FORM 10-K
(Mark One)
[X]ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d)
OF THE SECURITIES EXCHANGE ACT OF 1934
For the fiscal year ended December 31, 2000
OR
[_]TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d)
OF THE SECURITIES EXCHANGE ACT OF 1934
Commission file number 000-12477
AMGEN INC.
(Exact name of registrant as specified in its charter)
Delaware 95-3540776
(State or other jurisdiction of (I.R.S. Employer
incorporation or organization) Identification No.)
|
One Amgen Center Drive, Thousand Oaks, California 91320-1799
(Address of principal executive offices) (Zip Code)
805-447-1000
(Registrant's telephone number, including area code)
Securities registered pursuant to Section 12(g) of the Act:
Common stock, $0.0001 par value; preferred share purchase rights;
Contractual contingent payment rights
(Title of class)
Indicate by check mark whether the registrant (1) has filed all reports required to be filed by Section 13 or 15(d) of the Securities Exchange Act of 1934 during the preceding 12 months (or for such shorter period that the registrant was required to file such reports), and (2) has been subject to such filing requirements for the past 90 days. Yes [X] No [_]
Indicate by check mark if disclosure of delinquent filers pursuant to Item 405 of Regulation S-K is not contained herein, and will not be contained, to the best of registrant's knowledge, in definitive proxy or information statements incorporated by reference in Part III of this Form 10-K or any amendment to this Form 10-K. [_]
The approximate aggregate market value of voting and non-voting stock held by non-affiliates of the registrant was $74,135,056,000 as of February 15, 2001 (A)
1,041,537,659
(Number of shares of common stock outstanding as of February 15, 2001)
Documents incorporated by reference:
Form 10-K
Document Parts
-------- ---------
Definitive 2001 Proxy Statement, to be filed within
120 days of December 31, 2000 (specified portions).............. III
|
PART I
Item 1. BUSINESS
Overview
Amgen Inc. ("Amgen" or the "Company") is a global biotechnology company that discovers, develops, manufactures and markets human therapeutics based on advances in cellular and molecular biology.
The Company manufactures and markets four human therapeutic products, EPOGEN(R) (Epoetin alfa), NEUPOGEN(R) (Filgrastim), INFERGEN(R) (Interferon alfacon-1) and STEMGEN(R) (Ancestim). EPOGEN(R) stimulates the production of red blood cells and is marketed by Amgen in the United States for the treatment of anemia associated with chronic renal failure in patients on dialysis. NEUPOGEN(R) selectively stimulates the production of neutrophils, one type of white blood cell. The Company markets NEUPOGEN(R) in the United States, countries of the European Union ("EU"), Canada and Australia for use in decreasing the incidence of infection in patients undergoing myelosuppressive chemotherapy. In addition, NEUPOGEN(R) is marketed in most of these countries for use in reducing the duration of neutropenia for patients undergoing myeloablative therapy followed by bone marrow transplantation, for reducing symptoms in patients with severe chronic neutropenia, for supporting peripheral blood progenitor cell ("PBPC") transplants and for reducing the recovery time of neutrophils and the duration of fever following chemotherapy treatment in patients being treated for acute myelogenous leukemia ("AML"). NEUPOGEN(R) is also marketed in the EU, Canada and Australia for use in treating neutropenia in patients infected with the human immunodeficiency virus ("HIV") receiving antiviral and/or other myelosuppressive medications. INFERGEN(R) is a non- naturally occurring type-1 interferon which stimulates the immune system to fight viral infections and is indicated for the treatment of chronic hepatitis C viral infection. The Company sells INFERGEN(R) in the United States and Canada. STEMGEN(R) stimulates the production, mobilization and maturation of progenitor cells and is indicated for use in support of stem cell transplantation. The Company markets STEMGEN(R) in Canada and Australia.
The Company focuses its research and development efforts on human therapeutics delivered in the form of proteins, monoclonal antibodies and small molecules in the therapeutic areas of nephrology, cancer, inflammation and neurology and metabolism. The Company has research facilities in the United States and Canada and has clinical development staff in the United States, the EU, Canada, Australia, Japan and the People's Republic of China. In addition to internal research and development efforts, the Company has acquired certain product and technology rights and has established research and development collaborations.
Amgen operates commercial manufacturing facilities located in the United States, Puerto Rico and The Netherlands. A sales and marketing force is maintained in the United States, EU, Canada, Australia, New Zealand and the People's Republic of China. In addition, Amgen has entered into licensing and/or co-promotion agreements to market EPOGEN(R), NEUPOGEN(R) and INFERGEN(R) in certain geographic areas.
The Company was incorporated in California in 1980 and was merged into a Delaware corporation in 1987. Amgen's principal executive offices are located at One Amgen Center Drive, Thousand Oaks, California 91320-1799.
Products
Recombinant human erythropoietin
EPOGEN(R) (proper name--Epoetin alfa) is Amgen's registered trademark for its recombinant human erythropoietin product, a protein that stimulates red blood cell production. Red blood cells transport oxygen to all cells of the body. Without adequate amounts of erythropoietin, the red blood cell count is reduced, thereby diminishing the ability of the blood to deliver sufficient amounts of oxygen to the body, resulting in anemia. People with chronic renal failure suffer from anemia because they do not produce sufficient amounts of erythropoietin, which is normally produced in healthy kidneys. Amgen promotes EPOGEN(R) for the treatment
of anemia associated with chronic renal failure for patients who are on dialysis and is indicated to elevate or maintain the red blood cell level (as determined by hematocrit or hemoglobin measurements) and to decrease the need for blood transfusions in these patients.
In the United States, Amgen was granted rights to market recombinant human erythropoietin under a licensing agreement with Kirin-Amgen, Inc. ("Kirin- Amgen"), a joint venture between Kirin Brewery Company, Limited ("Kirin") and Amgen (see "Joint Ventures and Business Relationships--Kirin Brewery Company, Limited"). The Company began selling EPOGEN(R) in 1989 when the U.S. Food and Drug Administration ("FDA") approved its use in the treatment of anemia associated with chronic renal failure. In November 1999, the FDA approved EPOGEN(R) for the treatment of anemia in children with chronic renal failure who are on dialysis.
The Company has retained exclusive rights to market EPOGEN(R) in the United States for dialysis patients. Amgen has granted Ortho Pharmaceutical Corporation (which has assigned its rights under the Product License Agreement to Ortho Biotech Products, L.P.), a subsidiary of Johnson & Johnson, hereafter referred to as "Johnson & Johnson", a license to commercialize recombinant human erythropoietin as a human therapeutic in the United States in all markets other than dialysis. Johnson & Johnson markets recombinant human erythropoietin under the trademark PROCRIT(R) in the United States. See Note 1 to the Consolidated Financial Statements, "Summary of significant accounting policies--Product sales". In countries other than the United States, the People's Republic of China and Japan, Johnson & Johnson was granted rights to commercialize erythropoietin as a human therapeutic under a licensing agreement with Kirin-Amgen. Affiliates of Johnson & Johnson manufacture and market erythropoietin under the trademark EPREX(R) in various countries. See "Joint Ventures and Business Relationships--Johnson & Johnson".
In Japan and the People's Republic of China, Kirin was granted rights to market recombinant human erythropoietin under licensing agreements with Kirin- Amgen (see "Joint Ventures and Business Relationships-- Kirin Brewery Company, Limited"). Kirin manufactures and markets its recombinant human erythropoietin product under the trademark ESPO(R).
For EPOGEN(R) sales information for the years ended December 31, 2000, 1999 and 1998, see Note 10 to the Consolidated Financial Statements.
Recombinant-methionyl human granulocyte colony-stimulating factor
NEUPOGEN(R) (proper name--Filgrastim) is Amgen's registered trademark for its recombinant-methionyl human granulocyte colony-stimulating factor ("G- CSF"), a protein that selectively stimulates production of certain white blood cells known as neutrophils. Neutrophils are the body's first defense against infection. Treatments for various diseases and diseases themselves can result in extremely low numbers of neutrophils, a condition called neutropenia. Myelosuppressive chemotherapy, one treatment option for individuals with cancer, targets cell types which grow rapidly, such as tumor cells, neutrophils and other types of blood cells. Myelosuppressive chemotherapy can be administered with the intent to cure cancer (curative setting) or with the intent to reduce pain and other complications of cancer by shrinking the tumor (palliative setting). NEUPOGEN(R) is prescribed more frequently in the curative setting. Providing NEUPOGEN(R) as an adjunct to myelosuppressive chemotherapy can reduce the duration of neutropenia and thereby reduce the potential for infection.
Severe chronic neutropenia is an example of disease-related neutropenia. In severe chronic neutropenia, the body fails to manufacture sufficient neutrophils. Chronic administration of NEUPOGEN(R) has been shown to reduce the incidence and duration of neutropenia-related consequences, such as fever and infections, in patients with severe chronic neutropenia.
Patients undergoing bone marrow transplantation are treated with NEUPOGEN(R) to accelerate recovery of neutrophils following chemotherapy and bone marrow infusion. NEUPOGEN(R) also has been shown to induce
immature blood cells (progenitor cells, sometimes referred to as stem cells) to migrate (mobilize) from the bone marrow into the blood circulatory system. When these peripheral blood progenitor cells (PBPC) are collected from the blood, stored and re-infused (transplanted) after high dose chemotherapy, recovery of platelets, red blood cells and neutrophils is accelerated. PBPC transplantation may be an alternative to autologous bone marrow transplantation for some patients.
In the United States, NEUPOGEN(R) was initially indicated to decrease the incidence of infection as manifested by febrile neutropenia for patients with non-myeloid malignancies undergoing myelosuppressive chemotherapy. Subsequently, the FDA approved NEUPOGEN(R) for additional indications: to reduce the duration of neutropenia for patients with non-myeloid malignancies undergoing myeloablative therapy followed by bone marrow transplantation; to reduce the incidence and duration of neutropenia-related consequences in symptomatic patients with congenital neutropenia, cyclic neutropenia or idiopathic neutropenia (collectively, severe chronic neutropenia); for use in mobilization of PBPC for stem cell transplantation; and to reduce the recovery time of neutrophils and the duration of fever following chemotherapy treatment in patients being treated for AML. In the EU, Canada and Australia, NEUPOGEN(R) is marketed for the same indications.
The Company also markets NEUPOGEN(R) in the EU, Canada and Australia for the treatment of neutropenia in HIV patients receiving antiviral and/or other myelosuppressive medications. A trial for the treatment of neutropenia in HIV infected patients was completed and a supplemental licensing application for approval of this indication was submitted to the FDA in 1996. The FDA has raised concerns about whether this submission is approvable, and the Company cannot predict the outcome of discussions with the FDA.
The Company began selling NEUPOGEN(R) in the United States in February 1991 pursuant to a licensing agreement with Kirin-Amgen. Kirin markets GRAN(R), its G-CSF product, in Japan, the People's Republic of China, Taiwan and Korea under licensing agreements with Kirin-Amgen (see "Joint Ventures and Business Relationships--Kirin Brewery Company, Limited"). In the EU, NEUPOGEN(R) is commercialized by Amgen and F. Hoffmann-La Roche Ltd ("Roche") under a co- promotion agreement (see "Joint Ventures and Business Relationships--F. Hoffmann-La Roche Ltd"). In geographic areas of the world other than those above, Roche markets NEUPOGEN(R) under licenses from Amgen and Kirin-Amgen (see "Joint Ventures and Business Relationships--Kirin Brewery Company, Limited" and "Joint Ventures and Business Relationships--F. Hoffmann-La Roche Ltd").
For NEUPOGEN(R) sales information for the years ended December 31, 2000, 1999 and 1998, see Note 10 to the Consolidated Financial Statements.
Other products
INFERGEN(R) (proper name--Interferon alfacon-1) is Amgen's registered trademark for its recombinant consensus interferon, a non-naturally occurring protein that combines structural features of many interferon sub-types. Interferons are natural proteins produced by the body which stimulate the immune system to fight viral infections. Hepatitis C viral infection ("HCV") is a potentially deadly disease that, if not treated, may lead to cirrhosis and hepatocellular carcinoma, or liver cancer. The Company began selling INFERGEN(R) in the United States in October 1997. Amgen sells INFERGEN(R) for the treatment of adults with chronic HCV. INFERGEN(R) is approved for the treatment of newly diagnosed or previously untreated HCV patients for 24 weeks and for 48 weeks at a higher dose in patients who relapsed or failed to respond to initial interferon treatment. Amgen also sells INFERGEN(R) for the treatment of chronic HCV in Canada.
In 1996, Amgen licensed to Yamanouchi Pharmaceutical Co., Ltd. of Japan ("Yamanouchi") the rights to develop, manufacture and commercialize Interferon alfacon-1 for all indications around the world except in the United States and Canada. Yamanouchi granted rights to the Company to co-develop and market Interferon alfacon-1 in Japan, the People's Republic of China and Taiwan (see "Joint Ventures and Business Relationships--Yamanouchi Pharmaceutical Co., Ltd.").
STEMGEN(R) (proper name--Ancestim) is Amgen's registered trademark for its
recombinant-methionyl human stem cell factor. STEMGEN(R), when used in
combination with NEUPOGEN(R), has been shown to induce immature blood cells
(progenitor cells, sometimes referred to as stem cells) to migrate (mobilize)
from the bone marrow into the blood circulatory system. When these peripheral
blood progenitor cells (PBPC) are collected from the blood, stored and re-
infused (transplanted) after high dose chemotherapy, recovery of platelets, red
blood cells and neutrophils is accelerated. PBPC transplantation may be an
alternative to autologous bone marrow transplantation for some patients. In
1999, STEMGEN(R) was approved for use in support of stem cell transplantation
by the regulatory authorities in Canada, Australia and New Zealand. In 2000,
the Company withdrew its application to market STEMGEN(R) in the United States.
Discussions with other regulatory agencies are continuing. The Company is also
investigating the potential benefits of STEMGEN(R) for patients with aplastic
anemia in a phase 1/2 clinical trial.
Product Candidates
The Company focuses its research and development efforts on human therapeutics delivered in the form of proteins, monoclonal antibodies and small molecules in the therapeutic areas of nephrology, cancer, inflammation and neurology and metabolism (see "Factors That May Affect Amgen--Results of our product development are uncertain.").
Nephrology
ARANESP(TM) (proper name--darbepoetin alfa) is Amgen's registered trademark for its novel erythropoiesis stimulating protein, a protein that stimulates red blood cell production. In December 1999 and early 2000, the Company filed regulatory submissions for the use of ARANESP(TM) in patients with chronic renal insufficiency and chronic renal failure in the U.S., EU, Canada, Australia and New Zealand. Data from phase 3 clinical trials indicate that ARANESP(TM) permits less frequent dosing than Epoetin alfa in the treatment of anemia in patients with chronic renal insufficiency and chronic renal failure.
In April 1999, the Company announced that phase 2 clinical trials of darbepoetin alfa for the treatment of anemia resulting from chemotherapy had been initiated. Preliminary data from these clinical trials were presented in December 2000 and suggest that treatment of anemia with darbepoetin alfa in cancer patients receiving myelosuppressive chemotherapy may be effective given once weekly or once every three weeks. Phase 3 clinical trials of darbepoetin alfa for the treatment of anemia resulting from chemotherapy are ongoing.
The Company has entered into an agreement with Kirin to jointly develop darbepoetin alfa through its joint venture, Kirin-Amgen (see "Joint Ventures and Business Relationships--Kirin Brewery Company, Limited"). Amgen has been granted an exclusive license by Kirin-Amgen to manufacture and market darbepoetin alfa in the United States, all European countries, Canada, Australia, New Zealand, Mexico and all Central and South American countries. Kirin has been granted similar rights by Kirin-Amgen for Japan, the People's Republic of China, Taiwan, Korea and certain other countries in Southeast Asia.
A focus of the Company's effort in nephrology is in the area of hyperparathyroidism ("HPT"). HPT is a disorder that causes excessive secretion of parathyroid hormone ("PTH") from the parathyroid gland, leading to elevated serum calcium, called hypercalcemia. Symptoms of HPT include bone loss, muscle weakness, depression and forgetfulness. Secondary HPT is commonly seen as a result of kidney failure, affecting a majority of dialysis patients. Primary HPT primarily afflicts post-menopausal women. The Company has entered into a license agreement with NPS Pharmaceuticals, Inc. ("NPS") for Amgen to develop and commercialize NPS's calcimimetic small molecules based on NPS's proprietary calcium receptor technology for the treatment of HPT. The Company is in separate phase 2 clinical trials for primary and secondary HPT with a second generation calcimimetic compound. In 2000, data from phase 2 studies were presented suggesting that treatment with small-molecule calcimimetics results in dose-dependent decreases in PTH levels and may provide effective reduction of calcium levels.
Cancer
In March 1999, Amgen acquired the rights from PRAECIS PHARMACEUTICALS INCORPORATED ("Praecis") to develop and commercialize abarelix-depot (see "Joint Ventures and Business Relationships--PRAECIS PHARMACEUTICALS INCORPORATED"). Data from clinical trials suggest that abarelix-depot, a gonadotropin releasing hormone ("GnRH") antagonist, may inhibit the action of endogenous GnRH on the pituitary gland, thereby reducing the production of testosterone in men and estrogen in women. The reduction of testosterone or estrogen through the use of pharmaceuticals, a practice known as hormonal therapy, may confer a therapeutic benefit to patients with a number of diseases and medical conditions including prostate cancer and endometriosis. Abarelix- depot has completed phase 3 clinical trials in patients with hormonally- responsive prostate cancer and a regulatory file was submitted to the FDA in December 2000. In January 2001, this filing was accepted and granted priority review by the FDA. Abarelix-depot is also in a phase 2 clinical trial in patients with endometriosis, a painful gynecologic condition resulting from abnormal growth of uterine tissue, usually in the pelvic or abdominal area.
Amgen is developing a sustained duration version of G-CSF called SD/01. NEUPOGEN(R) is indicated to reduce the incidence of infections by reducing the duration and severity of neutropenia. Appropriate NEUPOGEN(R) doses are administered daily to be most effective. SD/01 is being developed to provide for less frequent dosing, possibly only once-per-cycle of chemotherapy, and thereby potentially improve compliance and patient satisfaction. In November 2000, the Company announced that phase 3 clinical trials of SD/01 to support breast cancer patients receiving multiple cycles of chemotherapy were successful.
In December 2000, Amgen acquired the rights from Immunomedics, Inc. to develop and commercialize epratuzumab. Epratuzumab is currently being evaluated for the treatment of non-Hodgkin's lymphoma ("NHL"). Epratuzumab is a humanized monoclonal antibody which apparently binds to the cell surface of many normal and most malignant B-cells, a type of white blood cell. Preliminary research and early-stage clinical trials suggest that epratuzumab may exert an anti- tumor activity. In the fourth quarter of 2000, a phase 3 clinical trial commenced to evaluate epratuzumab for the treatment of low-grade NHL in patients who failed to respond, or who responded for less than 6 months, to Rituximab, a monoclonal antibody (see "Competition--Cancer"). A phase 1/2 clinical trial of epratuzumab in combination with Rituximab to treat low-grade and aggressive NHL also is ongoing. A phase 1/2 clinical trial in patients with low-grade or aggressive NHL was completed in the fourth quarter of 2000.
Certain tissue growth factors are believed to play a role in tissue protection, regeneration and/or repair processes. Mucositis is a side effect often experienced by patients undergoing radiation therapy and chemotherapy and is characterized as the irritation or ulceration of the lining of the gastrointestinal tract. Amgen currently is conducting research with Keratinocyte Growth Factor ("KGF") as a prevention and treatment for mucositis. Phase 2 and 3 clinical trials of KGF in cancer patients suffering from mucositis are ongoing.
Osteoprotegerin ("OPG") is implicated in the regulation of bone mass. Bone mass is maintained in the body by the regulation of the competing activities of bone forming cells (osteoblasts) and bone resorbing cells (osteoclasts). Cancer metastases (cancers which have spread from their original tumor site) to bone cause bone destruction, leading to fractures and bone pain. In preclinical studies, OPG has been shown to inhibit the osteoclast mediated bone destruction induced by invading cancer cells. The Company's OPG program is in a phase 1 clinical trial in patients with bone metastases.
Inflammation
The inflammatory response is essential for defense against harmful microorganisms and for the repair of damaged tissues. The failure of the body's control mechanisms regulating inflammatory response occurs in conditions such as rheumatoid arthritis. Interleukin-1 receptor antagonist (proper name-- anakinra) and tumor necrosis factor binding protein were two product candidates added to the Company's inflammation research
program through the acquisition of Synergen, Inc. ("Synergen") (see "Joint Ventures and Business Relationships--Other business relationships").
In July 1999, the Company announced that a large, controlled phase 2 clinical trial of anakinra in combination with methotrexate demonstrated benefit over methotrexate alone for patients with rheumatoid arthritis. In December 1999, the Company filed a licensing application with the FDA for anakinra for the treatment of rheumatoid arthritis. Amgen plans to supplement this application with data from two additional clinical studies in the first quarter of 2001.
In April 1999, the Company announced that a phase 2 clinical trial of a second generation inhibitor of tumor necrosis factor, soluble tumor necrosis factor-receptor type I ("sTNF-RI"), was initiated in patients with rheumatoid arthritis.
In July 2000, the Company announced that a phase 1 clinical trial of anakinra in combination with sTNF-RI was initiated in patients with rheumatoid arthritis.
Neurology and Metabolism
In 1997, Amgen acquired the rights from Guilford Pharmaceuticals Inc. ("Guilford") for a novel class of small molecule, orally-active, neurotrophic agents called neuroimmunophilin compounds (see "Joint Ventures and Business Relationships--Other business relationships"). The neuroimmunophilin compounds are initially being developed to promote nerve regeneration and repair in neurodegenerative disorders. In July 2000, the Company initiated a phase 2 clinical trial with neuroimmunophilins in patients with Parkinson's disease.
Neurotrophic factors are proteins which play a role in nerve cell protection and regeneration and which may therefore be useful in treating a variety of neurological disorders, including neurodegenerative diseases of the central and peripheral nervous systems, nerve injury and trauma. In January 2001, all clinical development of brain-derived neurotrophic factor ("BDNF") that was being developed in collaboration with Regeneron Pharmaceuticals, Inc. ("Regeneron") (see "Joint Ventures and Business Relationships--Other business relationships") for the potential treatment of amyotrophic lateral sclerosis ("ALS") was discontinued following notification that BDNF did not provide a therapeutic advantage to ALS patients in clinical trials. On behalf of the collaboration with the Company, Regeneron is conducting clinical trials with Neurotrophin-3 ("NT-3") for the treatment of chronic constipation.
The Company is currently developing leptin, a protein encoded by the obesity gene. Leptin is made in fat cells and is believed to help regulate the amount of fat stored by the body. In 1995, the Rockefeller University granted to the Company an exclusive license which allows the Company to develop products based on the obesity gene. In October 1998, the Company announced the results of an interim analysis of preliminary three-month clinical data from two phase 2 clinical trials. This analysis revealed that there was no statistically significant difference in weight loss between native leptin and placebo for the study population as a whole. In April 1999, the Company announced that development of native leptin for both obesity and diabetes was being discontinued. The Company's leptin program now focuses on the development of second generation forms of leptin. The leptin program is in phase 2 clinical trials in obese subjects. Amgen has entered into a license agreement with Interneuron Pharmaceuticals, Inc. pursuant to which Amgen has been granted exclusive rights for the development and commercialization of products using leptin receptor technology.
Joint Ventures and Business Relationships
The Company generally intends to self-market its products. From time to time, the Company may enter into joint ventures and other business relationships to provide additional marketing and product development capabilities in certain countries. In addition to internal research and development efforts, the Company has acquired certain product and technology rights and has established research and development collaborations. Amgen has established the relationships described below and may establish others in the future.
F. Hoffmann-La Roche Ltd
Amgen and Roche have entered into an agreement providing for the commercialization of NEUPOGEN(R) (Filgrastim) in the EU. Under this agreement, the companies collaborate in the EU on the commercialization and further clinical development of the product, and Amgen has a majority share in the related costs and profits from sales. Amgen has most of the responsibilities for marketing, promotion, distribution and other key functions relating to product sales, and the Company distributes the product to EU countries from its European Logistics Center in Breda, The Netherlands. Amgen and Roche have also entered into another agreement to commercialize NEUPOGEN(R) in certain European countries not located within the EU. Under this agreement, Roche markets NEUPOGEN(R) in these countries and pays a royalty to Amgen on these sales. Amgen and Roche are also collaborating on the development of a second generation G-CSF product, SD/01, for the EU.
Johnson & Johnson
Amgen granted Johnson & Johnson a license to commercialize recombinant human erythropoietin as a human therapeutic in the United States in all markets other than dialysis. In countries other than the United States, the People's Republic of China and Japan, Johnson & Johnson was granted rights to commercialize recombinant human erythropoietin as a human therapeutic for all uses under a licensing agreement with Kirin-Amgen.
Kirin Brewery Company, Limited
The Company has a 50-50 joint venture (Kirin-Amgen) with Kirin. Kirin-Amgen, which was formed in 1984, develops and commercializes certain of the Company's and Kirin's technologies which have been transferred to this joint venture. Kirin-Amgen has given exclusive licenses to Amgen and Kirin to manufacture and market erythropoietin in the United States and Japan, respectively. Kirin-Amgen has licensed to Johnson & Johnson rights to erythropoietin in certain geographic areas of the world (see "--Johnson & Johnson"). Kirin-Amgen has also granted Amgen an exclusive license to manufacture and market G-CSF in the United States, Europe, Canada, Australia and New Zealand. Kirin-Amgen has licensed to Kirin similar rights with respect to G-CSF in Japan, Taiwan and Korea. Kirin markets recombinant human erythropoietin and recombinant-methionyl human granulocyte colony-stimulating factor in the People's Republic of China under a separate agreement. Kirin-Amgen and Roche have entered into an agreement to commercialize NEUPOGEN(R) in certain territories not covered by the various Amgen/Roche agreements (see "--F. Hoffmann-La Roche Ltd"). Under this agreement, Roche markets NEUPOGEN(R) in these countries and pays a royalty to Kirin-Amgen on these sales.
In 1996, Kirin-Amgen licensed to Amgen and Kirin the rights to develop and market darbepoetin alfa. Amgen has been granted an exclusive license by Kirin- Amgen to manufacture and market darbepoetin alfa in the United States, all European countries, Canada, Australia, New Zealand, Mexico and all Central and South American countries. Kirin has been licensed by Kirin-Amgen with similar rights for darbepoetin alfa in Japan, the People's Republic of China, Taiwan, Korea and certain other countries in Southeast Asia.
Pursuant to the terms of agreements entered into with Kirin-Amgen, the Company conducts certain research and development activities on behalf of Kirin-Amgen and is paid for such services at negotiated rates. Included in "Corporate partner revenues" in the Company's Consolidated Financial Statements for the years ended December 31, 2000, 1999 and 1998, are $221.0 million, $138.5 million and $121.0 million, respectively, related to these agreements.
In connection with its various license agreements with Kirin-Amgen, the Company pays Kirin-Amgen royalties based on sales. During the years ended December 31, 2000, 1999 and 1998, Kirin-Amgen earned royalties from Amgen of $140.8 million, $128.1 million and $105.0 million, respectively, under such agreements, which are included in "Cost of sales" in the Company's Consolidated Financial Statements.
Yamanouchi Pharmaceutical Co., Ltd.
In 1996, Amgen licensed to Yamanouchi the rights to develop, manufacture and commercialize Interferon alfacon-1 for the treatment of hepatitis C viral infection and any additional indications around the world except in the United States and Canada. Amgen sells Interferon alfacon-1 under the trademark INFERGEN(R) in the United States and Canada. Amgen has earned and will earn additional amounts if certain milestones are achieved by Yamanouchi and will receive royalties on sales. Yamanouchi has granted to Amgen K.K., the Company's Japanese subsidiary, certain co-development and co-promotion/co-marketing rights in Japan and has granted to Amgen Greater China, Ltd., Amgen's subsidiary in Hong Kong, certain co-development and co-promotion rights in the People's Republic of China and Taiwan.
PRAECIS PHARMACEUTICALS INCORPORATED
In March 1999, Amgen entered into a collaboration with Praecis relating to the development and commercialization of abarelix-depot. Amgen has been granted the exclusive right to commercialize abarelix-depot for all indications, including prostate cancer and endometriosis in the United States, Canada, Australia, Japan and several secondary markets. Amgen will conduct and pay for certain research, development and commercialization activities. In general, Praecis will receive a transfer price and royalty based on a sharing of the resulting profits on sales of abarelix products in the United States; Praecis will receive a royalty on net sales of abarelix products in Amgen's territories outside of the United States.
Other business relationships
In 1990, the Company entered into a collaboration agreement with Regeneron to co-develop and commercialize BDNF and NT-3 in the United States. To facilitate this collaboration, the Company and Regeneron formed Amgen-Regeneron Partners, a 50-50 partnership. In addition, Regeneron licensed these potential products to Amgen for development in certain other countries.
In 1994, the Company acquired Synergen, a biotechnology company. The acquisition of Synergen principally added its inflammation program to Amgen's product candidate pipeline. Synergen Clinical Partners, L.P. ("SCP"), the general partner of which was a subsidiary of Synergen, was formed to fund development and commercialization of anakinra in certain geographic areas. As a result of the acquisition of Synergen, the general partner of SCP became a subsidiary of Amgen. In connection with the settlement of certain litigation relating to Synergen and SCP, Amgen acquired all of the limited partnership units of SCP. Amgen may be required to pay future amounts to the former limited partners that were members of the plaintiff class, other members of the plaintiff class and their counsel if the FDA should grant approval to market anakinra (as more specifically defined in the related settlement agreement) and additional amounts if certain product revenues are realized.
In 1997, Amgen and Guilford entered into an agreement granting Amgen worldwide rights for Guilford's neuroimmunophilin compounds, a novel class of small molecule, orally-active, neurotrophic agents that may represent a new approach in the treatment of neurodegenerative disorders. Under the terms of the agreement, Amgen will receive worldwide rights to neuroimmunophilin compounds for all human therapeutic and diagnostic applications. Amgen will conduct and pay for all clinical development and manufacturing of products, market products worldwide and pay royalties to Guilford on such sales. In connection with this agreement, Amgen made an equity investment in Guilford.
Marketing
Amgen uses wholesale distributors of pharmaceutical products as the principal means of distributing the Company's products to clinics, hospitals and pharmacies. The Company monitors the financial condition of its larger distributors and seeks to limit its credit exposure by setting appropriate credit limits and requiring collateral from certain customers. Sales to two large wholesalers accounted for more than 10% of total revenues
for the years ended December 31, 2000, 1999 and 1998. Sales to one of these wholesalers, Bergen Brunswig Corporation, were $1,233.4 million, $1,078.0 million and $856.2 million for the years ended December 31, 2000, 1999 and 1998, respectively. Sales to the other wholesaler, Cardinal Distribution, were $445.2 million, $438.2 million and $366.5 million for the years ended December 31, 2000, 1999 and 1998, respectively.
Dialysis providers are primarily reimbursed for EPOGEN(R) by the federal government through the End Stage Renal Disease Program ("ESRD Program") of Medicare. The ESRD Program reimburses approved providers for 80% of allowed dialysis costs; the remainder is paid by other sources, including Medicaid, private insurance, and to a lesser extent, state kidney patient programs. The ESRD Program reimbursement rate is established by Congress and is monitored by the Health Care Financing Administration ("HCFA"). Changes in coverage and reimbursement policies could have a material adverse effect on EPOGEN(R) sales (see "Factors That May Affect Amgen--Our sales depend on reimbursement and third party payors.").
NEUPOGEN(R) is reimbursed by both private and public payors, and changes in coverage and reimbursement policies of these payors could have a material adverse effect on sales of NEUPOGEN(R) (see "Factors That May Affect Amgen--Our sales depend on reimbursement and third party payors.").
In the EU, Amgen and Roche share commercialization responsibilities for NEUPOGEN(R) under a co-promotion agreement (see "Joint Ventures and Business Relationships--F. Hoffmann-La Roche Ltd"). NEUPOGEN(R) is principally distributed to wholesalers and/or hospitals in all EU countries depending upon the distribution practice for products in each country. Most patients receiving NEUPOGEN(R) for approved indications are covered by government health care programs. Generally, the use of NEUPOGEN(R) is affected by EU government pressures on physician prescribing practices in response to ongoing government initiatives to reduce health care expenditures, and to a lesser extent, competition.
In Canada and Australia, NEUPOGEN(R) is marketed by the Company directly to hospitals, pharmacies and medical practitioners. Distribution is handled by third party contractors.
INFERGEN(R) is sold by the Company in the United States and Canada. INFERGEN(R) is reimbursed through both private and public sources, with primary reimbursement through private payors.
STEMGEN(R) is marketed by the Company directly to hospitals, pharmacies and medical practitioners in Canada and Australia. Distribution is handled by third party contractors.
Competition
Competition among biotechnology, pharmaceutical and other companies that research, develop, manufacture or market pharmaceuticals is intense and is expected to increase. See "Factors That May Affect Amgen--We face competition". Some competitors, principally large pharmaceutical companies, have greater clinical, research, regulatory and marketing resources and experience than the Company, particularly in the area of small molecule therapeutics. In addition, certain specialized biotechnology firms have entered into cooperative arrangements with major companies for development and commercialization of products, creating an additional source of competition. The Company faces product competition from firms in the United States, countries of the EU, Canada, Australia and elsewhere. Additionally, some of the Company's competitors, including biotechnology and pharmaceutical companies, are actively engaged in the research and development in areas where the Company is also developing product candidates, as more fully discussed below.
The introduction of new products or the development of new processes by competitors or new information about existing products may result in product replacements or price reductions, even for products protected by patents. In addition, the timing of entry of a new product into the market can be an important factor in determining the product's eventual success and profitability. Early entry may have important advantages in gaining product acceptance and market share. Accordingly, in some cases, the relative speed with which the Company can develop products, complete the testing and approval process and supply commercial quantities of
the product to the market is expected to be important to Amgen's competitive position. Competition among pharmaceutical products approved for sale also may be based on, among other things, patent position, product efficacy, safety, reliability, availability and price.
A significant amount of research and development in the biotechnology industry is conducted by small companies, academic institutions, governmental agencies and other public and private research organizations. These entities may seek patent protection and enter into licensing arrangements to collect royalties for use of technology or for the sale of products they have discovered or developed. Amgen also may face competition in its licensing or acquisition activities from pharmaceutical companies and large biotechnology companies that also seek to acquire technologies or product candidates from these entities. Accordingly, the Company may have difficulty acquiring technologies or product candidates on acceptable terms. Additionally, the Company competes with these entities and with pharmaceutical and biotechnology companies to attract and retain qualified scientific and technical personnel.
Nephrology
Any products or technologies that are directly or indirectly successful in addressing anemia could negatively impact the market for EPOGEN(R) or for ARANESP(TM). ARANESP(TM) will directly compete with other currently marketed products which treat anemia, including EPOGEN(R) and the recombinant human erythropoietin product marketed by Johnson & Johnson (see "Products-- Recombinant human erythropoietin"). Aventis S.A. ("Aventis") is developing gene-activated erythropoietin for the treatment of anemia (see "Item 3. Legal Proceedings--Transkaryotic Therapies and Aventis S.A. litigation").
The calcimimetic program could face competition from products currently marketed by Abbott Laboratories, Bone Care International, Inc., Genzyme Corporation and Roche which treat secondary HPT. In addition, another product to treat HPT is currently being developed by Chugai Pharmaceuticals Co., Ltd. ("Chugai").
Cancer
Any products or technologies that are directly or indirectly successful in addressing the causes or incidence of low levels of neutrophils could negatively impact the market for G-CSF. These include products that could receive approval for indications similar to those for which NEUPOGEN(R) has been approved, development of chemotherapy treatments that are less myelosuppressive than existing treatments and the availability of anti-cancer modalities that reduce the need for myelosuppressive chemotherapy. NEUPOGEN(R) currently faces market competition from a competing CSF product, granulocyte macrophage colony stimulating factor ("GM-CSF") and from the chemoprotectant, amifostine. Potential future sources of competition include other G-CSF products, GM-CSF products, FLT-3 ligand, myelopoietin, PGG-glucan, promegapoietin, and progenipoietin, among others.
Chugai markets a G-CSF product in Japan as an adjunct to chemotherapy and as a treatment for BMT patients. Chugai and Aventis market a G-CSF product in certain EU countries as an adjunct to chemotherapy and as a treatment in BMT settings. Chugai, through its licensee, AMRAD, markets this G-CSF product in Australia as an adjunct to chemotherapy and as a treatment for BMT patients. Under an agreement with Amgen, Chugai is precluded from selling its G-CSF product in the United States, Canada and Mexico.
Immunex Corporation ("Immunex") markets GM-CSF in the United States for BMT and PBPC transplant patients and as an adjunct to chemotherapy treatments for acute non-lymphocytic leukemia ("ANLL") and AML. Immunex is also pursuing other indications for its GM-CSF product including as an adjunct to chemotherapy outside the limited settings of ANLL and AML. Novartis AG markets another GM- CSF product for use in BMT patients and as an adjunct to chemotherapy in the EU and certain other countries. This GM-CSF product is currently being developed for similar indications in the United States and Canada. Nartograstim, a modified G-CSF protein, is sold by Kyowa Hakko Kogyo Co., Ltd. in Japan.
Other products which address potential markets for G-CSF may be identified and developed by competitors in the future. Such products could also present competition in markets for STEMGEN(R) and potential markets for SD/01.
Abarelix-depot could face competition from products currently marketed by TAP Pharmaceuticals, Inc. and AstraZeneca PLC which treat prostate cancer and/or endometriosis. In addition, other products to treat prostate cancer are currently approved, but not yet marketed, by Pharmacia Corporation and Bayer Corporation. Other products to treat prostate cancer are being developed by ASTA Medica AG, Atrix Laboratories, Inc. and Sanofi-Synthelabo.
NHL is primarily treated with standard chemotherapy agents, monoclonal antibodies, or a combination of the two modalities. Epratuzumab could face competition from Rituximab, another monoclonal antibody marketed jointly by Genentech, Inc. and Idec Pharmaceuticals Corporation. However, it is also possible that Epratuzumab may be used in combination with Rituximab (see "Product candidates--Cancer"). In addition, other monoclonal antibodies are being investigated for the treatment of NHL including those in development by GlaxoSmithKline plc (in collaboration with Beckman Coulter, Inc.) and Idec Pharmaceuticals Corporation.
Many companies are developing products that promote wound healing, soft tissue regeneration and chemoprotection. Companies such as Human Genome Sciences, Inc., Genetics Institute, Inc., U.S. Bioscience, Inc./MedImmune, Inc., IntraBiotics Pharmaceuticals, Inc. and ALZA Corporation are currently among many companies that are developing products which could be potential competitors for KGF.
The OPG program could face competition from a product currently marketed by Novartis AG for the treatment of cancer metastases to the bone.
Inflammation
Anakinra and sTNF-RI could face competition from a number of companies developing or marketing rheumatoid arthritis treatments. Current anti-arthritic treatments include generic methotrexate and other products marketed by Centocor, Inc./Johnson & Johnson, Immunex/American Home Products Corporation, Merck & Co., Inc., Pharmacia Corporation, Novartis AG and Sanofi-Synthelabo. In addition, a number of companies have cytokine inhibitors in development including Abbott Laboratories, GlaxoSmithKline plc and Taisho Pharmaceutical Co., Ltd.
Neurology and Metabolism
Several companies are developing neurotrophic factors that could compete with the neuroimmunophilin program or NT-3. These companies include Abbott Laboratories, Astra AB, Cephalon Inc., Kosan Biosciences Inc., Regeneron, Schering AG, SIBIA Neurosciences, Inc./Merck & Co., Inc. and Vertex Pharmaceuticals Incorporated.
Many companies currently market or are believed to be developing obesity treatments that could compete with the leptin program. Potential future competitors include Millennium Pharmaceuticals, Inc. (in collaboration with Roche), Neurogen Corporation (in collaboration with Pfizer Inc.), Bristol Myers Squibb Company, Novartis AG, Eli Lilly and Company and Merck & Co., Inc. Knoll AG and Roche currently market obesity treatments in various countries.
Other
INFERGEN(R) competes with other interferons and related products, several of which are in development or on the market. Schering-Plough Corporation and Roche are major suppliers of interferons. The Company cannot predict the extent to which it will maintain its share or further penetrate this market. Interferon Sciences, Inc. could be a potential competitor in this arena.
Research and Development
The Company's primary sources of new product candidates are internal research and acquisition and licensing from third parties. Amgen's internal research capabilities include an expertise in secreted protein therapeutics. The Company's discovery program may yield targets that lead to the development of therapeutics delivered as proteins, small molecules or monoclonal antibodies. Amgen has only recently entered the small molecule field. To supplement its small molecule discovery program, in December 2000, Amgen acquired Kinetix Pharmaceuticals, Inc. ("Kinetix"), a privately held company that focused on the discovery of small molecule drugs that inhibit protein kinases, a key class of biological regulators (see Note 11 to the Consolidated Financial Statements). Research and development expenses for the years ended December 31, 2000, 1999 and 1998 were $845.0 million, $822.8 million and $663.3 million, respectively. Additionally, the Company recorded a $30.1 million write-off of acquired in-process research and development during the year ended December 31, 2000 arising from the acquisition of Kinetix (see Note 4 to the Consolidated Financial Statements).
Government Regulation
Regulation by governmental authorities in the United States and other countries is a significant factor in the production and marketing of the Company's products and its ongoing research and development activities (see "Factors That May Affect Amgen--Our operations are significantly regulated.").
In order to clinically test, manufacture and market products for therapeutic use, Amgen must satisfy mandatory procedures and safety and effectiveness standards established by various regulatory bodies. In the United States, the Federal Food, Drug, and Cosmetic Act, as amended, and the regulations promulgated thereunder, and other federal and state statutes and regulations govern, among other things, the testing, manufacture, labeling, storage, record keeping, approval, advertising and promotion of the Company's products on a product-by-product basis. Product development and approval within this regulatory framework take a number of years and involve the expenditure of substantial resources. After laboratory analysis and preclinical testing in animals, an investigational new drug application is filed with the FDA to begin human testing. Typically, a three-phase human clinical testing program is then undertaken. In phase 1, small clinical trials are conducted to determine the safety of the product. In phase 2, clinical trials are conducted to assess safety, acceptable dose and gain preliminary evidence of the efficacy of the product. In phase 3, clinical trials are conducted to provide sufficient data for the statistically valid proof of safety and efficacy. The time and expense required to perform this clinical testing can vary and is substantial. No action can be taken to market any new drug or biologic product in the United States until an appropriate marketing application has been approved by the FDA. Even after initial FDA approval has been obtained, further clinical trials may be required to provide additional data on safety and effectiveness and are required to gain clearance for the use of a product as a treatment for indications other than those initially approved. In addition, side effects or adverse events that are reported during clinical trials can delay, impede, or prevent marketing approval. Similarly, adverse events that are reported after marketing approval can result in additional limitations being placed on the product's use and, potentially, withdrawal of the product from the market. Any adverse event, either before or after marketing approval, can result in product liability claims against the Company.
In addition to regulating and auditing human clinical trials, the FDA regulates and inspects equipment, facilities and processes used in the manufacturing of such products prior to providing approval to market a product. If after receiving clearance from the FDA, a material change is made in manufacturing equipment, location or process, additional regulatory review may be required. The Company also must adhere to current Good Manufacturing Practice and product-specific regulations enforced by the FDA through its facilities inspection program. The FDA also conducts regular, periodic visits to re-inspect equipment, facilities and processes following the initial approval. If, as a result of these inspections, the FDA determines that the Company's equipment, facilities or processes do not comply with applicable FDA regulations and conditions of product approval, the FDA may seek civil, criminal, or administrative sanctions and/or remedies against Amgen, including the suspension of the Company's manufacturing operations.
In the EU countries, Canada and Australia, regulatory requirements and
approval processes are similar in principle to those in the United States.
Additionally, depending on the type of drug for which approval is sought, there
are currently two potential tracks for marketing approval in the EU countries:
mutual recognition and the centralized procedure. These review mechanisms may
ultimately lead to approval in all EU countries, but each method grants all
participating countries some decision making authority in product approval.
The Company is also subject to various federal and state laws pertaining to health care "fraud and abuse", including anti-kickback laws and false claims laws. Anti-kickback laws make it illegal for a prescription drug manufacturer to solicit, offer, receive or pay any remuneration in exchange for, or to induce, the referral of business, including the purchase or prescription of a particular drug. The federal government has published regulations that identify "safe harbors" or exemptions for certain payment arrangements that do not violate the anti-kickback statutes. The Company seeks to comply with the safe harbors where possible. Due to the breadth of the statutory provisions and the absence of guidance in the form of regulations or court decisions addressing some of the Company's practices, it is possible that the Company's practices might be challenged under anti-kickback or similar laws. False claims laws prohibit anyone from knowingly and willingly presenting, or causing to be presented for payment to third party payors (including Medicare and Medicaid) claims for reimbursed drugs or services that are false or fraudulent, claims for items or services not provided as claimed, or claims for medically unnecessary items or services. Amgen's activities relating to the sale and marketing of its products may be subject to scrutiny under these laws. Violations of fraud and abuse laws may be punishable by criminal and/or civil sanctions, including fines and civil monetary penalties, as well as the possibility of exclusion from federal health care programs (including Medicare and Medicaid). If the government were to allege against or convict the Company of violating these laws, there could be a material adverse effect on the Company, including its stock price. The Company's activities could be subject to challenge for the reasons discussed above and due to the broad scope of these laws and the increasing attention being given to them by law enforcement authorities.
Since 1991, the Company has participated in the Medicaid rebate program established by the Omnibus Budget Reconciliation Act of 1990, and under amendments of that law that became effective in 1993, participation has included extending comparable discounts under the Public Health Service ("PHS") pharmaceutical pricing program. Under the Medicaid rebate program, the Company pays a rebate for each unit of its product reimbursed by Medicaid. The amount of the rebate for each product is set by law as a minimum 15.1% of the average manufacturer price ("AMP") of that product, or if it is greater, the difference between AMP and the best price available from the Company to any customer. The rebate amount also includes an inflation adjustment if AMP increases faster than inflation. The PHS pricing program extends discounts comparable to the Medicaid rebate to a variety of community health clinics and other entities that receive health services grants from the PHS, as well as hospitals that serve a disproportionate share of poor Medicare and Medicaid beneficiaries. The rebate amount is recomputed each quarter based on the Company's reports of its current average manufacturer price and best price for each of its products to HCFA. The terms of the Company's participation in the program impose an obligation to correct the prices reported in previous quarters, as may be necessary. Any such corrections could result in an overage or underage in the Company's rebate liability for past quarters, depending on the direction of the correction. In addition to retroactive rebates (and interest, if any), if the Company were found to have knowingly submitted false information to the government, in addition to other penalties available to the government, the statute provides for civil monetary penalties in the amount of $100,000 per item of false information.
The Company also makes its products available to authorized users of the Federal Supply Schedule ("FSS") of the General Services Administration. Since 1993, as a result of the Veterans Health Care Act of 1992 (the "VHC Act"), federal law has required that product prices for purchases by the Veterans Administration, the Department of Defense, Coast Guard and the PHS (including the Indian Health Service) be discounted by a minimum of 24 percent off the AMP to non-federal customers (the non-federal average manufacturer price, "non- FAMP"). The Company's computation and report of non-FAMP is used in establishing the price, and the accuracy of the reported non-FAMP may be audited by the government under
applicable federal procurement laws. Among the remedies available to the government for infractions of these laws is recoupment of any overages paid by FSS users during the audited years. In addition, if the Company were found to have knowingly reported a false non-FAMP, the VHC Act provides for civil monetary penalties of $100,000 per item that is incorrect.
Amgen is also subject to regulation under the Occupational Safety and Health Act, the Toxic Substances Control Act, the Resource Conservation and Recovery Act and other current and potential future federal, state or local regulations. The Company's research and development activities involve the controlled use of hazardous materials, chemicals, biological materials and various radioactive compounds. The Company believes that its procedures comply with the standards prescribed by state and federal regulations; however, the risk of injury or accidental contamination cannot be completely eliminated. Amgen's research and manufacturing activities also are conducted in voluntary compliance with the National Institutes of Health Guidelines for Recombinant DNA Research.
Additionally, the U.S. Foreign Corrupt Practices Act, to which the Company is subject, prohibits corporations and individuals from engaging in certain activities to obtain or retain business or to influence a person working in an official capacity. It is illegal to pay, offer to pay, or authorize the payment of anything of value to any foreign government official, government staff member, political party or political candidate in an attempt to obtain or retain business or to otherwise influence a person working in an official capacity. The Company's present and future business has been and will continue to be subject to various other laws and regulations.
Patents and Trademarks
Patents are very important to the Company in establishing proprietary rights to the products it has developed or licensed. The patent positions of pharmaceutical and biotechnology companies, including the Company, can be uncertain and involve complex legal, scientific and factual questions. See "Factors That May Affect Amgen--Intellectual property and legal matters can affect our business.".
The Company has filed applications for a number of patents and has been granted patents relating to its erythropoietin, G-CSF, darbepoetin alfa, consensus interferon and various potential products. In the United States, the U.S. Patent and Trademark Office (the "USPTO") has issued to the Company patents relating to erythropoietin that generally cover DNA and host cells (issued in 1987); processes for making erythropoietin (issued in 1995 and 1997); certain product claims to erythropoietin (issued in 1996 and 1997); cells that make certain levels of erythropoietin (issued in 1998); and pharmaceutical compositions of erythropoietin (issued in 1999). These patents have varying expiration dates, with the latest erythropoietin related patents expiring in 2015; all other patents expire earlier. The USPTO has also issued to the Company patents relating to aspects of DNAs, vectors, cells and processes relating to recombinant G-CSF (issued in 1989); other aspects of DNAs, vectors, cells and processes relating to recombinant G-CSF (issued in 1991); G-CSF polypeptides (issued in 1996); methods of treatment using G-CSF polypeptides (issued in 1996); methods of enhancing bone marrow transplantation and treating burn wounds (issued in 1997); methods for recombinant production of G-CSF (issued in 1998); and analogs of G-CSF (issued in 1999). The last to issue G-CSF patents expire in 2014; all other patents expire earlier. Additionally, U.S. patents pertaining to pegylated G-CSF (SD/01) expire in 2015. The patent relating to erythropoietin for the EU expires in 2004. The patent relating to G-CSF for the EU expires in 2006. The Company has two patents in the EU relating to darbepoetin alfa and hyperglycosylated erythropoietic proteins which expire in 2010 and 2014, respectively.
There can be no assurance that Amgen's patents or licensed patents will afford legal protection against competitors or provide significant proprietary protection or competitive advantage. In addition, Amgen's patents or licensed patents could be held invalid or unenforceable by a court, or infringed or circumvented by others, or others could obtain patents that the Company would need to license or circumvent. Competitors or potential competitors may have filed patent applications or received patents, and may obtain additional patents and proprietary rights relating to proteins, small molecules, compounds or processes competitive with those of the
Company. Additionally, for certain of the Company's product candidates, competitors or potential competitors may claim that their existing or pending patents prevent the Company from commercializing such product candidates in certain territories.
In general, the Company has obtained licenses from various parties which it deems to be necessary or desirable for the manufacture, use or sale of its products. These licenses generally require Amgen to pay royalties to the parties on product sales. In addition, other companies have filed patent applications or have been granted patents in areas of interest to the Company. There can be no assurance any licenses required under such patents will be available for license on acceptable terms or at all. The Company is engaged in various legal proceedings relating to certain of its patents. See "Item 3. Legal Proceedings".
Trade secret protection for its unpatented confidential and proprietary information is important to Amgen. To protect its trade secrets, the Company generally requires its employees, material consultants, scientific advisors and parties to collaboration and licensing agreements to execute confidentiality agreements upon the commencement of employment, the consulting relationship or the collaboration or licensing arrangement with the Company. However, others could either develop independently the same or similar information or obtain access to Amgen's proprietary information.
The Company has obtained U.S. registration of its EPOGEN(R), NEUPOGEN(R), INFERGEN(R) and STEMGEN(R) trademarks. In addition, these trademarks have been registered in other countries.
Manufacturing and Raw Materials
Amgen has manufacturing facilities which produce commercial quantities of Epoetin alfa, NEUPOGEN(R) (Filgrastim), INFERGEN(R) (Interferon alfacon-1) and STEMGEN(R) (Ancestim) (see "Item 2. Properties"). The Company additionally supplies Epoetin alfa to Johnson & Johnson under a supply agreement. There can be no assurance that the Company will be able to accurately anticipate future demand for Epoetin alfa, NEUPOGEN(R), INFERGEN(R) and STEMGEN(R) or maintain adequate manufacturing capacity (see "Factors That May Affect Amgen--We plan to grow rapidly.").
Certain raw materials necessary for the Company's commercial manufacturing of its products are proprietary products of other companies, and in some cases, such proprietary products are specifically cited in the Company's drug application with the FDA such that they must be obtained from that specific, sole source. The Company currently attempts to manage the risk associated with such sole sourced raw materials by active inventory management and alternate source development, where feasible. Amgen attempts to remain apprised of the financial condition of its suppliers, their ability to supply the Company's needs and the market conditions for these raw materials. Also, certain of the raw materials required in the commercial manufacturing of the Company's products are derived from biological sources. The Company is investigating screening procedures with respect to certain biological sources and alternatives to them. Raw materials may be subject to contamination and/or recall. A material shortage, contamination and/or recall could adversely impact or disrupt Amgen's commercial manufacturing of its products.
Human Resources
As of December 31, 2000, the Company had approximately 7,300 employees, of which approximately 3,800 were engaged in research and development, approximately 1,500 were engaged in sales and marketing and approximately 2,000 were engaged in other activities. There can be no assurance that the Company will be able to continue attracting and retaining qualified personnel in sufficient numbers to meet its needs. None of the Company's employees are covered by a collective bargaining agreement, and the Company has experienced no work stoppages. The Company considers its employee relations to be good.
Executive Officers of the Registrant
The executive officers of the Company, their ages as of March 1, 2001 and positions are as follows:
Mr. Kevin W. Sharer, age 52, has served as a director of the Company since November 1992. He became Chief Executive Officer and President in May 2000 and Chairman of the Board in December 2000, having served as President and Chief Operating Officer since October 1992. Prior to joining the Company, Mr. Sharer served as President of the Business Markets Division of MCI Communications Corporation, a telecommunications company, from April 1989 to October 1992, and served in numerous executive capacities at General Electric Company from February 1984 to March 1989. Mr. Sharer also serves as a director of Unocal Corporation.
Mr. Stan M. Benson, age 49, has served as Senior Vice President, Sales and Marketing, since joining the Company in June 1995. Prior to joining the Company, Mr. Benson held a number of executive management positions at Pfizer Inc., a pharmaceutical company, from June 1976 to June 1995.
Dr. Fabrizio Bonanni, age 54, has served as Senior Vice President, Quality and Compliance, since joining the Company in April 1999. Prior to joining the Company, Dr. Bonanni had been the Corporate Vice President for Regulatory/Clinical Affairs for Baxter International Inc. ("Baxter"), a pharmaceutical company, from December 1997 to April 1999, Corporate Vice President, Quality System from November 1994 to December 1997, and has held a variety of quality, regulatory and manufacturing positions with Baxter in Europe and in the U.S. since 1974.
Ms. Kathryn E. Falberg, age 40, became Senior Vice President, Finance and Corporate Development, and Chief Financial Officer in August 2000, having served as Senior Vice President, Finance and Chief Financial Officer since December 1998, as Vice President, Finance, Chief Financial Officer and Chief Accounting Officer since May 1998 and as Vice President, Corporate Controller and Chief Accounting Officer from June 1997 to May 1998. Previously, Ms. Falberg had served as Vice President and Treasurer from December 1996 to June 1997, and as Treasurer since joining the Company in January 1995.
Dr. Dennis M. Fenton, age 49, became Executive Vice President, in March 2000, having served as Senior Vice President, Operations, since January 1995, having served as Senior Vice President, Sales and Marketing, from August 1992 to January 1995, and having served as Vice President, Process Development, Facilities and Manufacturing Services, from July 1991 to August 1992. Dr. Fenton previously had served as Vice President, Pilot Plant Operations and Clinical Manufacturing, from October 1988 to July 1991, and as Director, Pilot Plant Operations, from 1985 to October 1988.
Mr. George J. Morrow, age 48, became Executive Vice President of Worldwide Sales and Marketing, in January 2001. Prior to joining the Company, from January 1999 until December 2000, Mr. Morrow was President and Chief Executive Officer of Glaxo Wellcome Inc. ("Glaxo"), a subsidiary of GlaxoSmithKline plc. From January 1997 until December 1998, Mr. Morrow was Managing Director of Glaxo Wellcome U.K., also a subsidiary GlaxoSmithKline plc. From May 1993 until December 1996, Mr. Morrow was Group Vice President for Commercial Operations of Glaxo.
Dr. George Morstyn, age 50, became Senior Vice President, Development and Chief Medical Officer in October 1999, having served as Vice President, Product Development and Chief Medical Officer since June 1998 and as Vice President, Clinical Development and Chief Medical Officer from September 1993 to June 1998. Dr. Morstyn previously served as Vice President, Clinical and Medical Affairs from July 1991 to September 1993.
Mr. Steven M. Odre, age 51, became Senior Vice President, General Counsel and Secretary in March 2000, having served as Vice President, Intellectual Property, and Associate General Counsel since October 1988, and having served as Associate General Counsel from March 1988 to October 1988. From May 1986 to March 1988, he served as Director of Intellectual Property.
Dr. Roger M. Perlmutter, age 48, became Executive Vice President of Research and Development in January 2001. Prior to joining the Company, from July 1999 until December 2000, Dr. Perlmutter was Executive Vice President, Worldwide Basic Research and Preclinical Development of Merck Research Laboratories ("Merck"). From February 1999 until July 1999, Dr. Perlmutter was Executive Vice President of Merck. From February 1997 until January 1999, Dr. Perlmutter was Senior Vice President of Merck. Prior to February 1997, Dr. Perlmutter was Chairman of the Department of Immunology, University of Washington from May 1989 until January 1997, Professor in the Departments of Immunology, Biochemistry and Medicine, University of Washington from January 1991 until January 1997 and Investigator, the Howard Hughes Medical Institute at the University of Washington from October 1991 until January 1997.
Mr. Barry D. Schehr, age 45, became Vice President, Financial Operations and Chief Accounting Officer in May 2000, having served as Vice President, Accounting and Financial Operations since March 2000 and as Director of Internal Audit from February 1997 to February 2000. Prior to joining the Company, Mr. Schehr had been a partner with Ernst & Young LLP, an accounting firm, from October 1989 to January 1997.
Geographic Area Financial Information
For financial information concerning the geographic areas in which the Company operates, see Note 10 to the Consolidated Financial Statements.
Factors That May Affect Amgen
Amgen operates in a rapidly changing environment that involves a number of risks, some of which are beyond our control. The following discussion highlights some of these risks and others are discussed elsewhere in this Form 10-K.
Results of our product development are uncertain.
We intend to continue an aggressive product development program. Successful product development in the biotechnology industry is highly uncertain, and very few research and development projects produce a commercial product. Product candidates that appear promising in the early phases of development, such as in early human clinical trials, may fail to reach the market for a number of reasons, such as:
-- the product candidate did not demonstrate acceptable clinical trial results even though it demonstrated positive preclinical trial results
-- the product candidate was not effective in treating a specified condition or illness
-- the product candidate had harmful side effects on humans
-- the necessary regulatory bodies (such as the FDA) did not approve our product candidate for an indicated use
-- the product candidate was not economical for us to manufacture it
-- other companies or people have or may have proprietary rights to our product candidate (e.g. patent rights) and will not let us sell it on reasonable terms, or at all
-- the product candidate is not cost effective in light of existing therapeutics
Several of our product candidates have failed at various stages in the product development process, including BDNF, Megakaryocyte Growth and Development Factor (MGDF) and glial cell-line derived neurotrophic factor (GDNF). For example, in 1997, we announced the failure of BDNF (for the treatment of ALS by subcutaneous injection administration route), because the product candidate, as administered, did not produce acceptable clinical results in a specific indication after a phase 3 trial, even though BDNF had progressed successfully through preclinical and earlier clinical trials. In addition, some of our other product
candidates have failed in clinical trials. Of course, there may be other factors that prevent us from marketing a product. We cannot guarantee we will be able to produce commercially successful products. Further, clinical trial results are frequently susceptible to varying interpretations by scientists, medical personnel, regulatory personnel, statisticians and others which may delay, limit or prevent further clinical development or regulatory approvals of a product candidate. Also, the length of time that it takes for us to complete clinical trials and obtain regulatory approval for product marketing has in the past varied by product and by the indicated use of a product. We expect that this will likely be the case with future product candidates and we cannot predict the length of time to complete necessary clinical trials and obtain regulatory approval. See "--Our operations are significantly regulated."
Our operations are significantly regulated.
Our research, preclinical testing, clinical trials, facilities, manufacturing, pricing and sales and marketing are subject to extensive regulation by numerous state and federal governmental authorities in the U.S., such as the FDA and the Health Care Financing Administration ("HCFA"), as well as by foreign countries and the European Union (the "EU"). Currently, we are required in the U.S. and in foreign countries to obtain approval from those countries' regulatory authorities before we can market and sell our products in those countries. The success of our current and future products will depend in part upon obtaining and maintaining regulatory approval to market products in approved indications in the U.S. and foreign markets. In our experience, the regulatory approval process is a lengthy and complex process, both in the U.S. and in foreign countries, including countries in the EU. Even if we obtain regulatory approval, both our manufacturing processes and our marketed products are subject to continued review. Later discovery of previously unknown problems with our products or manufacturing processes may result in restrictions on such products or manufacturing processes, including withdrawal of the products from the market. If we fail to obtain necessary approvals, or if any prior approvals are restricted, suspended or revoked, or if we fail to comply with regulatory requirements, then regulatory authorities could prevent us from manufacturing or selling our products which could have a material adverse effect on us and our results of operations.
Our sales depend on reimbursement and third party payors.
In both domestic and foreign markets, sales of our products are dependent, in part, on the availability of reimbursement from third party payors such as state and federal governments (for example, under Medicare and Medicaid programs in the U.S.) and private insurance plans. In certain foreign markets, the pricing and profitability of our products generally are subject to government controls. In the U.S., there have been, and we expect there will continue to be, a number of state and federal proposals that limit the amount that state or federal governments will pay to reimburse the cost of drugs. In addition, we believe the increasing emphasis on managed care in the U.S. has and will continue to put pressure on the price and usage of our products, which may impact product sales. Further, when a new therapeutic is approved, the reimbursement status and rate of such a product is uncertain. For example, we believe that sales of ARANESP(TM) will be affected by government and private payor reimbursement policies. In addition, current reimbursement policies for existing products may change at any time. Changes in reimbursement or our failure to obtain reimbursement for our products may reduce the demand for, or the price of, our products, which could result in lower product sales or revenues which could have a material adverse effect on us and our results of operations. For example, in the U.S. the use of EPOGEN(R) in connection with treatment for end stage renal disease is funded primarily by the U.S. federal government. Therefore, as in the past, EPOGEN(R) sales could be affected by future changes in reimbursement rates or the basis for reimbursement by the federal government. For example, in early 1997, HCFA instituted a reimbursement change for EPOGEN(R) which adversely affected the Company's EPOGEN(R) sales, until the policies were revised.
Guidelines and recommendations can affect the use of our products.
Government agencies promulgate regulations and guidelines directly applicable to us and to our products. However, professional societies, practice management groups, private health/science foundations and
organizations involved in various diseases from time to time may also publish guidelines or recommendations to the health care and patient communities. Recommendations of government agencies or these other groups/organizations may relate to such matters as usage, dosage, route of administration and use of concomitant therapies. Organizations like these have in the past made recommendations about our products. Recommendations or guidelines that are followed by patients and health care providers could result in decreased use of our products. In addition, the perception by the investment community or stockholders that such recommendations or guidelines will be followed could adversely affect prevailing market prices for our common stock.
Intellectual property and legal matters can affect our business.
The patent positions of pharmaceutical and biotechnology companies can be highly uncertain and often involve complex legal, scientific and factual questions. To date, there has emerged no consistent policy regarding breadth of claims allowed in such companies' patents. Accordingly, the patents and patent applications relating to our products, product candidates and technologies may be challenged, invalidated or circumvented by third parties and might not protect us against competitors with similar products or technology. For certain of our product candidates, there are third parties who have patents or pending patents that they may claim prevent us from commercializing these product candidates in certain territories. Patent disputes are frequent and can preclude commercialization of products. We are currently, and in the future may be, involved in patent litigation. For example, we are involved in ongoing patent infringement lawsuits against Transkaryotic Therapies, Inc. and Aventis with respect to our erythropoietin patents. If we ultimately lose these litigations, we could be subject to competition and/or significant liabilities, we could be required to enter into third party licenses or we could be required to cease using the technology or product in dispute. In addition, we cannot guarantee that such licenses will be available on terms acceptable to us.
We face competition.
We operate in a highly competitive environment. Our principal competitors are pharmaceutical and biotechnology companies. Some of our competitors, mainly large pharmaceutical corporations, have greater clinical, research, regulatory and marketing resources than we do. In addition, some of our competitors may have technical or competitive advantages over us for the development of technologies and processes and may acquire technology from academic institutions, government agencies and other private and public research organizations. We cannot guarantee that we will be able to produce or acquire rights to products that have commercial potential. In addition, even if we achieve successful product commercialization, it is possible that one or more of our competitors will achieve product commercialization earlier than we do, obtain patent protection that dominates or adversely affects our activities, or have significantly greater marketing capabilities.
Our operating results may fluctuate.
Our operating results may fluctuate from period to period for a number of reasons. In budgeting our operating expenses, we assume that revenues will continue to grow; however, some of our operating expenses are fixed in the short term. Because of this, even a relatively small revenue shortfall may cause a period's results to be below our expectations or projections. A revenue shortfall could arise from any number of factors, such as:
-- lower than expected demand for our products
-- changes in the government's or private payors' reimbursement policies for our products
-- changes in wholesaler buying patterns
-- increased competition from new or existing products
-- fluctuations in foreign currency exchange rates
-- changes in our product pricing strategies
Of course, there may be other factors that affect the Company's revenues in any given period.
We plan to grow rapidly.
We have an aggressive growth plan that includes substantial and increasing investments in research and development, sales and marketing and facilities. Our plan has a number of risks, for example:
-- we may need to generate higher revenues to cover a higher level of operating expenses
-- we may need to attract and assimilate a large number of new employees
-- we may need to manage complexities associated with a larger and faster growing organization
-- we may need to accurately anticipate demand for the products we manufacture and maintain adequate manufacturing capacity
Of course, there may be other risks and we cannot guarantee that we will be able to successfully manage these or other risks.
Our stock price is volatile.
Our stock price, like that of other biotechnology companies, is highly volatile. Our stock price may be affected by such factors as:
-- clinical trial results
-- product-development announcements by us or our competitors
-- regulatory matters
-- announcements in the scientific and research community
-- intellectual property and legal matters
-- changes in reimbursement policies or medical practices
-- broader industry and market trends unrelated to our performance
In addition, if our revenues or earnings in any period fail to meet the investment community's expectations, there could be an immediate adverse impact on our stock price.
Item 2. PROPERTIES
Amgen's principal executive offices and a majority of its administrative, manufacturing and research and development facilities are located in thirty- nine buildings in Thousand Oaks, California. Thirty-five of the buildings are owned and four are leased. Adjacent to these buildings are facilities that are under construction and additional property for future expansion. The Thousand Oaks, California properties include manufacturing facilities licensed by various regulatory bodies that produce commercial quantities of Epoetin alfa, NEUPOGEN(R) (Filgrastim), INFERGEN(R) (Interferon alfacon-1) and STEMGEN(R) (Ancestim). These properties also include a manufacturing facility capable of producing commercial quantities of ARANESP(TM) (darbepoetin alfa).
Amgen owns two buildings and leases four buildings in Boulder, Colorado, housing research facilities and a manufacturing facility capable of producing commercial quantities of anakinra. The Company has a manufacturing complex in Longmont, Colorado, that is licensed to produce commercial quantities of Epoetin alfa. Amgen also plans on using the Longmont facility to produce commercial quantities of ARANESP(TM) (darbepoetin alfa). The Company has acquired approximately 159 acres of undeveloped land adjacent to the Longmont site to accommodate future expansion.
Elsewhere in North America, the Company owns a distribution center in Louisville, Kentucky, and leases a research facility and administrative offices in Canada, a research facility in Medford Massachusetts, an
administrative office in Washington, D.C. and five regional sales offices in the U.S. The Company also owns land in Cambridge, Massachusetts, where a research facility is currently being constructed.
Outside North America, the Company has a manufacturing facility in Juncos, Puerto Rico, and a European packaging and distribution center in Breda, The Netherlands, which have been licensed by various regulatory bodies. The Company leases facilities in fourteen European countries, Australia, Japan, Taiwan and the People's Republic of China for administration, marketing and/or research and development.
Amgen believes that its current facilities plus anticipated additions are sufficient to meet its needs for the next several years.
Item 3. LEGAL PROCEEDINGS
Certain of the Company's legal proceedings are discussed below. While it is impossible to predict accurately or to determine the eventual outcome of these matters, the Company believes that the outcome of these proceedings will not have a material adverse effect on the annual financial statements of the Company.
Biogen litigation
On March 10, 1995, Biogen, Inc. ("Biogen") filed suit in the United States District Court for the District of Massachusetts (the "Massachusetts District Court") alleging infringement by the Company of certain claims of U.S. Patent No. 4,874,702 (the "'702 Patent"), relating to vectors for expressing cloned genes. Biogen alleged that Amgen infringed its patent by manufacturing and selling NEUPOGEN(R). On March 28, 1995, Biogen filed an amended complaint further alleging that the Company also infringed the claims of two additional patents allegedly assigned to Biogen, U.S. Patent No. 5,401,642 (the "'642 Patent") and U.S. Patent No. 5,401,658 (the "'658 Patent"), relating to vectors, methods for making vectors and expressing cloned genes, and host cells. The amended complaint sought injunctive relief, unspecified compensatory damages and treble damages. On April 24, 1995, the Company answered Biogen's amended complaint, denying its material allegations and pleading counterclaims for declaratory judgment of non-infringement, patent invalidity and unenforceability. The Massachusetts District Court exerted jurisdiction over claims 9 and 17 of the '702 Patent, and dismissed all claims and counterclaims relating to any other claims of the '702 Patent. On August 6, 1998, the Massachusetts District Court issued a final claim construction order ruling that, to be covered by claim 1 of the '702 Patent (the claim that forms the crux of the asserted claims), a plasmid vector must contain the entire lambda DNA sequence as represented in Figure 6 of the '702 Patent, as well as at least one endonuclease recognition site inserted at the converted HaeIII site at 73.1% of bacteriophage lambda or at another site downstream of HaeIII, said endonuclease recognition site being within 300 base pairs of the HincII site at -33, and prior to any sequences of lambda DNA downstream of the HaeIII site. On November 17, 1999, a hearing was held on Amgen's motion for summary judgment of non-infringement. At the hearing, the Massachusetts District Court orally ruled that Amgen does not literally infringe. On September 25, 2000, the Massachusetts District Court issued a Memorandum and Order finding no infringement, literally or under the doctrine of equivalents regarding the Company's manufacture and sale of NEUPOGEN(R). On October 12, 2000, the Massachusetts District Court entered judgment in Amgen's favor. Biogen disputed the finality of the Judgment and the correctness of the Massachusetts District Court's Memorandum and Order. On December 19, 2000, Amgen filed a Motion to Amend the Massachusetts District Court's September 25, 2000 Memorandum and Order. On March 1, 2001, the Massachusetts District Court allowed in part Amgen's Motion to Amend and ruled that the September 25, 2000 Order will be amended to reflect the Massachusetts District Court's reliance on prosecution history estoppel as a distinct and separate ground upon which to enter a judgment of non-infringement for Amgen regarding the '702 Patent. Regarding Amgen's Motion for Summary Judgment of Issue Preclusion, the Massachusetts District Court ruled that its clerk will schedule a hearing on Amgen's Motion for Summary Judgment of Issue Preclusion relating to Amgen's contention that prosecution history estoppel and issue preclusion compel findings of non- infringement of the '642 and '658 Patents and the dismissal of the Infergen matter described below. It also allowed Biogen's Motion to Alter or Amend Judgment
to the extent that the October 12, 2000 Judgment was not final in that it did not formally dispose of Amgen's pending counterclaims nor did it contain a certification under Rule 54(b) of the Federal Rules of Civil Procedure. The Massachusetts District Court ruled that it will vacate the October 12, 2000 Judgment and instructed its clerk to issue a substitute Judgment in favor of Amgen as to any alleged infringement of the claims of the '702 Patent. The Massachusetts District Court further ruled that Amgen's counterclaims are dismissed without prejudice as moot. The remaining calendar of scheduled items that were pending before the Massachusetts District Court, including trial, has been eliminated and the Company's motions for lack of ownership and for abandonment were dismissed as moot. The Company's motion for summary judgment of invalidity on the basis of prior public use was denied on procedural grounds.
In a separate matter, on July 30, 1997, Biogen filed a complaint in the Massachusetts District Court alleging that Amgen infringes claims 9 and 17 of the '702 Patent and the claims of the '642 and '658 Patents, identified above, by making and using the claimed subject matter in the United States in the manufacture of INFERGEN(R), the Company's consensus interferon product. On September 17, 1997, Amgen responded to the complaint by filing a motion to dismiss the case in its entirety due to Biogen's lack of standing to bring the lawsuit in view of Biogen's lack of ownership of the patents-in-suit. Amgen also filed a motion for summary judgment of patent invalidity of particular claims of the patents-in-suit due to abandonment of the invention. The Massachusetts District Court ordered Amgen to file an answer to Biogen's complaint and Amgen complied. All discovery in this case has been stayed. As noted above, the Massachusetts District Court will be setting a date for a hearing on Amgen's Motion for Summary Judgment of Issue Preclusion and for the dismissal of this case.
INFERGEN(R) litigation
On December 3, 1996, Schering-Plough Corporation ("Schering") filed suit in the U.S. District Court for the District of Delaware (the "Delaware Court") against the Company alleging infringement of U.S. Patent No. 4,530,901 (the "'901 Patent") by the manufacture and use of INFERGEN(R). The complaint sought unspecified damages and injunctive relief. Biogen was added as a plaintiff in the Delaware action. On July 30, 1998, the Delaware Court entered an order construing the meaning of the claims of the '901 Patent. The Delaware Court limited the scope of the claims to include DNAs that encode only "an immature, fused, and/or incomplete form" of Interferon-alpha-1. On February 3, 1999, the Delaware Court entered judgment of noninfringement in favor of Amgen that INFERGEN(R) does not infringe the '901 Patent. Schering and Biogen appealed and the appeal was argued in December 1999. The U.S. Court of Appeals affirmed the Delaware Court's judgment of noninfringement in favor of Amgen in a decision dated August 1, 2000.
Genentech litigation
On October 16, 1996, Genentech, Inc. ("Genentech") filed suit in the United States District Court for the Northern District of California (the "California Court") seeking an unspecified amount of compensatory damages, treble damages and injunctive relief on its U.S. Patent Nos. 4,704,362, 5,221,619 and 4,342,832 (the "'362, '619 and '832 Patents"), relating to vectors for expressing cloned genes and the methods for such expression. Genentech alleged that Amgen infringed its patents by manufacturing and selling NEUPOGEN(R). On December 2, 1996, Amgen was served with this lawsuit. On January 21, 1997, the Company answered the complaint and asserted counterclaims relating to invalidity and non-infringement of the patents-in-suit. On February 10, 1997, Genentech served Amgen with a reply to the counterclaim and an additional counterclaim asserting U.S. Patent No. 5,583,013 (the "'013 Patent"), issued December 10, 1996, seeking relief similar to that sought for the '362, '619 and '832 Patents. On March 31, 1997, Amgen answered this pleading and asserted counterclaims relating to invalidity and non-infringement of the '013 Patent. At a hearing held on May 29, 1998, the parties stipulated to: (i) the dismissal with prejudice of Genentech's first claim for patent infringement against Amgen with respect to the '832 Patent, as alleged in Genentech's complaint filed October 16, 1996 and (ii) dismissal with prejudice of Amgen's first, second, third and fourth claims for relief with respect to the '832 Patents as alleged in Amgen's answer to complaint and counterclaims filed on January 21, 1997. The judge issued a final claim construction ruling interpreting the '362, '619 and '013 Patent
claims which, among other things, essentially limited the claim term "control region" to DNA taken from a single operon and not constructed from control elements derived from various operons. It may not be constructed portion-by- portion from multiple operons. On February 18, 2000, Amgen filed a motion to amend its answer to allege inequitable conduct. On October 12, 2000, the California Court entered Final Judgment in the Company's favor on the basis of no infringement. Genentech has filed a notice of appeal. The parties are currently briefing these issues before the Federal Circuit Court of Appeals.
Transkaryotic Therapies and Aventis S.A. litigation
On April 15, 1997, Amgen filed suit in the Massachusetts District Court against Transkaryotic Therapies, Inc. ("TKT") and Hoechst Marion Roussel, Inc. ("HMR"--now Aventis S.A., together with TKT, the "Defendants") alleging infringement of several U.S. patents owned by Amgen that claim an erythropoietin product and processes for making erythropoietin. The suit sought an injunction preventing the Defendants from making, importing, using or selling erythropoietin in the U.S. On July 9, 1997, the Massachusetts District Court denied TKT's motion to dismiss the lawsuit on the pleadings. On April 15, 1998, the Massachusetts District Court issued an order granting the Defendants' motion for summary judgment of non-infringement on the grounds that Defendants' activities to date were protected by the clinical trial exemption. The Massachusetts District Court also ruled that the action would be administratively closed to be re-opened upon motion of either party for good cause shown. In June 1999, the Defendants filed a motion to reopen the case with which Amgen concurred. On October 7, 1999, Amgen filed an amended complaint which added two additional patents to the litigation. Defendants' amended answer asserted that all five of the patents-in-suit were not infringed, were invalid or were unenforceable due to inequitable conduct. Discovery by both sides was completed in 1999. The Defendant's motion for summary judgment of invalidity of three of the patents was denied on January 18, 2000. Amgen's motion for summary judgment of literal infringement was granted by the Massachusetts District Court on April 26, 2000 with respect to claim 1 of U.S. Patent No. 5,955,422 (the "'422 Patent"). Also on April 26, 2000, the Massachusetts District Court denied Amgen's motion for summary judgment with respect to claims 1 and 4 of U.S. Patent No. 5,756,349 (the "'349 Patent") and deferred decision on the infringement of that patent until trial. On May 15, 2000, trial began in the Massachusetts District Court. On June 9, 2000, the Massachusetts District Court granted motion for non-infringement of U.S. Patent No. 5,618,698 (the "'698 Patent"), removing the '698 Patent from this action. The Massachusetts District Court also held that, although the Defendants' erythropoietin product does not literally fall within the scope of U.S. Patent No. 5,621,080 (the "'080 Patent"), such product may infringe if it is found to be equivalent to the product claimed by the '080 Patent. Additionally, the Massachusetts District Court denied the Defendants' motion for non-infringement of U.S. Patent No. 5,547,933 (the "'933 Patent"). On July 21, 2000, the Massachusetts District Court granted Amgen's motion for judgment on the Defendants' defenses of invalidity based upon anticipation and obviousness. On January 19, 2001, the Massachusetts District Court ruled that claims 2-4 of the '080 Patent, claims 1-6 of the '349 Patent and claim 1 of the '422 Patent were valid, enforceable and infringed by TKT's GA-EPO product and the cells used to make such product. The Massachusetts District Court also held that claim 7 of the '349 patent and claims 1, 2 and 9 of the '933 Patent were not infringed, and that if infringed the claims of the '933 patent would be invalid. On January 26, 2001, TKT and HMR filed a Notice of Appeal and on February 14, 2001, Amgen filed a Notice of Cross-Appeal, to the U.S. Court of Appeals for the Federal Circuit.
Item 4. SUBMISSION OF MATTERS TO A VOTE OF SECURITY HOLDERS
No matters were submitted to a vote of the Company's security holders during the last quarter of its fiscal year ended December 31, 2000.
PART II
Item 5. MARKET FOR REGISTRANT'S COMMON EQUITY AND RELATED STOCKHOLDER MATTERS
The Company's common stock trades on The Nasdaq Stock Market under the symbol AMGN. As of February 28, 2001, there were approximately 17,000 holders of record of the Company's common stock. No cash dividends have been paid on the common stock to date, and the Company currently intends to utilize any earnings for development of the Company's business and for repurchases of its common stock.
The following table sets forth, for the fiscal periods indicated, the range of high and low closing sales prices of the common stock as quoted on The Nasdaq Stock Market for the years 2000 and 1999:
High Low
------ ------
2000
4th Quarter................................................ $71.38 $54.13
3rd Quarter................................................ 78.00 64.94
2nd Quarter................................................ 70.38 51.31
1st Quarter................................................ 74.69 52.25
1999
4th Quarter................................................ $64.88 $37.84
3rd Quarter................................................ 43.78 29.50
2nd Quarter................................................ 40.00 26.16
1st Quarter................................................ 39.53 26.14
|
Item 6. SELECTED FINANCIAL DATA
(in millions, except per share data)
Years ended December 31,
-----------------------------------------------
2000 1999 1998 1997 1996
-------- -------- -------- -------- --------
Consolidated Statement of
Operations Data:
Revenues:
Product sales(1)............ $3,202.2 $3,042.8 $2,514.4 $2,219.8 $2,088.2
Other revenues.............. 427.2 297.3 203.8 181.2 151.6
Total revenues............ 3,629.4 3,340.1 2,718.2 2,401.0 2,239.8
Research and development
expenses..................... 845.0 822.8 663.3 630.8 528.3
Selling, general and
administrative expenses...... 826.9 654.3 515.4 483.8 470.6
Other items, net(2)........... (18.8) (49.0) (23.0) 157.0 --
Net income.................... 1,138.5 1,096.4 863.2 644.3 679.8
Diluted earnings per share.... 1.05 1.02 0.82 0.59 0.61
Cash dividends declared per
share........................ -- -- -- -- --
At December 31,
-----------------------------------------------
2000 1999 1998 1997 1996
-------- -------- -------- -------- --------
Consolidated Balance Sheet
Data:
Total assets.................. $5,399.6 $4,077.6 $3,672.2 $3,110.2 $2,765.6
Long-term debt................ 223.0 223.0 223.0 229.0 59.0
Stockholders' equity.......... 4,314.5 3,023.5 2,562.2 2,139.3 1,906.3
|
(2) Amounts primarily comprised of benefits and expenses related to various legal proceedings. The amount in 2000 also includes a write-off of acquired in-process research and development of $30.1 million and a charitable contribution of $25 million to the Amgen Foundation. See Notes 4 and 11 to the Consolidated Financial Statements for a discussion of the amounts in 2000, 1999 and 1998. Other items, net increased/(decreased) earnings per share by $0.00 in 2000, $0.03 in 1999, $0.01 in 1998 and ($0.09) in 1997.
Item 7. MANAGEMENT'S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS
Liquidity and Capital Resources
The Company had cash, cash equivalents and marketable securities of $2,028.1 million at December 31, 2000, compared with $1,333.0 million at December 31, 1999. Cash provided by operating activities has been and is expected to continue to be the Company's primary source of funds. In 2000, operations provided $1,634.6 million of cash compared with $1,226.9 million in 1999.
Capital expenditures totaled $437.7 million in 2000 compared with $304.2 million in 1999. The Company anticipates spending approximately $450 million to $550 million in 2001 on capital projects and equipment to expand the Company's operations.
The Company receives cash from the exercise of employee stock options and proceeds from the sale of stock by Amgen pursuant to the employee stock purchase plan. In 2000, employee stock option exercises and proceeds from the sale of stock by Amgen pursuant to the employee stock purchase plan provided $333.7 million of cash compared with $248.8 million in 1999. Proceeds from the exercise of employee stock options will vary from period to period based upon, among other factors, fluctuations in the market value of the Company's stock relative to the exercise price of such options.
The Company has a stock repurchase program primarily to reduce the dilutive effect of its employee stock option and stock purchase plans. In 2000, the Company repurchased 12.2 million shares of its common stock at a total cost of $799.9 million, and in 1999, the Company repurchased 27.1 million shares of common stock at a cost of $1,024.7 million. In December 2000, the Board of Directors authorized the Company to repurchase up to $2 billion of common stock between January 1, 2001 and December 31, 2002. The amount the Company spends on and the number of shares repurchased each quarter varies based on a variety of factors, including the stock price and blackout periods in which the Company is restricted from repurchasing shares.
To provide for financial flexibility and increased liquidity, the Company has established several sources of debt financing. As of December 31, 2000, the Company had $223 million of unsecured long-term debt securities outstanding. These unsecured long-term debt securities consisted of: 1) $100 million of debt securities that bear interest at a fixed rate of 6.5% and mature in 2007 under a $500 million debt shelf registration (the "Shelf"), 2) $100 million of debt securities that bear interest at a fixed rate of 8.1% and mature in 2097 and 3) $23 million of debt securities that bear interest at a fixed rate of 6.2% and mature in 2003. Under the Shelf, all of the remaining $400 million of debt securities available for issuance may be offered under the Company's medium- term note program with terms to be determined by market conditions.
The Company's sources of debt financing also include a commercial paper program which provides for unsecured short-term borrowings up to an aggregate face amount of $200 million. As of December 31, 2000, commercial paper with a face amount of $100 million was outstanding. These borrowings had maturities of less than two months and had effective interest rates averaging 6.7%. In addition, the Company has an unsecured $150 million credit facility that expires on May 28, 2003. This credit facility supports the Company's commercial paper program. As of December 31, 2000, no amounts were outstanding under this line of credit.
The primary objectives for the Company's investment portfolio are liquidity and safety of principal. Investments are made to achieve the highest rate of return to the Company, consistent with these two objectives. The Company's investment policy limits investments to certain types of instruments issued by institutions with investment grade credit ratings and places restrictions on maturities and concentration by type and issuer.
The Company believes that existing funds, cash generated from operations and existing sources of debt financing are adequate to satisfy its working capital and capital expenditure requirements for the foreseeable future, as well as to support its stock repurchase program. However, the Company may raise additional capital from time to time.
Results of Operations
Product sales
Product sales were $3,202.2 million in 2000, an increase of $159.4 million or 5% over the prior year. In 1999, product sales were $3,042.8 million, an increase of $528.4 million or 21% over the prior year. Quarterly product sales are influenced by a number of factors, including underlying demand, wholesaler inventory management practices and foreign exchange effects.
EPOGEN(R) (Epoetin alfa)
EPOGEN(R) sales were $1,962.9 million in 2000, an increase of $203.8 million or 12% over the prior year. This increase was primarily due to higher demand, which was principally driven by growth in the U.S. dialysis patient population and to a lesser extent, the effect of higher prices. Sales in 2000 were adversely impacted by Year 2000-related sales to wholesalers in the fourth quarter of 1999 for which the Company provided extended payment terms and, the Company believes, by dialysis provider inventory drawdowns in 2000 of additional 1999 year-end stockpiling. The Company believes that some of this dialysis provider stockpiling may have been due to Year 2000 concerns and year- end contract expirations. In 1999, EPOGEN(R) sales were $1,759.1 million, an increase of $377.1 million or 27% over the prior year. This increase was primarily due to higher demand, principally driven by the administration of higher doses and growth in the U.S. dialysis patient population. The administration of higher doses of EPOGEN(R) was principally due to dialysis providers managing more patients into the hematocrit range of 33 to 36 percent as recommended by the Dialysis Outcomes Quality Initiative, as well as the use of hemoglobin instead of hematocrit to measure red blood cell volume.
NEUPOGEN(R) (Filgrastim)
Worldwide NEUPOGEN(R) sales were $1,223.7 million in 2000, a decrease of $32.9 million or 3% from the prior year. This decrease was primarily due to the adverse impact of wholesaler buying patterns, including Year 2000-related sales to wholesalers in the fourth quarter of 1999 for which the Company provided extended payment terms, as well as adverse foreign exchange effects. The Company believes these factors were partially offset by a mid-single digit rate increase in demand, which includes the effect of higher prices in the U.S. In 1999, worldwide NEUPOGEN(R) sales were $1,256.6 million, an increase of $140.0 million or 13% over the prior year. This increase was primarily due to higher demand, which includes the effect of higher prices in the U.S., and the impact of approximately $29 million of Year 2000-related sales to wholesalers in the fourth quarter of 1999 for which the Company provided extended payment terms.
Other product sales
Other product sales primarily consist of INFERGEN(R) (Interferon alfacon-1). INFERGEN(R) sales were $14.5 million in 2000, a decrease of $11.7 million or 45% from the prior year. In 1999, INFERGEN(R) sales were $26.2 million, an increase of $10.4 million or 66% over the prior year. INFERGEN(R) was launched in October 1997 for the treatment of chronic hepatitis C virus infection. There are other treatments, including combination therapy, for this infection against which INFERGEN(R) competes. The Company cannot predict the extent to which it will maintain its share or further penetrate this market.
Corporate partner revenues
In 2000, corporate partner revenues increased $84.8 million or 53% over the prior year. In 1999, corporate partner revenues increased $33.5 million or 26% over the prior year. These increases were primarily due to amounts earned from Kirin-Amgen, Inc. related to the development program for ARANESP(TM)(darbepoetin alfa), the Company's novel erythropoiesis stimulating protein.
Cost of sales
Cost of sales as a percentage of product sales was 12.8%, 13.2% and 13.7% for 2000, 1999 and 1998, respectively. The decreases in these percentages were primarily due to increased manufacturing efficiencies.
Research and development
In 2000, research and development expenses increased $22.2 million or 3% over the prior year. This increase was primarily due to higher staff-related costs necessary to support ongoing research and product development activities and higher clinical trial costs. These increases were substantially offset by a reduction in clinical manufacturing and product licensing costs. In 1999, research and development expenses increased $159.5 million or 24% over the prior year. This increase was primarily due to product licensing and development costs related to the collaboration with PRAECIS PHARMACEUTICALS INCORPORATED and higher staff-related costs necessary to support ongoing research and product development activities.
Selling, general and administrative
In 2000, selling, general and administrative ("SG&A") expenses increased $172.6 million or 26% over the prior year. This increase was primarily due to higher staff-related costs and outside marketing expenses as the Company continues to support its existing products and prepares for anticipated new product launches. In 1999, SG&A expenses increased $138.9 million or 27% over the prior year primarily due to higher staff-related costs and outside marketing expenses as the Company prepared for anticipated new product launches.
Other items, net
Other items, net consisted of three non-recurring items: 1) legal awards associated with the spillover arbitration with Johnson & Johnson, 2) a write- off of acquired in-process research and development associated with the acquisition of Kinetix Pharmaceuticals, Inc. and 3) a charitable contribution to the Amgen Foundation. See Note 4 to the Consolidated Financial Statements.
Interest and other income
In 2000, interest and other income increased $57.9 million or 66% over the prior year. This increase was primarily due to gains realized on the sale of certain equity securities in the Company's portfolio and higher interest income generated from the Company's investment portfolio as a result of higher average cash balances and higher interest rates. In 1999, interest and other income increased $42.6 million or 93% over the prior year. This increase was principally due to the absence of write-downs recorded in 1998 of certain non- current assets, primarily marketable equity securities.
Income taxes
The Company's effective tax rate was 32.0%, 30.0% and 29.5% for 2000, 1999 and 1998, respectively. The tax rate in all three years reflected the tax benefits from the sale of products manufactured in the Company's Puerto Rico manufacturing facility. The Company's tax rate has increased as a result of increased taxable income combined with a provision in the federal tax law that caps tax benefits associated with the Company's Puerto Rico operations at the 1995 income level. In addition, the 2000 tax rate increased as a result of the write-off of acquired in-process research and development, which is not deductible for tax purposes.
Financial Outlook
In December 1999 and early 2000, the Company filed regulatory submissions for the use of ARANESP(TM) in patients with chronic renal insufficiency and chronic renal failure in the U.S., the European Union, Canada, Australia and New Zealand. The Company anticipates selling ARANESP(TM) if approved, in most of these markets beginning in 2001. Because the Company is unable to predict the timing and the extent
to which health care providers in the U.S. may transition from administering EPOGEN(R) to ARANESP(TM), 2001 sales guidance for EPOGEN(R) and ARANESP(TM) will be provided on a combined basis. The Company expects the percentage increase of 2001 sales of EPOGEN(R) and ARANESP(TM) combined over 2000 EPOGEN(R) sales to be in the range of high teens to low twenties. Patients receiving treatment for end stage renal disease are covered primarily under medical programs provided by the federal government. Therefore, EPOGEN(R) sales may also be affected by future changes in reimbursement rates or a change in the basis for reimbursement by the federal government. In addition, ARANESP(TM) will be affected by government and private payor reimbursement policies.
In 2001, the Company expects the NEUPOGEN(R) sales growth rate to be in the high single digits. The Company believes that there is a trend in some cancer settings towards the use of chemotherapy treatments that are less myelosuppressive. Chemotherapy treatments that are less myelosuppressive may require less NEUPOGEN(R). Future NEUPOGEN(R) demand is dependent primarily upon penetration of existing markets and the effects of competitive products. NEUPOGEN(R) usage is expected to continue to be affected by cost containment pressures from governments and private insurers on health care providers worldwide. In addition, reported NEUPOGEN(R) sales will continue to be affected by changes in foreign currency exchange rates. In both domestic and foreign markets, sales of NEUPOGEN(R) are dependent, in part, on the availability of reimbursement from third party payors such as governments (for example, Medicare and Medicaid programs in the U.S.) and private insurance plans. Therefore, NEUPOGEN(R) sales may also be affected by future changes in reimbursement rates or changes in the bases for reimbursement.
INFERGEN(R) (Interferon alfacon-1) was launched in October 1997 for the treatment of chronic hepatitis C virus infection. There are other treatments, including combination therapy, for this infection against which INFERGEN(R) competes. The Company cannot predict the extent to which it will maintain its share or further penetrate this market.
For 2001, total product sales are expected to grow in the mid to high teens, cost of sales is expected to be in the range of 11.5% to 12.5% of total product sales, corporate partner revenues are expected to be approximately the same as in 2000, research and development expenses and SG&A expenses are each estimated to be in the range of 25% to 27% of total product sales, the effective tax rate is expected to be approximately 34%, and earnings per share is expected to grow in the mid teens.
Estimates of future product sales, operating expenses and earnings per share are necessarily speculative in nature and are difficult to predict with accuracy.
Except for the historical information contained herein, the matters discussed herein are by their nature forward-looking. Investors are cautioned that forward-looking statements or projections made by the Company, including those made in this document, are subject to risks and uncertainties that may cause actual results to differ materially from those projected. Reference is made in particular to forward-looking statements regarding product sales, earnings per share and expenses. Amgen operates in a rapidly changing environment that involves a number of risks, some of which are beyond the Company's control. Future operating results and the Company's stock price may be affected by a number of factors, including, without limitation: (i) the results of preclinical and clinical trials; (ii) regulatory approvals of product candidates, new indications and manufacturing facilities; (iii) reimbursement for Amgen's products by governments and private payors; (iv) health care guidelines and policies relating to Amgen's products; (v) intellectual property matters (patents) and the results of litigation; (vi) competition; (vii) fluctuations in operating results and (viii) rapid growth of the Company. These factors and others are discussed herein and in the sections appearing under the heading "Business--Factors That May Affect Amgen" in the Company's Annual Report on Form 10-K for the year ended December 31, 2000, which sections are incorporated herein by reference.
Item 7A. QUANTITATIVE AND QUALITATIVE DISCLOSURES ABOUT MARKET RISK
Interest income earned on the Company's investment portfolio is affected by changes in the general level of U.S. interest rates. The Company's short-term borrowings effectively bear interest at variable rates and therefore, changes in U.S. interest rates affect interest expense incurred thereon. The Company had reduced this exposure to interest rate changes by entering into an interest rate swap agreement, which expired during 2000, that effectively changed the interest expense incurred on a portion of its short-term borrowings to a fixed rate. Changes in interest rates do not affect interest expense incurred on the Company's long-term borrowings because they all bear interest at fixed rates. The following tables provide information about the Company's financial instruments that are sensitive to changes in interest rates. For the Company's investment portfolio and debt obligations, the tables present principal cash flows and related weighted-average interest rates by expected maturity dates. Additionally, the Company has assumed its available-for-sale debt securities, comprised primarily of corporate debt instruments and treasury securities, are similar enough to aggregate those securities for presentation purposes. For the interest rate swap, the tables present the notional amount and weighted-average interest rates by contractual maturity date. The notional amount is used to calculate the contractual cash flows to be exchanged under the contract.
Interest Rate Sensitivity Principal Amount by Expected Maturity as of 12/31/99 Average Interest Rate
(Dollars in millions)
Fair Value
2000 2001 2002 2003 2004 Thereafter Total 12/31/99
------ ------ ------ ----- ---- ---------- -------- ----------
Available-for-sale debt
securities............. $376.8 $721.8 $177.7 $17.0 $5.0 -- $1,298.3 $1,293.6
Interest rate........... 6.3% 6.4% 6.5% 6.0% 5.6% --
Commercial paper........ $100.0 -- -- -- -- -- $ 100.0 $ 100.0
Interest rate........... 6.4% -- -- -- -- --
Long-term debt.......... -- -- -- $23.0 -- $200.0 $ 223.0 $ 216.6
Interest rate........... -- -- -- 6.2% -- 7.3%
Interest rate swap
related to commercial
paper issuances:
Pay fixed/receive
variable............... $ 50.0 -- -- -- -- -- $ 50.0 $ 0.3
Avg. pay rate........... 5.3% -- -- -- -- --
Avg. receive rate....... 6.0% -- -- -- -- --
|
Interest Rate Sensitivity Principal Amount by Expected Maturity as of 12/31/00 Average Interest Rate
(Dollars in millions)
Fair Value
2001 2002 2003 2004 2005 Thereafter Total 12/31/00
------ ------ ------ ------ ----- ---------- -------- ----------
Available-for-sale debt
securities............. $780.4 $740.6 $232.3 $118.5 $60.0 -- $1,931.8 $1,950.2
Interest rate........... 6.6% 6.7% 7.0% 6.5% 7.0% --
Commercial paper........ $100.0 -- -- -- -- -- $ 100.0 $ 100.0
Interest rate........... 6.7% -- -- -- -- --
Long-term debt.......... -- -- $ 23.0 -- -- $200.0 $ 223.0 $ 222.0
Interest rate........... -- -- 6.2% -- -- 7.3%
|
The Company is exposed to equity price risks on the marketable portion of equity securities included in its portfolio of investments entered into for the promotion of business and strategic objectives. These investments
are generally in small capitalization stocks in the biotechnology industry sector. The Company typically does not attempt to reduce or eliminate its market exposure on these securities. An 80% adverse change in equity prices would result in a decrease of approximately $178 million and $72 million in the fair value of the Company's available-for-sale marketable equity securities at December 31, 2000 and 1999, respectively.
Item 8. FINANCIAL STATEMENTS AND SUPPLEMENTARY DATA
The information required by this item is incorporated herein by reference to the financial statements listed in Item 14(a) of Part IV of this Form 10-K Annual Report.
Item 9. CHANGES IN AND DISAGREEMENTS WITH ACCOUNTANTS ON ACCOUNTING AND FINANCIAL DISCLOSURES
None.
PART III
Item 10. DIRECTORS AND EXECUTIVE OFFICERS OF THE REGISTRANT
Information concerning the directors of the Company is incorporated by reference to the section entitled "Election of Directors" in the Company's definitive Proxy Statement with respect to the Company's 2001 Annual Meeting to be filed with the Securities and Exchange Commission within 120 days of December 31, 2000 (the "Proxy Statement"). For information concerning the executive officers of the Company, see "Item 1. Business--Executive Officers of the Registrant".
Item 11. EXECUTIVE COMPENSATION
The section labeled "Executive Compensation" appearing in the Company's Proxy Statement is incorporated herein by reference, except for such information as need not be incorporated by reference under rules promulgated by the Securities and Exchange Commission.
Item 12. SECURITY OWNERSHIP OF CERTAIN BENEFICIAL OWNERS AND MANAGEMENT
The section labeled "Security Ownership of Directors and Executive Officers and Certain Beneficial Owners" appearing in the Company's Proxy Statement is incorporated herein by reference.
Item 13. CERTAIN RELATIONSHIPS AND RELATED TRANSACTIONS
The section labeled "Certain Transactions" appearing in the Company's Proxy Statement is incorporated herein by reference.
PART IV
Item 14. EXHIBITS, FINANCIAL STATEMENT SCHEDULES AND REPORTS ON FORM 8-K
(a)1. Index to Financial Statements
The following Financial Statements are included herein:
Page
Number
----------
Report of Ernst & Young LLP, Independent Auditors.................. F-1
Consolidated Statements of Operations for each of the three years
in the period ended December 31, 2000............................. F-2
Consolidated Balance Sheets at December 31, 2000 and 1999.......... F-3
Consolidated Statements of Stockholders' Equity for each of the
three years in the period ended December 31, 2000................. F-4
Consolidated Statements of Cash Flows for each of the three years
in the period ended December 31, 2000............................. F-5
Notes to Consolidated Financial Statements......................... F-6 - F-22
|
(a)2. Index to Financial Statement Schedules
The following Schedule is filed as part of this Form 10-K Annual Report:
Page
Number
------
II Valuation Accounts................................................... F-23
|
All other schedules are omitted because they are not applicable, or not required, or because the required information is included in the consolidated statements or notes thereto.
(a)3. Exhibits
Exhibit
No. Description
------- -----------
3.1 Restated Certificate of Incorporation as amended.(10)
3.2 Amended and Restated Bylaws of Amgen Inc. (as amended October 24,
2000).(20)
3.3 Certificate of Amendment of Restated Certificate of Incorporation.(19)
3.4* Certificate of Designations of Series A Junior Participating Preferred
Stock.
4.1 Indenture dated January 1, 1992 between the Company and Citibank N.A.,
as trustee.(4)
4.2 First Supplement to Indenture, dated February 26, 1997 between the
Company and Citibank N.A., as trustee.(7)
4.3 Officer's Certificate pursuant to Sections 2.1 and 2.3 of the
Indenture, as supplemented, establishing a series of securities "8
1/8% Debentures due April 1, 2097."(9)
4.4 8 1/8% Debentures due April 1, 2097.(9)
4.5 Form of stock certificate for the common stock, par value $.0001 of
the Company.(10)
4.6 Officer's Certificate pursuant to Sections 2.1 and 2.3 of the
Indenture, dated as of January 1, 1992, as supplemented by the First
supplemental Indenture, dated as of February 26, 1997, each between
the Company and Citibank, N.A., as Trustee, establishing a series of
securities entitled "6.50% Notes Due December 1, 2007".(12)
4.7 6.50% Notes Due December 1, 2007 described in Exhibit 4.6.(12)
|
Exhibit
No. Description
------- -----------
4.8 Corporate Commercial Paper--Master Note between and among Amgen Inc.,
as Issuer, Cede & Co., as nominee of The Depository Trust Company and
Citibank, N.A. as Paying Agent.(14)
10.1*+ Company's Amended and Restated 1991 Equity Incentive Plan.
10.2*+ Company's Amended and Restated 1997 Special Non-Officer Equity
Incentive Plan.
10.3* Shareholder's Agreement of Kirin-Amgen, Inc., dated May 11, 1984,
between the Company and Kirin Brewery Company, Limited.
10.4 Amendment Nos. 1, 2, and 3, dated March 19, 1985, July 29, 1985 and
December 19, 1985, respectively, to the Shareholder's Agreement of
Kirin-Amgen, Inc., dated May 11, 1984.(19)
10.5 Product License Agreement, dated September 30, 1985, and Technology
License Agreement, dated, September 30, 1985 between the Company and
Ortho Pharmaceutical Corporation.(19)
10.6 Product License Agreement, dated September 30, 1985, and Technology
License Agreement, dated September 30, 1985 between Kirin-Amgen, Inc.
and Ortho Pharmaceutical Corporation.(19)
10.7+ Company's Amended and Restated Employee Stock Purchase Plan.(19)
10.8 Research, Development Technology Disclosure and License Agreement PPO,
dated January 20, 1986, by and between the Company and Kirin Brewery
Co., Ltd.(1)
10.9* Amendment Nos. 4 and 5, dated October 16, 1986 (effective July 1,
1986) and December 6, 1986 (effective July 1, 1986), respectively, to
the Shareholders Agreement of Kirin-Amgen, Inc. dated May 11, 1984.
10.10* Assignment and License Agreement, dated October 16, 1986, between the
Company and Kirin-Amgen, Inc.
10.11* G-CSF European License Agreement, dated December 30, 1986, between
Kirin-Amgen, Inc. and the Company.
10.12*+ Company's Retirement and Savings Plan (as amended and restated
effective October 23, 2000).
10.13+ Company's Amended and Restated 1988 Stock Option Plan.(6)
10.14*+ First Amendment to the Company's Retirement and Savings Plan (as
amended and restated effective October 23, 2000).
10.15 Amendment, dated June 30, 1988, to Research, Development, Technology
Disclosure and License Agreement: GM-CSF dated March 31, 1987,
between Kirin Brewery Company, Limited and the Company.(2)
10.16 Agreement on G-CSF in Certain European Countries, dated January 1,
1989, between Amgen Inc. and F. Hoffmann-La Roche & Co. Limited
Company (with certain confidential information deleted therefrom).(3)
10.17 Partnership Purchase Agreement, dated March 12, 1993, between the
Company, Amgen Clinical Partners, L.P., Amgen Development
Corporation, the Class A limited partners and the Class B limited
partner.(5)
10.18+ Amgen Inc. Supplemental Retirement Plan (As Amended and Restated
Effective November 1, 1999).(18)
10.19+ First Amendment to Amgen Inc. Change of Control Severance Plan.(19)
10.20+ Amended and Restated Amgen Performance Based Management Incentive
Plan.(17)
10.21 Credit Agreement, dated as of May 28, 1998, among Amgen Inc., the
Borrowing Subsidiaries named therein, the Banks named therein,
Citibank, N.A., as Issuing Bank, and Citicorp USA, Inc., as
Administrative Agent.(15)
|
Exhibit
No. Description
------- -----------
10.22* G-CSF United States License Agreement dated June 1, 1987 (effective
July 1, 1986) between Kirin-Amgen, Inc. and the Company.
10.23* Amendment No. 1 dated October 20, 1988 to Kirin-Amgen, Inc./Amgen G-
CSF United States License Agreement dated June 1, 1987 (effective
July 1, 1986).
10.24* Amendment No. 2 dated October 17, 1991 (effective November 13, 1990)
to Kirin-Amgen, Inc./Amgen G-CSF United States License Agreement
dated June 1, 1987 (effective July 1, 1986).
10.25* Amendment No. 10 dated March 1, 1996 to the Shareholders' Agreement of
Kirin-Amgen, Inc. dated May 11, 1984.
10.26+ Amgen Inc. Change of Control Severance Plan effective as of October
20, 1998.(16)
10.27 Preferred Share Rights Agreement, dated as of December 12, 2000,
between Amgen Inc. and American Stock Transfer and Trust Company, as
Rights Agent.(21)
10.28+ First Amendment, effective January 1, 1998, to the Company's Amended
and Restated Employee Stock Purchase Plan.(11)
10.29* Amendment No. 11 dated March 20, 2000 to the Shareholders' Agreement
of Kirin-Amgen, Inc. dated May 11, 1984.
10.30+ Agreement between Amgen Inc. and Dr. Fabrizio Bonanni, dated March 3,
1999.(18)
10.31* Amendment No. 1 dated June 1, 1987 to Kirin-Amgen, Inc./Amgen G-CSF
European License Agreement dated December 30, 1986.
10.32* Amendment No. 2 dated March 15, 1988 to Kirin-Amgen, Inc./Amgen G-CSF
European License Agreement dated December 30, 1986.
10.33* Amendment No. 3 dated October 20, 1988 to Kirin-Amgen, Inc./Amgen G-
CSF European License Agreement dated December 30, 1986.
10.34* Amendment No. 4 dated December 29, 1989 to Kirin-Amgen, Inc./Amgen G-
CSF European License Agreement dated December 30, 1986.
10.35+ Company's Amended and Restated 1987 Directors' Stock Option Plan.(8)
10.36 Amended and Restated Agreement on G-CSF in the EU between Amgen Inc.
and F. Hoffmann-La Roche Ltd (with certain confidential information
deleted therefrom).(14)
10.37 Collaboration and License Agreement, dated December 15, 1997, between
the Company, GPI NIL Holdings, Inc. and Guilford Pharmaceuticals Inc.
(with certain confidential information deleted therefrom).(13)
10.38+ Promissory Note of Dr. Fabrizio Bonanni, dated August 7, 1999.(18)
10.39 Promissory Note of Dr. Fabrizio Bonanni, dated October 29, 1999.(18)
10.40*+ Company's Amended and Restated 1997 Equity Incentive Plan.
10.41+ Agreement between Amgen Inc. and Mr. Gordon M. Binder, dated May 10,
2000.(19)
10.42* Amendment No. 6 dated May 11, 1984 to the Shareholders' Agreement of
Kirin-Amgen, Inc. dated May 11, 1984.
10.43* Amendment No. 7 dated July 17, 1987 (effective April 1, 1987) to the
Shareholders' Agreement of Kirin-Amgen, Inc. dated May 11, 1984.
10.44* Amendment No. 8 dated May 28, 1993 (effective November 13, 1990) to
the Shareholders' Agreement of Kirin-Amgen, Inc. dated May 11, 1984.
10.45* Amendment No. 9 dated December 9, 1994 (effective June 14, 1994) to
the Shareholders' Agreement of Kirin-Amgen, Inc. dated May 11, 1984.
|
Exhibit
No. Description
------- -----------
21* Subsidiaries of the Company.
23 Consent of Ernst & Young LLP, Independent Auditors. The consent set
forth as page 41 is incorporated herein by reference.
24 Power of Attorney. The Power of Attorney set forth on page 40 is
incorporated herein by reference.
|
(1) Filed as an exhibit to Amendment No. 1 to Form S-1 Registration Statement
(Registration No. 33-3069) on March 11, 1986 and incorporated herein by
reference.
(2) Filed as an exhibit to Form 8 amending the Quarterly Report on Form 10-Q
for the quarter ended June 30, 1988 on August 25, 1988 and incorporated
herein by reference.
(3) Filed as an exhibit to the Form 8 dated November 8, 1989, amending the
Annual Report on Form 10-K for the year ended March 31, 1989 on June 28,
1989 and incorporated herein by reference.
(4) Filed as an exhibit to Form S-3 Registration Statement dated December 19,
1991 and incorporated herein by reference.
(5) Filed as an exhibit to the Form 8-A dated March 31, 1993 and incorporated
herein by reference.
(6) Filed as an exhibit to the Form 10-Q for the quarter ended September 30,
1996 on November 5, 1996 and incorporated herein by reference.
(7) Filed as an exhibit to the Form 8-K Current Report dated March 14, 1997 on
March 14, 1997 and incorporated herein by reference.
(8) Filed as an exhibit to the Annual Report on Form 10-K for the year ended
December 31, 1996 on March 24, 1997 and incorporated herein by reference.
(9) Filed as an exhibit to the Form 8-K Current Report dated April 8, 1997 on
April 8, 1997 and incorporated herein by reference.
(10) Filed as an exhibit to the Form 10-Q for the quarter ended March 31, 1997
on May 13, 1997 and incorporated herein by reference.
(11) Filed as an exhibit to the Form 10-Q for the quarter ended June 30, 1997
on August 12, 1997 and incorporated herein by reference.
(12) Filed as an exhibit to the Form 8-K Current Report dated and filed on
December 5, 1997 and incorporated herein by reference.
(13) Filed as Exhibit 10.40 to the Guilford Pharmaceuticals Inc. Form 10-K for
the year ended December 31, 1997 on March 27, 1998 and incorporated herein
by reference.
(14) Filed as an exhibit to the Form 10-Q for the quarter ended March 31, 1998
on May 13, 1998 and incorporated herein by reference.
(15) Filed as an exhibit to the Form 10-Q for the quarter ended June 30, 1998
on August 14, 1998 and incorporated herein by reference.
(16) Filed as an exhibit to the Annual Report on Form 10-K for the year ended
December 31, 1998 on March 16, 1999 and incorporated herein by reference.
(17) Filed as an exhibit to the Form 10-Q for the quarter ended June 30, 1999
on August 3, 1999 and incorporated herein by reference.
(18) Filed as an exhibit to the Annual Report on Form 10-K for the year ended
December 31, 1999 on March 7, 2000 and incorporated herein by reference.
(19) Filed as an exhibit to the Form 10-Q for the quarter ended June 30, 2000
on August 1, 2000 and incorporated herein by reference.
(20) Filed as an exhibit to the Form 10-Q for the quarter ended September 30,
2000 on November 14, 2000 and incorporated herein by reference.
(21) Filed as an exhibit to the Form 8-K Current Report dated December 13, 2000
on December 18, 2000 and incorporated herein by reference.
(b) Reports on Form 8-K
The Company filed three Current Reports on Form 8-K during the three months ended December 31, 2000. The report filed on November 3, 2000 reported under Item 5 that on October 26, 2000, the Company publicly disseminated a press release announcing its third quarter of 2000 financial results. The report filed on November 13, 2000 reported under Item 5 that on November 8, 2000, the Company publicly disseminated a press release updating the investment community on the Company's business and providing certain financial guidance. The report filed on December 18, 2000 reported under Item 5 that on December 12, 2000, the Company's Board of Directors amended and restated its stockholder rights agreement and approved the Amended and Restated Rights Agreement, dated as of December 12, 2000, between the Company and American Stock Transfer & Trust Company.
SIGNATURES
Pursuant to the requirements of the Securities Exchange Act of 1934, the registrant has duly caused this Annual Report to be signed on its behalf by the undersigned, thereunto duly authorized.
AMGEN INC.
(Registrant)
/s/ Kathryn E. Falberg
Date: 3/6/01 By: _________________________________
Kathryn E. Falberg
Senior Vice President, Finance
and Chief Financial Officer
|
POWER OF ATTORNEY
KNOW ALL MEN AND WOMEN BY THESE PRESENTS, that each person whose signature appears below constitutes and appoints Kathryn E. Falberg and Barry D. Schehr, or either of them, his or her attorney-in-fact, each with the power of substitution, for him or her in any and all capacities, to sign any amendments to this Report, and to file the same, with exhibits thereto and other documents in connection therewith, with the Securities and Exchange Commission, hereby ratifying and confirming all that each of said attorneys-in-fact, or his or her substitute or substitutes, may do or cause to be done by virtue hereof.
Pursuant to the requirements of the Securities Exchange Act of 1934, this report has been signed below by the following persons on behalf of the registrant and in the capacities and on the dates indicated:
Signature Title Date
--------- ----- ----
/s/ Kevin W. Sharer Chairman of the Board, Chief 3/6/01
____________________________________ Executive Officer and
Kevin W. Sharer Director (Principal
Executive Officer)
/s/ Kathryn E. Falberg Senior Vice President, 3/6/01
____________________________________ Finance and Chief Financial
Kathryn E. Falberg Officer
/s/ Barry D. Schehr Vice President, Financial 3/6/01
____________________________________ Operations, and Chief
Barry D. Schehr Accounting Officer
/s/ David Baltimore Director 3/6/01
____________________________________
David Baltimore
/s/ William K. Bowes, Jr. Director 3/6/01
____________________________________
William K. Bowes, Jr.
/s/ Jerry D. Choate Director 3/6/01
____________________________________
Jerry D. Choate
/s/ Frederick W. Gluck Director 3/6/01
____________________________________
Frederick W. Gluck
/s/ Franklin P. Johnson, Jr. Director 3/6/01
____________________________________
Franklin P. Johnson, Jr.
/s/ Steven Lazarus Director 3/6/01
____________________________________
Steven Lazarus
/s/ Gilbert S. Omenn Director 3/6/01
____________________________________
Gilbert S. Omenn
/s/ Judith C. Pelham Director 3/6/01
____________________________________
Judith C. Pelham
/s/ J. Paul Reason Director 3/6/01
____________________________________
J. Paul Reason
/s/ Donald B. Rice Director 3/6/01
____________________________________
Donald B. Rice
|
EXHIBIT 23
CONSENT OF ERNST & YOUNG LLP, INDEPENDENT AUDITORS
We consent to the incorporation by reference in the Registration Statement (Form S-8 No. 33-5111) pertaining to the 1984 Stock Option Plan, 1981 Incentive Stock Option Plan and Nonqualified Stock Option Plan of Amgen Inc., in the Registration Statement (Form S-8 No. 33-24013) pertaining to the Amended and Restated 1988 Stock Option Plan of Amgen Inc., in the Registration Statement (Form S-8 No. 33-39183) pertaining to the Amended and Restated Employee Stock Purchase Plan, in the Registration Statement (Form S-8 No. 33-39104) pertaining to the Amended and Restated Amgen Retirement and Savings Plan, in the Registration Statements (Form S-3/S-8 No. 33-29791 and Form S-8 No. 33-42501) pertaining to the Amended and Restated 1987 Directors' Stock Option Plan, in the Registration Statement (Form S-8 No. 33-42072) pertaining to the Amgen Inc. Amended and Restated 1991 Equity Incentive Plan, in the Registration Statement (Form S-8 No. 33-47605) pertaining to the Retirement and Savings Plan for Amgen Puerto Rico, Inc., in the Registration Statement (Form S-8 No. 333-44727) pertaining to the Amgen Inc. 1997 Special Non-Officer Equity Incentive Plan, in the Registration Statement (Form S-3 No. 333-19931) of Amgen Inc., in the Registration Statement (Form S-3 No. 333-40405) of Amgen Inc., in the Registration Statement (Form S-8 No. 333-62735) pertaining to the Amgen Inc. Amended and Restated 1997 Special Non-Officer Equity Incentive Plan, in the Registration Statement (Form S-3 No. 333-53929) pertaining to the Amgen Inc. 1997 Special Non-Officer Equity Incentive Plan, the Amgen Inc. Amended and Restated 1991 Equity Incentive Plan, the Amended and Restated 1988 Stock Option Plan of Amgen Inc. and the Amended and Restated 1987 Directors' Stock Option Plan and in the Registration Statement (Form S-8 No. 333-74585) pertaining to the Amgen Limited Sharesave Plan and in the related Prospectuses of our report dated January 23, 2001, with respect to the consolidated financial statements and financial statement schedule of Amgen Inc. included in this Annual Report (Form 10-K) for the year ended December 31, 2000.
/s/ ERNST & YOUNG LLP
Los Angeles, California
March 6, 2001
|
REPORT OF ERNST & YOUNG LLP, INDEPENDENT AUDITORS
The Board of Directors and Stockholders of Amgen Inc.
We have audited the accompanying consolidated balance sheets of Amgen Inc. as of December 31, 2000 and 1999, and the related consolidated statements of operations, stockholders' equity, and cash flows for each of the three years in the period ended December 31, 2000. Our audits also included the financial statement schedule listed in the Index at Item 14(a). These financial statements and schedule are the responsibility of the Company's management. Our responsibility is to express an opinion on these financial statements based on our audits.
We conducted our audits in accordance with auditing standards generally accepted in the United States. Those standards require that we plan and perform the audit to obtain reasonable assurance about whether the financial statements are free of material misstatement. An audit includes examining, on a test basis, evidence supporting the amounts and disclosures in the financial statements. An audit also includes assessing the accounting principles used and significant estimates made by management, as well as evaluating the overall financial statement presentation. We believe that our audits provide a reasonable basis for our opinion.
In our opinion, the financial statements referred to above present fairly, in all material respects, the consolidated financial position of Amgen Inc. as of December 31, 2000 and 1999, and the consolidated results of its operations and its cash flows for each of the three years in the period ended December 31, 2000, in accordance with accounting principles generally accepted in the United States. Also, in our opinion, the related financial statement schedule, when considered in relation to the basic financial statements taken as a whole, presents fairly in all material respects the information set forth therein.
/s/ ERNST & YOUNG LLP
Los Angeles, California
January 23, 2001
|
AMGEN INC.
CONSOLIDATED STATEMENTS OF OPERATIONS
Years ended December 31, 2000, 1999 and 1998
(In millions, except per share data)
2000 1999 1998
-------- -------- --------
Revenues:
Product sales............. $3,202.2 $3,042.8 $2,514.4
Corporate partner
revenues................. 246.2 161.4 127.9
Royalty income............ 181.0 135.9 75.9
-------- -------- --------
Total revenues.......... 3,629.4 3,340.1 2,718.2
-------- -------- --------
Operating expenses:
Cost of sales............. 408.4 402.1 345.2
Research and development.. 845.0 822.8 663.3
Selling, general and
administrative........... 826.9 654.3 515.4
Loss of affiliates, net... 23.9 16.8 28.6
Other items, net.......... (18.8) (49.0) (23.0)
-------- -------- --------
Total operating
expenses............... 2,085.4 1,847.0 1,529.5
-------- -------- --------
Operating income............ 1,544.0 1,493.1 1,188.7
Other income (expense):
Interest and other income,
net...................... 146.2 88.3 45.7
Interest expense, net..... (15.9) (15.2) (10.0)
-------- -------- --------
Total other income...... 130.3 73.1 35.7
-------- -------- --------
Income before income taxes.. 1,674.3 1,566.2 1,224.4
Provision for income taxes.. 535.8 469.8 361.2
-------- -------- --------
Net income.................. $1,138.5 $1,096.4 $ 863.2
======== ======== ========
Earnings per share:
Basic..................... $ 1.11 $ 1.07 $ 0.85
Diluted................... $ 1.05 $ 1.02 $ 0.82
Shares used in calculation
of earnings per share:
Basic..................... 1,029.6 1,021.7 1,020.2
Diluted................... 1,084.7 1,078.3 1,057.3
|
See accompanying notes.
AMGEN INC.
CONSOLIDATED BALANCE SHEETS
December 31, 2000 and 1999
(In millions, except per share data)
2000 1999
-------- --------
ASSETS
------
Current assets:
Cash and cash equivalents................................. $ 226.5 $ 130.9
Marketable securities..................................... 1,801.6 1,202.1
Trade receivables, net of allowance for doubtful accounts
of $21.2 in 2000 and $26.0 in 1999....................... 389.2 412.2
Inventories............................................... 305.2 184.3
Other current assets...................................... 214.6 135.8
-------- --------
Total current assets.................................... 2,937.1 2,065.3
Property, plant and equipment at cost, net.................. 1,781.5 1,553.6
Other assets................................................ 681.0 458.7
-------- --------
$5,399.6 $4,077.6
======== ========
LIABILITIES AND STOCKHOLDERS' EQUITY
------------------------------------
Current liabilities:
Accounts payable.......................................... $ 143.2 $ 83.4
Commercial paper.......................................... 99.7 99.5
Accrued liabilities....................................... 619.2 648.2
-------- --------
Total current liabilities............................... 862.1 831.1
Long-term debt.............................................. 223.0 223.0
Stockholders' equity:
Preferred stock; $0.0001 par value; 5.0 shares authorized;
none issued or outstanding............................... -- --
Common stock and additional paid-in capital; $0.0001 par
value; 2,750.0 shares authorized; outstanding--1,037.4
shares in 2000 and 1,017.9 shares in 1999................ 2,947.3 2,072.3
Retained earnings......................................... 1,304.6 966.0
Accumulated other comprehensive income (loss)............. 62.6 (14.8)
-------- --------
Total stockholders' equity.............................. 4,314.5 3,023.5
-------- --------
$5,399.6 $4,077.6
======== ========
|
See accompanying notes.
AMGEN INC.
CONSOLIDATED STATEMENTS OF STOCKHOLDERS' EQUITY
Years ended December 31, 2000, 1999 and 1998
(In millions)
Common
stock and Accumulated
Number additional other
of paid-in Retained comprehensive
shares capital earnings income (loss) Total
------- ---------- --------- ------------- ---------
Balance at December 31,
1997.................. 1,033.1 $1,218.2 $ 943.2 $(22.1) $ 2,139.3
---------
Comprehensive Income:
Net income........... -- -- 863.2 -- 863.2
Other comprehensive
income, net of tax:
Unrealized gains on
securities,
net of
reclassification
adjustments........ -- -- -- 9.1 9.1
Foreign currency
translation
adjustments........ -- -- -- 9.0 9.0
---------
Total other
comprehensive
income........... -- -- -- -- 18.1
---------
Comprehensive income... -- -- -- -- 881.3
Issuance of common
stock upon the
exercise of employee
stock options and in
connection with an
employee stock
purchase plan......... 42.8 345.5 -- -- 345.5
Tax benefits related to
employee stock
options............... -- 108.2 -- -- 108.2
Repurchases of common
stock................. (57.4) -- (912.1) -- (912.1)
------- -------- --------- ------ ---------
Balance at December 31,
1998.................. 1,018.5 1,671.9 894.3 (4.0) 2,562.2
---------
Comprehensive Income:
Net income........... -- -- 1,096.4 -- 1,096.4
Other comprehensive
loss, net of tax:
Unrealized gains on
securities, net of
reclassification
adjustments........ -- -- -- 7.3 7.3
Foreign currency
translation
adjustments........ -- -- -- (18.1) (18.1)
---------
Total other
comprehensive
loss............. -- -- -- -- (10.8)
---------
Comprehensive income... -- -- -- -- 1,085.6
Issuance of common
stock upon the
exercise of employee
stock options......... 26.5 248.8 -- -- 248.8
Tax benefits related to
employee stock
options............... -- 151.6 -- -- 151.6
Repurchases of common
stock................. (27.1) -- (1,024.7) -- (1,024.7)
------- -------- --------- ------ ---------
Balance at December 31,
1999.................. 1,017.9 2,072.3 966.0 (14.8) 3,023.5
---------
Comprehensive Income:
Net income........... -- -- 1,138.5 -- 1,138.5
Other comprehensive
income, net of tax:
Unrealized gains on
securities, net of
reclassification
adjustments........ -- -- -- 99.0 99.0
Foreign currency
translation
adjustments........ -- -- -- (21.6) (21.6)
---------
Total other
comprehensive
income........... -- -- -- -- 77.4
---------
Comprehensive income... -- -- -- -- 1,215.9
Issuance of common
stock upon the
exercise of employee
stock options and in
connection with an
employee stock
purchase plan......... 29.1 333.7 -- -- 333.7
Tax benefits related to
employee stock
options............... -- 376.6 -- -- 376.6
Issuance of common
stock for the
acquisition of Kinetix
Pharmaceuticals,
Inc. ................. 2.6 164.7 -- -- 164.7
Repurchases of common
stock................. (12.2) -- (799.9) -- (799.9)
------- -------- --------- ------ ---------
Balance at December 31,
2000.................. 1,037.4 $2,947.3 $ 1,304.6 $ 62.6 $ 4,314.5
======= ======== ========= ====== =========
|
See accompanying notes.
AMGEN INC.
CONSOLIDATED STATEMENTS OF CASH FLOWS
Years ended December 31, 2000, 1999 and 1998
(In millions)
2000 1999 1998
--------- --------- --------
Cash flows from operating activities:
Net income................................... $ 1,138.5 $ 1,096.4 $ 863.2
Write-off of acquired in-process research and
development................................. 30.1 -- --
Depreciation and amortization................ 211.8 176.8 143.8
Tax benefits related to employee stock
options..................................... 376.6 151.6 108.2
Gain on equity investments................... (31.8) -- (17.3)
Other non-cash expenses...................... 6.2 9.8 27.5
Loss of affiliates, net...................... 23.9 16.8 28.6
Cash provided by (used in):
Trade receivables, net..................... 23.0 (92.3) (50.9)
Inventories................................ (120.9) (73.5) (1.6)
Other current assets....................... (51.4) (9.0) (21.2)
Accounts payable........................... 59.8 (38.2) 17.7
Accrued liabilities........................ (31.2) (11.5) 51.7
--------- --------- --------
Net cash provided by operating
activities.............................. 1,634.6 1,226.9 1,149.7
--------- --------- --------
Cash flows from investing activities:
Purchases of property, plant and equipment... (437.7) (304.2) (407.8)
Proceeds from maturities of marketable
securities.................................. -- 40.0 20.1
Proceeds from sales of marketable
securities.................................. 1,067.8 843.5 466.2
Purchases of marketable securities........... (1,638.7) (1,032.7) (766.3)
Other........................................ (27.7) (10.1) 14.1
--------- --------- --------
Net cash used in investing activities.... (1,036.3) (463.5) (673.7)
--------- --------- --------
Cash flows from financing activities:
Increase (decrease) in commercial paper...... 0.2 (0.2) 99.7
Net proceeds from issuance of common stock
upon the exercise of employee stock options
and in connection with an employee stock
purchase plan............................... 333.7 248.8 345.5
Repurchases of common stock.................. (799.9) (1,024.7) (912.1)
Other........................................ (36.7) (57.5) (47.1)
--------- --------- --------
Net cash used in financing activities.... (502.7) (833.6) (514.0)
--------- --------- --------
Increase (decrease) in cash and cash
equivalents................................... 95.6 (70.2) (38.0)
Cash and cash equivalents at beginning of
period........................................ 130.9 201.1 239.1
--------- --------- --------
Cash and cash equivalents at end of period..... $ 226.5 $ 130.9 $ 201.1
========= ========= ========
|
See accompanying notes.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS
December 31, 2000
1. Summary of significant accounting policies
Business
Amgen Inc. ("Amgen" or the "Company") is a global biotechnology company that discovers, develops, manufactures and markets human therapeutics based on advances in cellular and molecular biology.
Principles of consolidation
The consolidated financial statements include the accounts of the Company and its wholly owned subsidiaries as well as affiliated companies in which the Company has a controlling financial interest and exercises control over their operations ("majority controlled affiliates"). All material intercompany transactions and balances have been eliminated in consolidation. Investments in affiliated companies which are 50% or less owned and where the Company exercises significant influence over operations are accounted for using the equity method. All other equity investments are accounted for under the cost method. The caption "Loss of affiliates, net" includes Amgen's equity in the operating results of affiliated companies and the minority interest others hold in the operating results of Amgen's majority controlled affiliates.
Cash and cash equivalents
The Company considers cash equivalents to be only those investments which are highly liquid, readily convertible to cash and which mature within three months from date of purchase. Under the Company's cash management system, the bank notifies the Company daily of checks presented for payment against its primary disbursement accounts. The Company transfers funds from short-term investments to cover the checks presented for payment. This system results in a book cash overdraft in the primary disbursement accounts as a result of checks outstanding. The book overdraft, which was reclassified to accounts payable, was $101.2 million and $43.9 million at December 31, 2000 and 1999, respectively.
Available-for-sale securities
The Company considers its investment portfolio and marketable equity investments available-for-sale as defined in Statement of Financial Accounting Standards ("SFAS") No. 115 and, accordingly, these investments are recorded at fair value (see Note 9, "Fair values of financial instruments"). Realized gains totaled $32.4 million, $2.8 million and $17.3 million for the years ended December 31, 2000, 1999 and 1998, respectively. Realized losses totaled $2.5 million, $6.6 million and $33.1 million for the years ended December 31, 2000, 1999 and 1998, respectively. The cost of securities sold is based on the specific identification method. The fair value of available-for-sale investments by type of security, contractual maturity and classification in the balance sheets are as follows (in millions):
Gross Gross Estimated
Amortized Unrealized Unrealized Fair
December 31, 2000 Cost Gains Losses Value
----------------- --------- ---------- ---------- ---------
Type of security:
Corporate debt securities........... $1,054.7 $ 11.3 ($1.4) $1,064.6
U.S. Treasury securities and
obligations of U.S. government
agencies........................... 663.6 5.9 -- 669.5
Other interest bearing securities... 215.8 0.4 (0.1) 216.1
-------- ------ ----- --------
Total debt securities............. 1,934.1 17.6 (1.5) 1,950.2
Equity securities................... 73.1 179.2 (7.0) 245.3
-------- ------ ----- --------
$2,007.2 $196.8 ($8.5) $2,195.5
======== ====== ===== ========
|
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Gross Gross Estimated
Amortized Unrealized Unrealized Fair
December 31, 1999 Cost Gains Losses Value
----------------- --------- ---------- ---------- ---------
Type of security:
Corporate debt securities........... $ 963.8 $ 0.4 $(10.8) $ 953.4
U.S. Treasury securities and
obligations of U.S. government
agencies........................... 209.9 -- (1.6) 208.3
Other interest bearing securities... 132.4 -- (0.5) 131.9
-------- ----- ------ --------
Total debt securities............. 1,306.1 0.4 (12.9) 1,293.6
Equity securities................... 66.8 46.7 (8.9) 104.6
-------- ----- ------ --------
$1,372.9 $47.1 $(21.8) $1,398.2
======== ===== ====== ========
|
December 31,
------------------
2000 1999
-------- --------
Contractual maturity:
Maturing in one year or less........................... $ 783.6 $ 376.4
Maturing after one year through three years............ 986.1 896.0
Maturing after three years............................. 180.5 21.2
-------- --------
Total debt securities................................ 1,950.2 1,293.6
Equity securities...................................... 245.3 104.6
-------- --------
$2,195.5 $1,398.2
======== ========
Classification in balance sheets:
Cash and cash equivalents.............................. $ 226.5 $ 130.9
Marketable securities.................................. 1,801.6 1,202.1
Other assets--noncurrent............................... 285.3 144.6
-------- --------
2,313.4 1,477.6
Less cash.............................................. (117.9) (79.4)
-------- --------
$2,195.5 $1,398.2
======== ========
|
The primary objectives for the Company's investment portfolio are liquidity and safety of principal. Investments are made to achieve the highest rate of return to the Company, consistent with these two objectives. The Company's investment policy limits investments to certain types of instruments issued by institutions with investment grade credit ratings and places restrictions on maturities and concentration by type and issuer.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Inventories
Inventories are stated at the lower of cost or market. Cost is determined in a manner which approximates the first-in, first-out (FIFO) method. Inventories consist of currently marketed products and product candidates which the Company expects to commercialize. The inventory balance of such product candidates totaled $112.7 million and $20.3 million as of December 31, 2000 and 1999, respectively. Inventories are shown net of applicable reserves and allowances. Inventories consisted of the following (in millions):
December 31,
-------------
2000 1999
------ ------
Raw materials.................................................. $ 29.4 $ 37.5
Work in process................................................ 238.7 96.6
Finished goods................................................. 37.1 50.2
------ ------
$305.2 $184.3
====== ======
|
Depreciation and amortization
Depreciation of buildings and equipment is provided over their estimated useful lives on a straight-line basis. Leasehold improvements are amortized on a straight-line basis over the shorter of their estimated useful lives or lease terms, including periods covered by options which are expected to be exercised. Useful lives by asset category are as follows:
Asset category Years -------------- ----- Buildings and building improvements.................................. 10-30 Manufacturing equipment.............................................. 5-10 Laboratory equipment................................................. 5-10 Furniture and office equipment....................................... 3-10 |
Long-lived assets
The Company reviews its long-lived assets for impairment whenever events or changes in circumstances indicate that the carrying amount of an asset may not be recoverable.
Product sales
Product sales primarily consist of sales of EPOGEN(R) (Epoetin alfa) and NEUPOGEN(R) (Filgrastim) (see Note 10, "Segment information").
The Company has the exclusive right to sell Epoetin alfa for dialysis, diagnostics and all non-human uses in the United States. The Company sells Epoetin alfa under the brand name EPOGEN(R). Amgen has granted to Ortho Pharmaceutical Corporation (which has assigned its rights under the product license agreement to Ortho Biotech Products, L.P.), a subsidiary of Johnson & Johnson ("Johnson & Johnson"), a license relating to Epoetin alfa for sales in the United States for all human uses except dialysis and diagnostics. Pursuant to this license, Amgen does not recognize product sales it makes into the exclusive market of Johnson & Johnson and does recognize the product sales made by Johnson & Johnson into Amgen's exclusive market. Sales in Amgen's exclusive market and adjustments thereto are derived from Company shipments and from third-party data on shipments to end users and their usage (see Note 4, "Other items, net--Legal award"). Sales of the Company's other products are recognized when shipped and title has passed.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Research and development costs
Research and development costs are expensed as incurred, including the cost to acquire in-process research and development (see Note 11, "Business combination").
Foreign currency transactions
The Company has a program to manage foreign currency risk. As part of this program, it has purchased foreign currency option and forward contracts to hedge against possible reductions in values of certain anticipated foreign currency cash flows generally over the next 12 months. At December 31, 2000, the Company had option contracts and forward contracts to exchange foreign currencies for U.S. dollars of $10.0 million and $150.6 million, respectively, all having maturities of eleven months or less. The option contracts, which have only nominal intrinsic value at the time of purchase, are designated as effective hedges of anticipated foreign currency transactions for financial reporting purposes and, accordingly, the net gains on such contracts are deferred and recognized in the same period as the hedged transactions. The forward contracts do not qualify as hedges for financial reporting purposes and, accordingly, are marked-to-market. Net gains realized on option contracts and changes in market values of forward contracts are reflected in "Interest and other income, net" in the accompanying consolidated statements of operations. The deferred premiums on option contracts and fair values of forward contracts are included in "Other current assets" in the accompanying consolidated balance sheets.
The Company has additional foreign currency forward contracts to hedge exposures to foreign currency fluctuations of certain assets and liabilities denominated in foreign currencies. At December 31, 2000, the Company had forward contracts to exchange foreign currencies for U.S. dollars of $37.8 million, all having maturities of less than one month. These contracts are designated as effective hedges and, accordingly, gains and losses on these forward contracts are recognized in the same period the offsetting gains and losses of hedged assets and liabilities are realized and recognized. The fair values of the forward contracts are included in the corresponding captions of the hedged assets and liabilities. Gains and losses on forward contracts and the related hedged assets and liabilities are included in "Interest and other income, net" in the accompanying consolidated statements of operations.
Recent accounting pronouncements
In June 1998, the Financial Accounting Standards Board issued SFAS No. 133, "Accounting for Derivative Instruments and Hedging Activities". SFAS No. 133 establishes accounting and reporting standards requiring that all derivatives be recorded in the balance sheet as either an asset or liability measured at fair value and that changes in fair value be recognized currently in earnings, unless specific hedge accounting criteria are met. Certain provisions of SFAS No. 133, including its required implementation date, were subsequently amended. The Company will adopt SFAS No. 133, as amended, in the first quarter of 2001 and its adoption will not have a material effect on the Company's results of operations or financial position.
In December 1999, the Securities and Exchange Commission issued Staff Accounting Bulletin No. 101, "Revenue Recognition in Financial Statements" ("SAB 101"). SAB 101 provides guidance on applying generally accepted accounting principles to revenue recognition issues in financial statements. The Company adopted SAB 101 in the fourth quarter of 2000 and its adoption has not had a material effect on the Company's results of operations or financial position.
In July 2000, the Emerging Issues Task Force ("EITF") issued EITF 00-15, "Classification in the Statement of Cash Flows of the Income Tax Benefit Realized by a Company upon Employee Exercise of a Nonqualified Stock Option", which requires companies to classify the income tax benefits related to employee
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
exercises of nonqualified stock options as an operating activity in the statement of cash flows for both current and prior periods. Prior to the adoption of EITF 00-15 in the third quarter of 2000, Amgen had classified these amounts in financing activities in the consolidated statements of cash flows. In addition, the Company has included the income tax benefits related to disqualifying dispositions of incentive stock options within this reclassification.
Interest
Interest costs are expensed as incurred, except to the extent such interest is related to construction in progress, in which case interest is capitalized. Interest costs capitalized for the years ended December 31, 2000, 1999 and 1998, were $12.3 million, $11.6 million and $19.2 million, respectively.
Employee stock option and stock purchase plans
The Company's employee stock option and stock purchase plans are accounted for under Accounting Principles Board Opinion No. 25, "Accounting for Stock Issued to Employees" ("APB 25"). See Note 7, "Employee stock option, stock purchase and defined contribution plans".
Earnings per share
Basic earnings per share is based upon the weighted-average number of common shares outstanding. Diluted earnings per share is based upon the weighted- average number of common shares and dilutive potential common shares outstanding. Potential common shares are outstanding options under the Company's employee stock option plans, restricted stock and potential issuances of stock under the employee stock purchase plan which are included under the treasury stock method.
The following table sets forth the computation for basic and diluted earnings per share (in millions, except per share information):
Years ended December 31,
--------------------------
2000 1999 1998
-------- -------- --------
Numerator for basic and diluted earnings per share--
net income.......................................... $1,138.5 $1,096.4 $ 863.2
======== ======== ========
Denominator:
Denominator for basic earnings per share--weighted-
average shares.................................... 1,029.6 1,021.7 1,020.2
Effect of dilutive securities--employee stock
options, restricted stock and potential stock
issuances under the employee stock purchase plan.. 55.1 56.6 37.1
-------- -------- --------
Denominator for diluted earnings per share--
adjusted weighted-average shares.................. 1,084.7 1,078.3 1,057.3
======== ======== ========
Basic earnings per share............................. $ 1.11 $ 1.07 $ 0.85
======== ======== ========
Diluted earnings per share........................... $ 1.05 $ 1.02 $ 0.82
======== ======== ========
|
Options to purchase 10.6 million, 1.6 million and 3.0 million shares with exercise prices greater than the average market prices of common stock were outstanding at December 31, 2000, 1999 and 1998, respectively. These options were excluded from the respective computations of diluted earnings per share because their effect would be anti-dilutive.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Use of estimates
The preparation of financial statements in conformity with generally accepted accounting principles requires management to make estimates and assumptions that affect the amounts reported in the financial statements and accompanying notes. Actual results may differ from those estimates.
Reclassification
Certain prior year amounts have been reclassified to conform to the current year presentation.
2. Related party transactions
The Company owns a 50% interest in Kirin-Amgen, Inc. ("Kirin-Amgen"), a corporation formed in 1984 for the development and commercialization of certain products based on advanced biotechnology. Pursuant to the terms of agreements entered into with Kirin-Amgen, the Company conducts certain research and development activities on behalf of Kirin-Amgen and is paid for such services at negotiated rates. During the years ended December 31, 2000, 1999 and 1998, Amgen earned revenues from Kirin-Amgen of $221.0 million, $138.5 million and $121.0 million, respectively, under such agreements, which are included in "Corporate partner revenues" in the accompanying consolidated statements of operations.
In connection with its various agreements with Kirin-Amgen, the Company has been granted sole and exclusive licenses for the manufacture and sale of certain products in specified geographic areas of the world. In return for such licenses, the Company pays Kirin-Amgen royalties based on sales. During the years ended December 31, 2000, 1999 and 1998, Kirin-Amgen earned royalties from Amgen of $140.8 million, $128.1 million and $105.0 million, respectively, under such agreements, which are included in "Cost of sales" in the accompanying consolidated statements of operations.
At December 31, 2000, Amgen's share of Kirin-Amgen's undistributed retained earnings was approximately $75.9 million.
3. Debt
The Company has a commercial paper program which provides for unsecured short-term borrowings up to an aggregate of $200 million. As of December 31, 2000, commercial paper with a face amount of $100 million was outstanding. These borrowings had maturities of less than two months and had effective interest rates averaging 6.7%. Commercial paper with a face amount of $100 million and with effective interest rates averaging 6.0% was outstanding at December 31, 1999.
The Company has established a $500 million debt shelf registration statement. In December 1997, pursuant to this registration statement, the Company issued $100 million of debt securities that bear interest at a fixed rate of 6.5% and mature in 2007 (the "Notes") and established a $400 million medium-term note program. The Company may offer and issue medium-term notes from time to time with terms to be determined by market conditions.
The Company had $100 million of debt securities outstanding at December 31, 2000 and 1999 that bear interest at a fixed rate of 8.1% and mature in 2097 (the "Century Notes"). These securities may be redeemed in whole or in part at the Company's option at any time for a redemption price equal to the greater of the principal amount to be redeemed or the sum of the present values of the principal and remaining interest payments discounted at a determined rate plus, in each case, accrued interest.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
In addition to the Notes and the Century Notes, debt securities outstanding at December 31, 2000 and 1999 include $23 million of debt securities that bear interest at a fixed rate of 6.2% and mature in 2003. The terms of the debt securities require the Company to meet certain debt to tangible net asset ratios and places limitations on liens and sale/leaseback transactions and, except with respect to the Notes and the Century Notes, places limitations on subsidiary indebtedness.
The Company has an unsecured credit facility (the "credit facility") that includes a commitment expiring on May 28, 2003 for up to $150 million of borrowings under a revolving line of credit (the "revolving line commitment"). This credit facility supports the Company's commercial paper program. As of December 31, 2000, $150 million was available under the revolving line commitment for borrowing. Borrowings under the revolving line commitment bear interest at various rates which are a function of, at the Company's option, either the prime rate of a major bank, the federal funds rate or a Eurodollar base rate. Under the terms of the credit facility, the Company is required to meet a minimum interest coverage ratio and maintain a minimum level of tangible net worth. In addition, the credit facility contains limitations on investments, liens and sale/leaseback transactions.
The aggregate stated maturities of all long-term obligations due subsequent to December 31, 2000, are as follows: none in 2001 and 2002; $23 million in 2003; none in 2004 and 2005; and $200 million after 2005.
4. Other items, net
Other items, net in the accompanying consolidated statements of operations consists of the following (income) and expense items (in millions):
Years ended December
31,
----------------------
2000 1999 1998
------ ------ ------
Legal award, net................................... $(73.9) $(49.0) $(23.0)
Write-off of acquired in-process research and
development (see Note 11)......................... 30.1 -- --
Amgen Foundation contribution...................... 25.0 -- --
------ ------ ------
Other items, net................................... $(18.8) $(49.0) $(23.0)
====== ====== ======
|
Legal award
In September 1985, the Company granted Johnson & Johnson's affiliate, Ortho Pharmaceutical Corporation, a license relating to certain patented technology and know-how of the Company to sell a genetically engineered form of recombinant human erythropoietin, called Epoetin alfa, throughout the United States for all human uses except dialysis and diagnostics. A number of disputes have arisen between Amgen and Johnson & Johnson as to their respective rights and obligations under the various agreements between them, including the agreement granting the license (the "License Agreement").
A dispute between Amgen and Johnson & Johnson that had been the subject of an arbitration proceeding related to the audit methodology currently employed by the Company to account for Epoetin alfa sales. Under the License Agreement, the Company and Johnson & Johnson are required to compensate each other for Epoetin alfa sales that either party makes into the other party's exclusive market, sometimes described as "spillover" sales. The Company has established and is employing an audit methodology to measure each party's spillover sales and to allocate the net profits from those sales to the appropriate party. The arbitrator in this dispute (the "Arbitrator") issued a final order adopting the Company's audit methodology with certain adjustments and also found that the Company was the successful party in the arbitration. Pursuant to the final order in the arbitration, an independent panel was formed principally (i) to address ongoing challenges to the
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
survey results for the years 1995 through 1999 and (ii) to refine the procedures for measuring the erythropoietin market as may be necessary. As a result of decisions made by this independent panel regarding certain challenges by Johnson & Johnson as well as other reduced uncertainties, the Company reduced amounts previously provided for potential spillover liabilities by $49 million in the third quarter of 1999 and $23 million in the fourth quarter of 1998.
Because the Arbitrator ruled that the Company was the successful party in the arbitration, Johnson & Johnson was ordered to pay to the Company all costs and expenses, including reasonable attorneys' fees, that the Company incurred in the arbitration as well as one-half of the audit costs. On July 17, 2000, the Arbitrator issued a final order awarding the Company approximately $78 million in costs and expenses, including reasonable attorneys' fees, that the Company incurred in the arbitration as well as one-half of the audit costs (the "Fee Award"). As a result, the Company recorded a net $73.9 million legal award, which represents the Fee Award reduced by minor amounts related to other miscellaneous disputes with Johnson & Johnson, in the third quarter of 2000.
Amgen Foundation contribution
During the fourth quarter of 2000, the Company contributed $25.0 million to the Amgen Foundation. This contribution will allow the Amgen Foundation to increase its support of non-profit organizations that focus on issues in health and medicine, science education and other activities that strengthen local communities over the next several years.
5. Income taxes
The provision for income taxes includes the following (in millions):
Years ended December
31,
---------------------
2000 1999 1998
------ ------ ------
Current provision:
Federal (including U.S. possessions)................ $481.7 $422.8 $339.6
State............................................... 47.5 37.2 27.2
------ ------ ------
Total current provision........................... 529.2 460.0 366.8
------ ------ ------
Deferred provision (benefit):
Federal (including U.S. possessions)................ 9.6 5.3 (4.7)
State............................................... (3.0) 4.5 (0.9)
------ ------ ------
Total deferred provision (benefit)................ 6.6 9.8 (5.6)
------ ------ ------
$535.8 $469.8 $361.2
====== ====== ======
|
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Deferred income taxes reflect the net tax effects of net operating loss and credit carryforwards and temporary differences between the carrying amounts of assets and liabilities for financial reporting purposes and the amounts used for income tax purposes. Significant components of the Company's deferred tax assets and liabilities are as follows (in millions):
December 31,
----------------
2000 1999
------- -------
Deferred tax assets:
Acquired net operating loss and credit carryforwards.... $ 66.0 $ 64.3
Expenses capitalized for tax purposes................... 58.9 27.9
Fixed assets............................................ 46.0 22.9
Expense accruals........................................ 32.9 84.0
Other................................................... 20.0 27.4
------- -------
Total deferred tax assets............................. 223.8 226.5
Valuation allowance..................................... (25.4) (46.0)
------- -------
Net deferred tax assets............................... 198.4 180.5
------- -------
Deferred tax liabilities:
Purchase of technology rights........................... (95.9) (78.1)
Marketable securities and investments................... (62.6) (10.0)
Other................................................... (39.3) (13.9)
------- -------
Total deferred tax liabilities........................ (197.8) (102.0)
------- -------
$ 0.6 $ 78.5
======= =======
|
At December 31, 2000, the Company had operating loss carryforwards available to reduce future federal taxable income of which $29.3 million expire in 2008, $84.0 million expire in 2009 and $16.8 million expire thereafter. These operating loss carryforwards relate to the acquisition of companies. Utilization of these operating loss carryforwards is limited to approximately $26 million in 2001, $23 million in 2002 and $16 million per year thereafter.
The provision for income taxes varies from income taxes provided based on the federal statutory rate as follows:
Years ended
December 31,
------------------
2000 1999 1998
---- ---- ----
Statutory rate applied to income before income taxes.. 35.0 % 35.0 % 35.0 %
Benefit of Puerto Rico operations, net of Puerto Rico
income taxes......................................... (2.0)% (2.3)% (3.2)%
Utilization of tax credits, primarily research and
experimentation...................................... (1.4)% (2.1)% (2.4)%
Other, net............................................ 0.4 % (0.6)% 0.1 %
---- ---- ----
32.0 % 30.0 % 29.5 %
==== ==== ====
|
Income taxes paid during the years ended December 31, 2000, 1999 and 1998, totaled $141.3 million, $318.7 million and $251.3 million, respectively.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
6. Stockholders' equity
Stockholder Rights Agreement
On February 18, 1997, the Board of Directors of the Company redeemed the rights under the Company's former common stock rights plan and declared a dividend of one preferred share purchase right (a "Right") for each then outstanding share of common stock of the Company and authorized the distribution of one Right with respect to each subsequently issued share of common stock. The Rights were distributed to stockholders of record on March 21, 1997. On December 12, 2000, the Board of Directors of the Company amended and restated the preferred stock rights plan governing the Rights (the "Amended and Restated Rights Plan") to, among other things: (i) provide that, as a result of two-for-one splits of the Company's common stock effected in February and November 1999 (the "Stock Splits"), each Right shall represent the right to purchase one four-thousandth of a share of Series A Junior Participating Preferred Stock ("Series A Preferred Stock") of the Company (which one four- thousandth gives effect to the Stock Splits); (ii) increase the exercise price of each Right to $350.00 from $56.25 (as adjusted for the Stock Splits); (iii) extend the term of the rights agreement to December 12, 2010 from March 21, 2007 and (iv) amend the definition of "Outside Director".
Pursuant to the Amended and Restated Rights Plan, each share of common stock outstanding has attached to it one whole Right. One Right represents the right to purchase one four-thousandth (1/4000) of a share of Series A Preferred Stock of the Company at $350.00. The Rights will expire on December 12, 2010.
Under certain circumstances, if an acquiring person or group acquires 10% or more of the Company's outstanding common stock, an exercisable Right will entitle its holder (other than the acquirer) to buy shares of common stock of the Company having a market value of two times the exercise price of one Right. However, in limited circumstances approved by the outside directors of the Board of Directors, a stockholder who enters into an acceptable standstill agreement may acquire up to 20% of the outstanding shares without triggering the Rights. If an acquirer acquires at least 10%, but less than 50%, of the Company's common stock, the Board of Directors may exchange each Right (other than those of the acquirer) for one share of common stock per Right. In addition, under certain circumstances, if the Company is involved in a merger or other business combination where it is not the surviving corporation, an exercisable Right will entitle its holder to buy shares of common stock of the acquiring company having a market value of two times the exercise price of one Right. The Company may redeem the Rights at $0.00025 per Right at any time prior to the public announcement that a 10% position has been acquired.
Stock repurchase program
The Company has a stock repurchase program primarily to reduce the dilutive effect of its employee stock option and stock purchase plans. Stock repurchased under the program is intended to be retired. The amount the Company spends on and the number of shares repurchased varies based on a variety of factors, including the stock price and blackout periods in which the Company is restricted from repurchasing shares. In December 2000, the Board of Directors authorized the Company to repurchase up to $2 billion of common stock between January 1, 2001 and December 31, 2002.
Other comprehensive income/(loss)
SFAS No. 130, "Reporting Comprehensive Income", requires unrealized gains and losses on the Company's available-for-sale securities and foreign currency translation adjustments to be included in other comprehensive income/(loss).
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Information regarding the components of accumulated other comprehensive income/(loss) are as follows (in millions):
Accumulated
Unrealized Foreign Other
Gains on Currency Comprehensive
Securities Translation Income/(Loss)
---------- ----------- -------------
Balance at December 31, 1999.......... $ 15.3 $(30.1) $(14.8)
Current year other comprehensive
income/(loss)........................ 99.0 (21.6) 77.4
------ ------ ------
Balance at December 31, 2000.......... $114.3 $(51.7) $ 62.6
====== ====== ======
|
Information regarding the income tax effects for items of other comprehensive income/(loss) are as follows (in millions):
Tax
Before-Tax Benefit/ After-Tax
Amount (Expense) Amount
---------- -------- ---------
For the year ended December 31, 1998:
Unrealized losses on available-for-sale
securities................................. $ (1.8) $ 0.7 $ (1.1)
Less: Reclassification adjustments for
losses realized in net income.............. (15.8) 5.6 (10.2)
------ ------ ------
Net unrealized gains on available-for-sale
securities................................. 14.0 (4.9) 9.1
Foreign currency translation adjustments.... 9.0 -- 9.0
------ ------ ------
Other comprehensive income.................. $ 23.0 $ (4.9) $ 18.1
====== ====== ======
For the year ended December 31, 1999:
Unrealized gains on available-for-sale
securities................................. $ 12.0 $ (5.3) $ 6.7
Less: Reclassification adjustments for
losses realized in net income.............. (1.0) 0.4 (0.6)
------ ------ ------
Net unrealized gains on available-for-sale
securities................................. 13.0 (5.7) 7.3
Foreign currency translation adjustments.... (18.1) -- (18.1)
------ ------ ------
Other comprehensive loss.................... $ (5.1) $ (5.7) $(10.8)
====== ====== ======
For the year ended December 31, 2000:
Unrealized gains on available-for-sale
securities................................. $193.0 $(75.8) $117.2
Less: Reclassification adjustments for gains
realized in net income..................... 30.0 (11.8) 18.2
------ ------ ------
Net unrealized gains on available-for-sale
securities................................. 163.0 (64.0) 99.0
Foreign currency translation adjustments.... (21.6) -- (21.6)
------ ------ ------
Other comprehensive income.................. $141.4 $(64.0) $ 77.4
====== ====== ======
|
Other
In addition to common stock, the Company's authorized capital includes 5.0 million shares of preferred stock, $0.0001 par value, of which 0.7 million shares have been designated Series A Preferred Stock. At December 31, 2000 and 1999, no shares of preferred stock were issued or outstanding.
At December 31, 2000, the Company had reserved 183.1 million shares of its common stock which may be issued through its employee stock option and stock purchase plans and had reserved 0.7 million shares of Series A Preferred Stock.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
7. Employee stock option, stock purchase and defined contribution plans
Employee stock option plans
The Company's employee stock option plans provide for option grants designated as either nonqualified or incentive stock options. Option grants to employees generally vest over a three to five year period and expire seven years from the date of grant. Most employees are eligible to receive a grant of stock options periodically with the number of shares generally determined by the employee's salary grade, performance level and the stock price. In addition, certain management and professional level employees normally receive a stock option grant upon hire. As of December 31, 2000, the Company had 67.8 million shares of common stock available for future grant under its employee stock option plans.
Stock option information with respect to all of the Company's employee stock option plans follows (shares in millions):
Exercise Price
-----------------------
Weighted-
Shares Low High Average
------ ------ ------ ---------
Balance unexercised at December 31, 1997....... 141.9 $ 0.58 $16.97 $10.02
Granted...................................... 33.5 $11.78 $26.22 $16.53
Exercised.................................... (42.4) $ 0.58 $20.77 $ 8.14
Forfeited.................................... (6.8) $ 4.48 $18.52 $13.57
-----
Balance unexercised at December 31, 1998....... 126.2 $ 0.66 $26.22 $12.18
Granted...................................... 19.0 $26.25 $57.69 $31.48
Exercised.................................... (26.9) $ 0.66 $39.44 $ 9.45
Forfeited.................................... (2.5) $ 5.48 $44.97 $17.76
-----
Balance unexercised at December 31, 1999....... 115.8 $ 0.92 $57.69 $15.88
Granted...................................... 13.1 $51.31 $78.00 $67.40
Exercised.................................... (28.2) $ 0.92 $72.75 $11.03
Forfeited.................................... (2.0) $ 4.48 $74.86 $26.02
-----
Balance unexercised at December 31, 2000....... 98.7 $ 2.55 $78.00 $23.89
=====
|
At December 31, 2000, 1999 and 1998, employee stock options to purchase 55.5 million, 61.7 million and 66.1 million shares were exercisable at weighted- average prices of $15.35, $11.80 and $9.76, respectively.
Fair value disclosures of employee stock options
Employee stock option grants are set at the closing price of the Company's common stock on the date of grant and the related number of shares granted are fixed at that point in time. Therefore, under the principles of APB 25, the Company does not recognize compensation expense associated with the grant of employee stock options. SFAS No. 123, "Accounting for Stock-Based Compensation," requires the use of option valuation models to provide supplemental information regarding options granted after 1994. Pro forma information regarding net income and earnings per share shown below was determined as if the Company had accounted for its employee stock options and shares sold under its employee stock purchase plan under the fair value method of that statement.
The fair value of the options was estimated at the date of grant using a Black-Scholes option pricing model with the following weighted-average assumptions for 2000, 1999 and 1998, respectively: risk-free interest rates of 5.9%, 5.8% and 5.4%; dividend yields of 0%, 0% and 0%; volatility factors of the expected
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
market price of the Company's common stock of 45%, 38% and 34%; and expected life of the options of 3.4 years, 3.4 years and 3.4 years. These assumptions resulted in weighted-average fair values of $25.87, $10.55 and $5.11 per share for employee stock options granted in 2000, 1999 and 1998, respectively.
The Black-Scholes option valuation model was developed for use in estimating the fair value of traded options. The Company's employee stock options have characteristics significantly different from those of traded options such as vesting restrictions and extremely limited transferability. In addition, the assumptions used in option valuation models (see above) are highly subjective, particularly the expected stock price volatility of the underlying stock. Because changes in these subjective input assumptions can materially affect the fair value estimate, in management's opinion, existing valuation models do not provide a reliable single measure of the fair value of its employee stock options.
For purposes of pro forma disclosures, the estimated fair values of the options are amortized over the options' vesting periods. The Company's pro forma information is as follows (in millions, except per share information):
Years ended December 31,
------------------------
2000 1999 1998
-------- -------- ------
Pro forma net income............................... $1,035.4 $1,030.0 $735.9
Pro forma earnings per share:
Basic............................................ $ 1.01 $ 1.01 $ 0.72
Diluted.......................................... $ 0.95 $ 0.95 $ 0.70
|
Information regarding employee stock options outstanding as of December 31, 2000 is as follows (shares in millions):
Options Outstanding Options Exercisable
---------------------------- --------------------
Weighted-
Weighted- Average Weighted-
Average Remaining Average
Exercise Contractual Exercise
Price Range Shares Price Life Shares Price
----------- ------ --------- ----------- ------ ---------
$10.00 and under........... 11.4 $ 7.83 1.1 years 11.4 $ 7.83
Over $10.00 to $15.00...... 32.4 $13.77 3.4 years 26.7 $13.72
Over $15.00 to $30.00...... 25.2 $16.94 4.5 years 12.0 $17.22
Over $30.00 to $60.00...... 18.2 $33.59 5.5 years 4.9 $32.44
Over $60.00................ 11.5 $68.38 6.5 years 0.5 $66.48
|
Employee stock purchase plan
The Company has an employee stock purchase plan whereby, in accordance with
Section 423 of the Internal Revenue Code, eligible employees may authorize
payroll deductions of up to 10% of their salary to purchase shares of the
Company's common stock at the lower of 85% of the fair market value of common
stock on the first or last day of the offering period. During the years ended
December 31, 2000 and 1998, employees purchased 1.3 million and 1.0 million
shares at weighted-average prices of approximately $30.33 and $11.46 per share,
respectively. No shares were purchased under the employee stock purchase plan
during 1999 because the Company had a 15 month offering period which extended
from January 1, 1999 to March 31, 2000. At December 31, 2000, the Company had
16.2 million shares available for future issuance under this plan.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Defined contribution plans
The Company has defined contribution plans covering substantially all employees in the United States and its possessions. Under these plans, the Company makes certain amounts of matching contributions for those employees who elect to contribute to the plans and makes additional contributions based upon the compensation of eligible employees regardless of whether or not the employees contribute to the plans. In addition, the Company has other defined contribution plans covering certain employees of the Company and employees of its foreign affiliates. The Company's expense for its defined contribution plans totaled $42.6 million, $34.3 million and $26.7 million for the years ended December 31, 2000, 1999 and 1998, respectively.
8. Balance sheet accounts
Property, plant and equipment consisted of the following (in millions):
December 31,
------------------
2000 1999
-------- --------
Land..................................................... $ 120.0 $ 110.1
Buildings and building improvements...................... 901.7 841.4
Manufacturing equipment.................................. 287.6 251.8
Laboratory equipment..................................... 338.1 306.3
Furniture and office equipment........................... 672.6 577.8
Leasehold improvements................................... 53.7 50.8
Construction in progress................................. 345.5 177.0
-------- --------
2,719.2 2,315.2
Less accumulated depreciation and amortization........... (937.7) (761.6)
-------- --------
$1,781.5 $1,553.6
======== ========
|
Accrued liabilities consisted of the following (in millions):
December 31,
-------------
2000 1999
------ ------
Employee compensation and benefits............................ $151.9 $149.1
Income taxes.................................................. 116.7 87.5
Sales incentives, royalties and allowances.................... 107.6 135.7
Due to affiliated companies and corporate partners............ 92.8 160.8
Clinical development costs.................................... 50.5 35.4
Other......................................................... 99.7 79.7
------ ------
$619.2 $648.2
====== ======
|
9. Fair values of financial instruments
The carrying amounts of cash, cash equivalents, marketable securities and marketable equity investments approximated their fair values. Fair values of cash equivalents, marketable securities and marketable equity investments are based on quoted market prices.
The carrying amount of commercial paper approximated its fair value as of December 31, 2000 and 1999. The fair values of long-term debt at December 31, 2000 and 1999 totaled approximately $222.0 million and $216.6 million, respectively. The fair values of commercial paper and long-term debt were estimated based on quoted market rates for instruments with similar terms and remaining maturities.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
The fair values of the foreign currency forward contracts and purchased foreign currency option contracts were not significant based on the estimated amounts at which the contracts could be settled taking into account current market exchange rates.
10. Segment information
Enterprise-wide disclosures about revenues by product, revenues and long- lived assets by geographic area and revenues from major customers are presented below.
Revenues
Revenues consisted of the following (in millions):
Years ended December 31,
--------------------------
2000 1999 1998
-------- -------- --------
EPOGEN(R)......................................... $1,962.9 $1,759.1 $1,382.0
NEUPOGEN(R)....................................... 1,223.7 1,256.6 1,116.6
Other product sales............................... 15.6 27.1 15.8
-------- -------- --------
Total product sales............................... 3,202.2 3,042.8 2,514.4
Other revenues.................................... 427.2 297.3 203.8
-------- -------- --------
Total revenues.................................... $3,629.4 $3,340.1 $2,718.2
======== ======== ========
|
Geographic information
The Company sells NEUPOGEN(R) through its foreign affiliates in countries of the European Union, Canada and Australia. Information regarding revenues and long-lived assets (consisting of property, plant and equipment) attributable to the United States and to all foreign countries collectively is stated below. The geographic classification of product sales was based upon the location of the customer. The geographic classification of all other revenues was based upon the domicile of the entity from which the revenues were earned. Information is as follows (in millions):
Years ended December 31,
--------------------------
2000 1999 1998
-------- -------- --------
Revenues:
United States and possessions.................. $3,343.0 $3,024.5 $2,441.6
Foreign countries.............................. 286.4 315.6 276.6
-------- -------- --------
Total revenues............................... $3,629.4 $3,340.1 $2,718.2
======== ======== ========
|
December 31,
--------------------------
2000 1999 1998
-------- -------- --------
Long-lived assets:
United States and possessions.................. $1,706.5 $1,475.7 $1,360.8
Foreign countries.............................. 75.0 77.9 89.4
-------- -------- --------
Total long-lived assets...................... $1,781.5 $1,553.6 $1,450.2
======== ======== ========
|
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
Major customers
Amgen uses wholesale distributors of pharmaceutical products as the principal means of distributing the Company's products to clinics, hospitals and pharmacies. The Company monitors the financial condition of its larger distributors and limits its credit exposure by setting appropriate credit limits and requiring collateral from certain customers. Sales to two large wholesalers accounted for more than 10% of the total revenues for the years ended December 31, 2000, 1999 and 1998. Sales to one wholesaler were $1,233.4 million, $1,078.0 million and $856.2 million for the years ended December 31, 2000, 1999 and 1998, respectively. Sales to another wholesaler were $445.2 million, $438.2 million and $366.5 million for the years ended December 31, 2000, 1999 and 1998, respectively. At December 31, 2000 and 1999, amounts due from four large wholesalers accounted for 51% and 59%, respectively, of gross trade receivables.
11. Business combination
On December 14, 2000, Amgen acquired Kinetix Pharmaceuticals, Inc. ("Kinetix"), a privately held company with expertise in the discovery of small molecules in the field of protein kinase inhibition. Amgen acquired all the outstanding shares of Kinetix common stock in a tax-free exchange for 2.6 million shares of Amgen common stock. The acquisition has been accounted for under the purchase method of accounting, and accordingly, the operating results of Kinetix are included in the accompanying consolidated financial statements starting from December 14, 2000. The acquisition was valued at $172.2 million, including $1.0 million of related acquisition costs and $6.5 million of Amgen restricted common stock issued in exchange for Kinetix restricted common stock held by employees retained from Kinetix. The $6.5 million will be recognized as compensation expense over the vesting period of the restricted common stock. The preliminary assignment of the purchase price among identifiable tangible and intangible assets and liabilities of Kinetix was based upon an analysis of their fair values. The excess of the purchase price over the fair values of assets and liabilities acquired of $103.3 million was allocated to goodwill and will be amortized on a straight-line basis over a 15 year period.
The assets acquired included in-process research and development. The value assigned to this asset was determined by an analysis of data concerning four substantive in-process research projects. The values of these research projects were determined based on analyses of cash flows to be generated by the products that are expected to result from the in-process projects. These cash flows were estimated by forecasting total revenues expected from these products and then deducting appropriate operating expenses, cash flow adjustments and contributory asset returns to establish a forecast of net returns on the in- process technology. These net returns were substantially reduced to take into account the time value of money and the risks associated with the inherent difficulties and uncertainties in developing specific molecules into viable human therapeutics given the stage of development of these projects at the date of the acquisition. Finally, these net returns were multiplied by the estimated percentage completed of each project, based upon analysis of three factors-- time, cost and complexity. The above analysis resulted in $30.1 million of value assigned to acquired in-process research and development, which was expensed on the acquisition date in accordance with generally accepted accounting principles. A discounted, risk-adjusted cash flow analysis was also performed to value the technology platform of Kinetix that is expected to generate future molecules that may be developed into human therapeutics. This analysis resulted in valuing the acquired base technology at $36.6 million, which was capitalized and will be amortized on a straight-line basis over a 15 year period. Amgen management believes the assumptions used in valuing these acquired technologies are reasonable, but are inherently uncertain, and no assurance can be given that the assumptions made will occur.
This business combination would not have had a material impact on Amgen's revenues, net income or earnings per share in either 2000 or 1999.
AMGEN INC.
NOTES TO CONSOLIDATED FINANCIAL STATEMENTS--(Continued)
12. Quarterly financial data (unaudited)
(in millions, except per share data)
June
2000 Quarter Ended Dec. 31(1) Sept. 30(2) 30 Mar. 31(3)
------------------ ---------- ----------- ------ ----------
Product sales......................... $846.8 $851.0 $806.8 $697.6
Gross margin from product sales....... 735.3 741.5 705.1 611.9
Net income............................ 210.8 358.9 302.6 266.2
Earnings per share:
Basic............................... 0.20 0.35 0.29 0.26
Diluted............................. 0.19 0.33 0.28 0.25
June
1999 Quarter Ended Dec. 31(4) Sept. 30(5) 30 Mar. 31
------------------ ---------- ----------- ------ ----------
Product sales......................... $847.4 $769.2 $737.9 $688.3
Gross margin from product sales....... 735.4 670.3 639.1 595.9
Net income............................ 281.6 300.0 267.6 247.2
Earnings per share:
Basic............................... 0.28 0.29 0.26 0.24
Diluted............................. 0.26 0.28 0.25 0.23
|
(2) During the third quarter of 2000, the Company recorded a net legal award of $73.9 million, which primarily represents an award for certain costs and expenses, including attorney's fees, associated with the spillover arbitration with Johnson & Johnson (see Note 4, "Other items, net--Legal award").
(3) During the first quarter of 2000, sales were adversely impacted by Year 2000-related sales totaling $45 million (see item 4 below). In addition, the Company believes sales were adversely impacted by additional 1999 year- end stockpiling of EPOGEN(R) by dialysis providers and by wholesalers reducing their inventories of NEUPOGEN(R).
(4) Due to Year 2000 contingency planning in the fourth quarter of 1999, the Company offered extended payment terms on limited shipments of EPOGEN(R) and NEUPOGEN(R) to certain wholesalers totaling $45 million. Sales in the first quarter of 2000 were adversely impacted by these Year 2000-related sales (see item 3 above).
(5) During the third quarter of 1999, due to reduced uncertainties, the Company reduced its potential spillover liabilities to Johnson & Johnson by $49 million (see Note 4, "Other items, net--Legal award").
SCHEDULE II
AMGEN INC.
VALUATION ACCOUNTS
Years ended December 31, 2000, 1999 and 1998
(In millions)
Additions
Balance at Charged to Balance
Beginning Costs and at End
of Period Expenses Deductions of Period
---------- ---------- ---------- ---------
Year ended December 31, 2000:
Allowance for doubtful accounts.... $26.0 $ 0.1 $4.9 $21.2
Year ended December 31, 1999:
Allowance for doubtful accounts.... $17.1 $10.1 $1.2 $26.0
Year ended December 31, 1998:
Allowance for doubtful accounts.... $14.2 $ 3.6 $0.7 $17.1
|
EXHIBIT 3.4
CERTIFICATE OF DESIGNATIONS
of
SERIES A JUNIOR PARTICIPATING PREFERRED STOCK
of
AMGEN INC.
(Pursuant to Section 151 of the
Delaware General Corporation Law)
Amgen Inc., a corporation organized and existing under the General Corporation Law of the State of Delaware (hereinafter called the "Corporation"), hereby certifies that the following resolution was adopted by the Board of Directors of the Corporation as required by Section 151 of the General Corporation Law at a meeting duly called and held on December 12, 2000.
RESOLVED, that pursuant to the authority granted to and vested in the Board of Directors of this Corporation (hereinafter called the "Board of Directors" or the "Board") in accordance with the provisions of the Certificate of Incorporation, the Board of Directors hereby creates a series of Preferred Stock, par value $.0001 per share (the "Preferred Stock"), of the Corporation and hereby states the designation and number of shares, and fixes the relative rights, preferences, and limitations thereof as follows:
Series A Junior Participating Preferred Stock:
(A) Subject to the rights of the holders of any shares of any series
of Preferred Stock (or any similar stock) ranking prior and superior to the
Series A Preferred Stock with respect to dividends, the holders of shares
of Series A Preferred Stock, in preference to the holders of Common Stock,
par value $.0001 per share (the "Common Stock"), of the Corporation, and of
any other junior stock, shall be entitled to receive, when, as and if
declared by the Board of Directors out of funds legally available for the
purpose, quarterly dividends payable in cash on the first day of March,
June, September and December in each year (each such date being referred to
herein as a "Quarterly Dividend Payment Date"), commencing on the first
Quarterly Dividend Payment Date after the first issuance of a share or
fraction of a share of Series A Preferred Stock, in an amount per share
(rounded to the nearest cent) equal to the greater of (a) $1.00 or (b)
subject to the provision for adjustment hereinafter set forth, 4,000 times
the aggregate per share amount of all cash dividends, and 4,000 times the
aggregate per share amount (payable in kind) of all non-cash dividends or
other distributions, other than a dividend payable in shares of Common
Stock or a subdivision of the outstanding shares of Common Stock (by
reclassification or otherwise), declared on the Common Stock since the
immediately preceding Quarterly Dividend Payment Date or, with respect to
the first Quarterly Dividend Payment Date, since the first issuance of any
share or fraction of a share of Series A Preferred Stock. In the event the
Corporation shall at any time declare or pay any dividend on the Common
Stock payable in shares of Common Stock, or effect a subdivision,
combination or consolidation of the outstanding shares of Common Stock (by
reclassification or otherwise than by payment of a dividend in shares of
Common Stock) into a greater or lesser number of shares of Common Stock,
then in each such case the amount to which holders of shares of Series A
Preferred Stock were entitled immediately prior to such event under clause
(b) of the preceding sentence shall be adjusted by multiplying such amount
by a fraction, the numerator of which is the number of shares of Common
Stock outstanding immediately after such event and the denominator of which
is the number of shares of Common Stock that were outstanding immediately
prior to such event.
(B) The Corporation shall declare a dividend or distribution on the Series A Preferred Stock as provided in paragraph (A) of this Section 2 immediately after it declares a dividend or distribution on the Common Stock (other than a dividend payable in shares of Common Stock); provided that, in the event no dividend or distribution shall have been declared on the Common Stock during the period between any Quarterly Dividend Payment Date and the next subsequent Quarterly Dividend Payment Date, a dividend of $1.00 per share on the Series A Preferred Stock shall nevertheless be payable on such subsequent Quarterly Dividend Payment Date.
(C) Dividends shall begin to accrue and be cumulative on outstanding shares of Series A Preferred Stock from the Quarterly Dividend Payment Date next preceding the date of issue of such shares, unless the date of issue of such shares is prior to the record date for the first Quarterly Dividend Payment Date, in which case dividends on such shares
shall begin to accrue from the date of issue of such shares, or unless the date of issue is a Quarterly Dividend Payment Date or is a date after the record date for the determination of holders of shares of Series A Preferred Stock entitled to receive a quarterly dividend and before such Quarterly Dividend Payment Date, in either of which events such dividends shall begin to accrue and be cumulative from such Quarterly Dividend Payment Date. Accrued but unpaid dividends shall not bear interest. Dividends paid on the shares of Series A Preferred Stock in an amount less than the total amount of such dividends at the time accrued and payable on such shares shall be allocated pro rata on a share-by-share basis among all such shares at the time outstanding. The Board of Directors may fix a record date for the determination of holders of shares of Series A Preferred Stock entitled to receive payment of a dividend or distribution declared thereon, which record date shall be not more than 60 days prior to the date fixed for the payment thereof.
(A) Subject to the provision for adjustment hereinafter set forth, each share of Series A Preferred Stock shall entitle the holder thereof to 4,000 votes on all matters submitted to a vote of the stockholders of the Corporation. In the event the Corporation shall at any time declare or pay any dividend on the Common Stock payable in shares of Common Stock, or effect a subdivision, combination or consolidation of the outstanding shares of Common Stock (by reclassification or otherwise than by payment of a dividend in shares of Common Stock) into a greater or lesser number of shares of Common Stock, then in each such case the number of votes per share to which holders of shares of Series A Preferred Stock were entitled immediately prior to such event shall be adjusted by multiplying such number by a fraction, the numerator of which is the number of shares of Common Stock outstanding immediately after such event and the denominator of which is the number of shares of Common Stock that were outstanding immediately prior to such event.
(B) Except as otherwise provided herein, in any other Certificate of Designations creating a series of Preferred Stock or any similar stock, or by law, the holders of shares of Series A Preferred Stock and the holders of shares of Common Stock and any other capital stock of the Corporation having general voting rights shall vote together as one class on all matters submitted to a vote of stockholders of the Corporation.
(C) Except as set forth herein, or as otherwise provided by law, holders of Series A Preferred Stock shall have no special voting rights and their consent shall not be required (except to the extent they are entitled to vote with holders of Common Stock as set forth herein) for taking any corporate action.
(A) Whenever quarterly dividends or other dividends or distributions payable on the Series A Preferred Stock as provided in Section 2 are in arrears, thereafter and until all
accrued and unpaid dividends and distributions, whether or not declared, on shares of Series A Preferred Stock outstanding shall have been paid in full, the Corporation shall not:
(i) declare or pay dividends, or make any other distributions, on any shares of stock ranking junior (either as to dividends or upon liquidation, dissolution or winding up) to the Series A Preferred Stock;
(ii) declare or pay dividends, or make any other distributions, on any shares of stock ranking on a parity (either as to dividends or upon liquidation, dissolution or winding up) with the Series A Preferred Stock, except dividends paid ratably on the Series A Preferred Stock and all such parity stock on which dividends are payable or in arrears in proportion to the total amounts to which the holders of all such shares are then entitled;
(iii) redeem or purchase or otherwise acquire for consideration shares of any stock ranking junior (either as to dividends or upon liquidation, dissolution or winding up) to the Series A Preferred Stock, provided that the Corporation may at any time redeem, purchase or otherwise acquire shares of any such junior stock in exchange for shares of any stock of the Corporation ranking junior (either as to dividends or upon dissolution, liquidation or winding up) to the Series A Preferred Stock; or
(iv) redeem or purchase or otherwise acquire for consideration any shares of Series A Preferred Stock, or any shares of stock ranking on a parity with the Series A Preferred Stock, except in accordance with a purchase offer made in writing or by publication (as determined by the Board of Directors) to all holders of such shares upon such terms as the Board of Directors, after consideration of the respective annual dividend rates and other relative rights and preferences of the respective series and classes, shall determine in good faith will result in fair and equitable treatment among the respective series or classes.
(B) The Corporation shall not permit any Subsidiary of the Corporation to purchase or otherwise acquire for consideration any shares of stock of the Corporation unless the Corporation could, under paragraph (A) of this Section 4, purchase or otherwise acquire such shares at such time and in such manner.
ranking junior (either as to dividends or upon liquidation, dissolution or winding up) to the Series A Preferred Stock unless, prior thereto, the holders of shares of Series A Preferred Stock shall have received $4,000 per share, plus an amount equal to accrued and unpaid dividends and distributions thereon, whether or not declared, to the date of such payment, provided that the holders of shares of Series A Preferred Stock shall be entitled to receive an aggregate amount per share, subject to the provision for adjustment hereinafter set forth, equal to 4,000 times the aggregate amount to be distributed per share to holders of shares of Common Stock, or (2) to the holders of shares of stock ranking on a parity (either as to dividends or upon liquidation, dissolution or winding up) with the Series A Preferred Stock, except distributions made ratably on the Series A Preferred Stock and all such parity stock in proportion to the total amounts to which the holders of all such shares are entitled upon such liquidation, dissolution or winding up. In the event the Corporation shall at any time declare or pay any dividend on the Common Stock payable in shares of Common Stock, or effect a subdivision, combination or consolidation of the outstanding shares of Common Stock (by reclassification or otherwise than by payment of a dividend in shares of Common Stock) into a greater or lesser number of shares of Common Stock, then in each such case the aggregate amount to which holders of shares of Series A Preferred Stock were entitled immediately prior to such event under the proviso in clause (1) of the preceding sentence shall be adjusted by multiplying such amount by a fraction the numerator of which is the number of shares of Common Stock outstanding immediately after such event and the denominator of which is the number of shares of Common Stock that are outstanding immediately prior to such event.
IN WITNESS WHEREOF, this Certificate of Designations is executed on behalf of the Corporation by its Senior Vice President, Finance and Corporate Development, and Chief Financial Officer and attested by its Secretary this 13th day of December, 2000.
/s/ Kathryn E. Falberg
----------------------------------------
Senior Vice President, Finance and
Corporate Development, and Chief Financial Officer
Attest:
/s/ Steve M. Odre
-----------------
Secretary
|
EXHIBIT 10.1
AMGEN INC.
(a) The purpose of the Amended and Restated 1991 Equity Incentive Plan as amended and restated in February 1999 (the "Plan") is to provide a means by which employees or directors of and consultants to Amgen Inc., a Delaware corporation (the "Company"), and its Affiliates, as defined in paragraph 1(b), directly, or indirectly through Trusts, may be given an opportunity to benefit from increases in value of the stock of the Company through the granting of (i) incentive stock options, (ii) nonqualified stock options, (iii) stock bonuses, and (iv) rights to purchase restricted stock, all as defined below. For purposes of the incentive stock option rules of Section 422 of the Internal Revenue Code of 1986, as amended (the "Code"), the Plan is a new plan.
(b) The word "Affiliate" as used in the Plan means any parent corporation or subsidiary corporation of the Company, as those terms are defined in Sections 424(e) and (f), respectively, of the Code.
(c) The Company, by means of the Plan, seeks to retain the services of persons now employed by or serving as directors or consultants to the Company, to secure and retain the services of persons capable of filling such positions, and to provide incentives for such persons to exert maximum efforts for the success of the Company.
(d) The Company intends that the rights issued under the Plan ("Stock Awards") shall, in the discretion of the Board of Directors of the Company (the "Board") or any committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), be either (i) stock options granted pursuant to Sections 5 or 6 hereof, including incentive stock options as that term is used in Section 422 of the Code ("Incentive Stock Options"), or options which do not qualify as Incentive Stock Options ("Nonqualified Stock Options") (together hereinafter referred to as "Options"), or (ii) stock bonuses or rights to purchase restricted stock granted pursuant to Section 7 hereof.
(e) The word "Trust" as used in the Plan shall mean a trust created for the benefit of the employee, director or consultant, his or her spouse, or members of their immediate family. The word optionee shall mean the person to whom the option is granted or the employee, director or consultant for whose benefit the option is granted to a Trust, as the context shall require.
(a) The Plan shall be administered by the Board unless and until the Board delegates administration to a committee, as provided in paragraph 2(c).
(b) The Board shall have the power, subject to, and within the limitations of, the express provisions of the Plan:
(1) To determine from time to time which of the persons eligible under the Plan shall be granted Stock Awards; when and how Stock Awards shall be granted; whether a Stock Award will be an Incentive Stock Option, a Nonqualified Stock Option, a stock bonus, a right to purchase restricted stock, or a combination of the foregoing; the provisions of each Stock Award granted (which need not be identical), including the time or times when a person shall be permitted to purchase or receive stock pursuant to a Stock Award; and the number of shares with respect to which Stock Awards shall be granted to each such person.
(2) To construe and interpret the Plan and Stock Awards granted under it, and to establish, amend and revoke rules and regulations for its administration. The Board, in the exercise of this power, may correct any defect, omission or inconsistency in the Plan or in any Stock Award, in a manner and to the extent it shall deem necessary or expedient to make the Plan fully effective.
(3) To amend the Plan as provided in Section 14.
(4) Generally, to exercise such powers and to perform such acts as the Board deems necessary or expedient to promote the best interests of the Company.
(c) The Board may delegate administration of the Plan to a committee composed of not fewer than two (2) members of the Board (the "Committee"). One or more of these members may be non-employee directors and outside directors, if required and as defined by the provisions of paragraphs 2(d) and 2(e). If administration is delegated to a Committee, the Committee shall have, in connection with the administration of the Plan, the powers theretofore possessed by the Board (except amendment of Section 6 or the options granted thereunder shall only be by action taken by the Board or a committee of one or more members of the Board to which such authority has been specifically delegated by the Board), subject, however, to such resolutions, not inconsistent with the provisions of the Plan, as may be adopted from time to time by the Board. Notwithstanding anything else in this paragraph 2(c) to the contrary, at any time the Board or the Committee may delegate to a committee of one or more members of the Board the authority to grant or amend options to all employees, directors or consultants or any portion or class thereof.
(d) The term "non-employee director" shall mean a member of the Board who (i) is not currently an officer of the Company or a parent or subsidiary of the Company (as defined in Rule 16a-1(f) promulgated by the Securities and Exchange Commission under
Section 16 of the Securities Exchange Act of 1934, as amended (the "Exchange
Act")) or an employee of the Company or a parent or subsidiary of the Company;
(ii) does not receive compensation from the Company or a parent or subsidiary of
the Company for services rendered in any capacity other than as a member of the
Board (including a consultant) in an amount required to be disclosed to the
Company's stockholders under Rule 404 of Regulation S-K promulgated by the
Securities and Exchange Commission ("Rule 404"); (iii) does not possess an
interest in any other transaction required to be disclosed under Rule 404; or
(iv) is not engaged in a business relationship required to be disclosed under
Rule 404, as all of these provisions are interpreted by the Securities and
Exchange Commission under Rule 16b-3 promulgated under the Exchange Act.
(e) The term "outside director," as used in this Plan, shall mean an administrator of the Plan, whether a member of the Board or of any Committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), who is considered to be an "outside director" in accordance with the rules, regulations or interpretations of Section 162(m) of the Code.
(f) Any requirement that an administrator of the Plan be a "non- employee director" or "outside director" shall not apply if the Board or the Committee expressly declares that such requirement shall not apply.
(a) Subject to the provisions of Section 11 relating to adjustments upon changes in stock, the stock that may be issued pursuant to Stock Awards granted under the Plan shall not exceed in the aggregate One Hundred Ninety-Two Million (192,000,000) shares of the Company's $.0001 par value common stock (the "Common Stock"). If any Stock Award granted under the Plan shall for any reason expire or otherwise terminate without having been exercised in full, the Common Stock not purchased under such Stock Award shall again become available for the Plan. Shares repurchased by the Company pursuant to any repurchase rights reserved by the Company pursuant to the Plan shall not be available for subsequent issuance under the Plan.
(b) The Common Stock subject to the Plan may be unissued shares or reacquired shares, bought on the market or otherwise.
(c) An Incentive Stock Option may be granted to an eligible person under the Plan only if the aggregate fair market value (determined at the time the Incentive Stock Option is granted) of the Common Stock with respect to which incentive stock options (as defined by the Code) are exercisable for the first time by such optionee during any calendar year under all such plans of the Company and its Affiliates does not exceed one hundred thousand dollars
($100,000). If it is determined that an entire Option or any portion thereof does not qualify for treatment as an Incentive Stock Option by reason of exceeding such maximum, such Option or the applicable portion shall be considered a Nonqualified Stock Option.
(a) Incentive Stock Options may be granted only to employees (including officers) of the Company or its Affiliates. A director of the Company shall not be eligible to receive Incentive Stock Options unless such director is also an employee of the Company or any Affiliate. Stock Awards other than Incentive Stock Options may be granted to employees (including officers) or directors of or consultants to the Company or any Affiliate or to Trusts of any such employee, director or consultant.
(b) A director shall in no event be eligible for the benefits of the Plan (other than from a Director NQSO under Section 6 of the Plan) unless and until such director is expressly declared eligible to participate in the Plan by action of the Board or the Committee, and only if, at any time discretion is exercised by the Board or the Committee in the selection of a director as a person to whom Stock Awards may be granted, or in the determination of the number of shares which may be covered by Stock Awards granted to a director, the Plan complies with the requirements of Rule 16b-3 promulgated under the Exchange Act, as from time to time in effect. The Board shall otherwise comply with the requirements of Rule 16b-3 promulgated under the Exchange Act, as from time to time in effect. Notwithstanding the foregoing, the restrictions set forth in this paragraph 4(b) shall not apply if the Board or Committee expressly declares that such restrictions shall not apply.
(c) No person shall be eligible for the grant of an Incentive Stock Option under the Plan if, at the time of grant, such person owns (or is deemed to own pursuant to Section 424(d) of the Code) stock possessing more than ten percent (10%) of the total combined voting power of all classes of stock of the Company or of any of its Affiliates unless the exercise price of such Incentive Stock Option is at least one hundred and ten percent (110%) of the fair market value of the Common Stock at the date of grant and the Incentive Stock Option is not exercisable after the expiration of five (5) years from the date of grant.
(d) Stock Awards shall be limited to a maximum of 2,000,000 shares of Common Stock per person per calendar year.
An option granted pursuant to this Section 5 (a "Discretionary Stock Option") shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Options need not be identical,
but each Option shall include (through incorporation of provisions hereof by reference in the Option or otherwise) the substance of each of the following provisions:
(a) No Option shall be exercisable after the expiration of ten (10) years from the date it was granted.
(b) The exercise price of each Incentive Stock Option and each Nonqualified Stock Option shall be not less than one hundred percent (100%) of the fair market value of the Common Stock subject to the Option on the date the Option is granted.
(c) The purchase price of Common Stock acquired pursuant to an Option
shall be paid, to the extent permitted by applicable statutes and regulations,
either: (i) in cash at the time the Option is exercised; or (ii) at the
discretion of the Board or the Committee, either at the time of grant or
exercise of the Option (A) by delivery to the Company of shares of Common Stock
that have been held for the period required to avoid a charge to the Company's
reported earnings and valued at the fair market value on the date of exercise,
(B) according to a deferred payment or other arrangement with the person to whom
the Option is granted or to whom the Option is transferred pursuant to paragraph
5(d), or (C) in any other form of legal consideration that may be acceptable to
the Board or the Committee in their discretion; including but not limited to
payment of the purchase price pursuant to a program developed under Regulation T
as promulgated by the Federal Reserve Board which results in the receipt of cash
(or a check) by the Company before Common Stock is issued or the receipt of
irrevocable instruction to pay the aggregate exercise price to the Company from
the sales proceeds before Common Stock is issued.
In the case of any deferred payment arrangement, interest shall be payable at least annually and shall be charged at not less than the minimum rate of interest necessary to avoid the treatment as interest, under any applicable provisions of the Code, of any amounts other than amounts stated to be interest under the deferred payment arrangement.
(d) An Option granted to a natural person shall be exercisable during the lifetime of such person only by such person, provided that such person during such person's lifetime may designate a Trust to be such person's beneficiary with respect to any Incentive Stock Options granted after February 25, 1992 and with respect to any Nonqualified Stock Options, and such beneficiary shall, after the death of the person to whom the Option was granted, have all the rights that such person has while living, including the right to exercise the Option. In the absence of such designation, after the death of the person to whom the Option is granted, the Option shall be exercisable by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution.
(e) The total number of shares of Common Stock subject to an Option may, but need not, be allotted in periodic installments (which may, but need not, be equal). From
time to time during each of such installment periods, the Option may become exercisable ("vest") with respect to some or all of the shares allotted to that period, and may be exercised with respect to some or all of the shares allotted to such period and/or any prior period as to which the Option was not fully exercised. During the remainder of the term of the Option (if its term extends beyond the end of the installment periods), the Option may be exercised from time to time with respect to any shares then remaining subject to the Option. The provisions of this paragraph 5(e) are subject to any Option provisions governing the minimum number of shares as to which an Option may be exercised.
(f) The Company may require any optionee, or any person to whom an Option is transferred under paragraph 5(d), as a condition of exercising any such Option: (i) to give written assurances satisfactory to the Company as to such person's knowledge and experience in financial and business matters and/or to employ a purchaser representative who has such knowledge and experience in financial and business matters, and that such person is capable of evaluating, alone or together with the purchaser representative, the merits and risks of exercising the Option; and (ii) to give written assurances satisfactory to the Company stating that such person is acquiring the Common Stock subject to the Option for such person's own account and not with any present intention of selling or otherwise distributing the Common Stock. These requirements, and any assurances given pursuant to such requirements, shall be inoperative if: (x) the issuance of the shares upon the exercise of the Option has been registered under a then currently effective registration statement under the Securities Act of 1933, as amended (the "Securities Act"); or (y) as to any particular requirement, a determination is made by counsel for the Company that such requirement need not be met in the circumstances under the then applicable securities law.
(g) An Option shall terminate three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate, unless: (i) such termination is due to the optionee's permanent and total disability, within the meaning of Section 422(c)(6) of the Code and with such permanent and total disability being certified by the Social Security Administration prior to such termination, in which case the Option may, but need not, provide that it may be exercised at any time within one (1) year following such termination of employment or relationship as a consultant or director; (ii) the optionee dies while in the employ of or while serving as a consultant or director to the Company or an Affiliate, or within not more than three (3) months after termination of such employment or relationship as a consultant or director, in which case the Option may, but need not, provide that it may be exercised at any time within eighteen (18) months following the death of the optionee by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution; or (iii) the Option by its term specifies
either (A) that it shall terminate sooner than three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate; or (B) that it may be exercised more than three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate. This paragraph 5(g) shall not be construed to extend the term of any Option or to permit anyone to exercise the Option after expiration of its term, nor shall it be construed to increase the number of shares as to which any Option is exercisable from the amount exercisable on the date of termination of the optionee's employment or relationship as a consultant or director.
(h) The Option may, but need not, include a provision whereby the optionee may elect at any time during the term of the optionee's employment or relationship as a consultant or director with the Company or any Affiliate to exercise the Option as to any part or all of the shares subject to the Option prior to the stated vesting dates of the Option. Any shares so purchased from any unvested installment or Option may be subject to a repurchase right in favor of the Company or to any other restriction the Board or the Committee determines to be appropriate.
(i) To the extent provided by the terms of an Option, each optionee may satisfy any federal, state or local tax withholding obligation relating to the exercise of such Option by any of the following means or by a combination of such means: (i) tendering a cash payment; (ii) authorizing the Company to withhold from the shares of the Common Stock otherwise issuable to the optionee as a result of the exercise of the Option a number of shares having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding; or (iii) delivering to the Company owned and unencumbered shares of the Common Stock having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding.
(j) Without in any way limiting the authority of the Board or Committee to make or not to make grants of Discretionary Stock Options under this Section 5, the Board or Committee shall have the authority (but not an obligation) to include as part of any Option agreement a provision entitling the optionee to a further Option (a "Re-Load Option") in the event the optionee exercises the Option evidenced by the Option agreement, in whole or in part, by surrendering other shares of Common Stock in accordance with this Plan and the terms and conditions of the Option agreement. Any such Re-Load Option (i) shall be for a number of shares equal to the number of shares surrendered as part or all of the exercise price of such Option; (ii) shall have an expiration date which is the same as the expiration date of the Option the exercise of which gave rise to such Re-Load Option; and (iii) shall have an exercise price which is equal to one hundred percent (100%) of the fair market value of the Common Stock subject to the Re-Load Option on the date of exercise of the original Option or, in the case of a
Re-Load Option which is an Incentive Stock Option and which is granted to a 10% stockholder (as defined in paragraph 4(c)), shall have an exercise price which is equal to one hundred and ten percent (110%) of the fair market value of the Common Stock subject to the Re-Load Option on the date of exercise of the original Option.
Any such Re-Load Option may be an Incentive Stock Option or a Nonqualified Stock Option, as the Board or Committee may designate at the time of the grant of the original Option, provided, however, that the designation of any Re-Load Option as an Incentive Stock Option shall be subject to the one hundred thousand dollars ($100,000) annual limitation on exercisability of Incentive Stock Options described in paragraph 3(c) of the Plan and in Section 422(d) of the Code. There shall be no Re-Load Option on a Re-Load Option. Any such Re-Load Option shall be subject to the availability of sufficient shares under paragraph 3(a) and shall be subject to such other terms and conditions as the Board or Committee may determine.
(a) On January 27 of each year, each person who is at that time an Eligible Director of the Company, (as defined in paragraph 6(k)), shall automatically be granted under the Plan, without further action by the Company, the Board, or the Company's stockholders, a Nonqualified Stock Option (a "Director NQSO") to purchase sixteen thousand (16,000) shares of Common Stock on the terms and conditions set forth herein. An Eligible Director may designate that such Director NQSO be granted in the name of a Trust instead of in the name of such Eligible Director. The Director NQSO shall be on the terms and conditions set forth herein and should the date of grant set forth above be a Saturday, Sunday or legal holiday, such grant shall be made on the next business day.
(b) Each person who becomes an Eligible Director, shall, upon the date such person first becomes an Eligible Director, automatically be granted under the Plan, without further action by the Company, the Board, or the Company's stockholders, a Director NQSO to purchase sixty thousand (60,000) shares of Common Stock on the terms and conditions set forth herein. An Eligible Director may designate that such Director NQSO be granted in the name of a Trust instead of in the name of such Eligible Director. The Director NQSO shall be on the terms and conditions set forth herein and should the date of grant set forth above be a Saturday, Sunday or legal holiday, such grant shall be made on the next business day.
(c) Each Director NQSO granted pursuant to this Section 6 (or any Director Re-Load Option granted pursuant to paragraph 6(j)) shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Director NQSO's need not be identical, but each
Director NQSO shall include (through incorporation of provisions hereof by reference in the Director NQSO or otherwise) the substance of each of the following provisions as set forth in paragraphs 6(d) through 6(j), inclusive.
(d) The term of each Director NQSO shall be ten (10) years from the date it was granted.
(e) The exercise price of each Director NQSO shall be one hundred percent (100%) of the fair market value of the Common Stock subject to such Director NQSO on the date such Director NQSO is granted.
(f) The purchase price of Common Stock acquired pursuant to a Director NQSO shall be paid, to the extent permitted by applicable statutes and regulations, either (i) in cash at the time the Director NQSO is exercised; (ii) by delivery to the Company of shares of Common Stock that have been held for the period required to avoid a charge to the Company's reported earnings and valued at their fair market value on the date of exercise; or (iii) pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instructions to pay the aggregate exercise price to the Company from the sales proceeds before Common Stock is issued.
(g) A Director NQSO shall be exercisable during the lifetime of the Eligible Director with respect to whom it was granted only by the person to whom it was granted (whether the Eligible Director or a Trust), provided that such person during the Eligible Director's lifetime may designate a Trust to be a beneficiary with respect to the Director NQSO, and such beneficiary shall, after the death of the Eligible Director to whom the Director NQSO was granted, have all of the rights designated for such beneficiary. In the absence of such designation, after the death of the Eligible Director with respect to whom the Director NQSO was granted, if such Director NQSO was granted to the Eligible Director, the Director NQSO shall be exercisable by the person or persons to whom the optionee's rights under such option pass by will or by the laws of descent and distribution.
(h) A Director NQSO shall not vest with respect to an Eligible Director, or the affiliate of such Eligible Director, as the case may be, (i) unless the Eligible Director, has, at the date of grant, provided three (3) years of prior continuous service as an Eligible Director, or (ii) until the date upon which such Eligible Director has provided one year of continuous service as an Eligible Director following the date of grant of such Director NQSO, whereupon such Director NQSO shall become fully vested and exercisable in accordance with its terms.
(i) The Company may require any optionee under this Section 6, or any person to whom a Director NQSO is transferred under paragraph 6(g), as a condition of exercising any such option: (i) to give written assurances satisfactory to the Company as to
such person's knowledge and experience in financial and business matters and/or
to employ a purchaser representative who has such knowledge and experience in
financial and business matters, and that such person is capable of evaluating,
alone or together with the purchaser representative, the merits and risks of
exercising the Director NQSO; and (ii) to give written assurances satisfactory
to the Company stating that such person is acquiring the Common Stock subject to
the Director NQSO for such person's own account and not with any present
intention of selling or otherwise distributing the stock. These requirements,
and any assurances given pursuant to such requirements, shall be inoperative if
(i) the issuance of the shares upon the exercise of the Director NQSO has been
registered under a then currently effective registration statement under the
Securities Act of 1933, as amended (the "Securities Act"), or (ii), as to any
particular requirement, a determination is made by counsel for the Company that
such requirement need not be met in the circumstances under the then applicable
securities laws.
(j) Subject to the last sentence of this paragraph 6(j), each Director NQSO shall include a provision entitling the optionee to a further Nonqualified Stock Option (a "Director Re-Load Option") in the event the optionee exercises the Director NQSO evidenced by the Director NQSO grant, in whole or in part, by surrendering other shares of Common Stock in accordance with the Plan and the terms of the Director NQSO grant. Any such Director Re-Load Option (i) shall be for a number of shares equal to the number of shares surrendered as part or all of the exercise price of the original Director NQSO; (ii) shall have an expiration date which is the same as the expiration date of the original Director NQSO; and (iii) shall have an exercise price which is equal to one hundred percent (100%) of the fair market value of the Common Stock subject to the Director Re-Load Option on the date of exercise of the original Director NQSO. Any such Director Re-Load Option shall be subject to the availability of sufficient shares under paragraph 3(a). There shall be no Director Re-Load Option on a Director Re-Load Option. Notwithstanding anything else in the Plan to the contrary, this paragraph 6(j) shall be of no force and effect from and after June 23, 1998.
(k) For purposes of this Section 6, the term "Eligible Director" shall mean a member of the Board who is not an employee of the Company or any Affiliate, and the term "affiliate" shall mean a person that directly or indirectly controls, is controlled by, or is under common control with, the Eligible Director.
Each stock bonus or restricted stock purchase agreement shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The terms and conditions of stock bonus or restricted stock purchase agreements
may change from time to time, and the terms and conditions of separate agreements need not be identical, but each stock bonus or restricted stock purchase agreement shall include (through incorporation of provisions hereof by reference in the agreement or otherwise) the substance of each of the following provisions as appropriate:
(a) The purchase price under each stock purchase agreement shall be such amount as the Board or Committee shall determine and designate in such agreement. Notwithstanding the foregoing, the Board or the Committee may determine that eligible participants in the Plan may be awarded stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.
(b) No rights under a stock bonus or restricted stock purchase agreement shall be assignable by any participant under the Plan, either voluntarily or by operation of law, except where such assignment is required by law or expressly authorized by the terms of the applicable stock bonus or restricted stock purchase agreement.
(c) The purchase price of stock acquired pursuant to a stock purchase agreement shall be paid either: (i) in cash at the time of purchase; (ii) at the discretion of the Board or the Committee, according to a deferred payment or other arrangement with the person to whom the Common Stock is sold; or (iii) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion; including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instruction to pay the aggregate exercise price of the Company from the sales proceeds before Common Stock is issued. Notwithstanding the foregoing, the Board or the Committee to which administration of the Plan has been delegated may award Common Stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.
(d) Shares of Common Stock sold or awarded under the Plan may, but need not, be subject to a repurchase option in favor of the Company in accordance with a vesting schedule to be determined by the Board or the Committee.
(e) In the event a person ceases to be an employee of or ceases to serve as a director or consultant to the Company or an Affiliate, the Company may repurchase or otherwise reacquire any or all of the shares of Common Stock held by that person which have not vested as of the date of termination under the terms of the stock bonus or restricted stock purchase agreement between the Company and such person.
(a) During the terms of the Stock Awards granted under the Plan, the
Company shall keep available at all times the number of shares of Common Stock required to satisfy such Stock Awards up to the number of shares of Common Stock authorized under the Plan.
(b) The Company shall seek to obtain from each regulatory commission or agency having jurisdiction over the Plan such authority as may be required to issue and sell shares of Common Stock under the Stock Awards granted under the Plan; provided, however, that this undertaking shall not require the Company to register under the Securities Act either the Plan, any Stock Award granted under the Plan or any Common Stock issued or issuable pursuant to any such Stock Award. If, after reasonable efforts, the Company is unable to obtain from any such regulatory commission or agency the authority that counsel for the Company deems necessary for the lawful issuance and sale of Common Stock under the Plan, the Company shall be relieved from any liability for failure to issue and sell Common Stock upon exercise of such Stock Awards unless and until such authority is obtained.
(a) The Board or Committee shall have the power to accelerate the time during which a Stock Award may be exercised or the time during which a Stock Award or any part thereof will vest, notwithstanding the provisions in the Stock Award stating the time during which it may be exercised or the time during which it will vest. Each Discretionary Stock Option providing for vesting pursuant to paragraph 5(e) shall also provide that if the employee's employment or a director's or consultant's affiliation with the Company is terminated by reason of death or disability (within the meaning of Title II or XVI of the Social Security Act and with such permanent and total disability certified by the Social Security Administration prior to such termination), then the vesting schedule of Discretionary Stock Options granted to such employee, director or consultant or to the Trusts of such employee, director or consultant shall be accelerated by twelve months for each full year the employee has been employed by or the director or consultant has been affiliated with the Company. Discretionary Stock Options granted under the Plan that are outstanding on February 25, 1992, shall be amended to include the accelerated vesting upon death provided for in the preceding sentence of this paragraph 10(a) and Discretionary Stock Options granted under the Plan that are outstanding on June 18, 1996, shall be amended to include the accelerated vesting upon disability provided for in the preceding sentence of this paragraph 10(a).
(b) Neither an optionee nor any person to whom an Option is transferred under the provisions of the Plan shall be deemed to be the holder of, or to have any of the rights of a holder with respect to, any shares subject to such Option unless and until such person has satisfied all requirements for exercise of the Option pursuant to its terms.
(c) Nothing in the Plan or any instrument executed or Stock Award granted pursuant thereto shall confer upon any eligible employee, consultant, director, optionee or holder of Stock Awards under the Plan any right to continue in the employ of the Company or any Affiliate or to continue acting as a consultant or director or shall affect the right of the Company or any Affiliate to terminate the employment or consulting relationship or directorship of any eligible employee, consultant, director, optionee or holder of Stock Awards under the Plan with or without cause. In the event that a holder of Stock Awards under the Plan is permitted or otherwise entitled to take a leave of absence, the Company shall have the unilateral right to (i) determine whether such leave of absence will be treated as a termination of employment or relationship as consultant or director for purposes hereof, and (ii) suspend or otherwise delay the time or times at which exercisability or vesting would otherwise occur with respect to any outstanding Stock Awards under the Plan.
If any change is made in the Common Stock subject to the Plan, or subject to any Stock Award granted under the Plan (through merger, consolidation, reorganization, recapitalization, stock dividend, dividend in property other than cash, stock split, liquidating dividend, combination of shares, exchange of shares, change in corporate structure or other transaction not involving the receipt of consideration by the Company), the Plan and outstanding Stock Awards will be appropriately adjusted in the class(es) and maximum number of shares subject to the Plan, the maximum number of shares which may be granted to a participant in a calendar year, the class(es) and number of shares and price per share of stock subject to outstanding Stock Awards, and the number of shares of Common Stock to be granted as provided for in paragraphs 6(a) and 6(b). Such adjustment shall be made by the Board or the Committee, the determination of which shall be final, binding and conclusive. (The conversion of any convertible securities of the Company shall not be treated as a "transaction not involving the receipt of consideration".)
(a) Notwithstanding anything to the contrary in this Plan, in the event of a Change in Control (as hereinafter defined), then, to the extent permitted by applicable law: (i) the time during which Stock Awards become vested shall automatically be accelerated so that the unvested portions of all Stock Awards shall be vested prior to the Change in Control and (ii) the time during which the Options may be exercised shall automatically be accelerated to prior to the Change in Control. Upon and following the acceleration of the vesting and exercise periods, at the election of the holder of the Stock Award, the Stock Award may be: (x) exercised (with respect to Options) or, if the surviving or acquiring corporation agrees to assume the Stock Awards or substitute similar stock awards, (y) assumed; or (z) replaced with substitute stock awards. Options not exercised, substituted or assumed prior to or upon the Change in Control shall be terminated.
(b) For purposes of the Plan, a "Change of Control" shall be deemed to have occurred at any of the following times:
(i) upon the acquisition (other than from the Company) by any person, entity or "group," within the meaning of Section 13(d)(3) or 14(d)(2) of the Exchange Act (excluding, for this purpose, the Company or its affiliates, or any employee benefit plan of the Company or its affiliates which acquires beneficial ownership of voting securities of the Company), of beneficial ownership (within the meaning of Rule 13d-3 promulgated under the Exchange Act) of fifty percent (50%) or more of either the then outstanding shares of Common Stock or the combined voting power of the Company's then outstanding voting securities entitled to vote generally in the election of directors; or
(ii) at the time individuals who, as of April 2, 1991, constitute the Board (the "Incumbent Board") cease for any reason to constitute at least a majority of the Board, provided that any person becoming a director subsequent to April 2, 1991, whose election, or nomination for election by the Company's stockholders, was approved by a vote of at least a majority of the directors then comprising the Incumbent Board (other than an election or nomination of an individual whose initial assumption of office is in connection with an actual or threatened election contest relating to the election of the Directors of the Company, as such terms are used in Rule 14a-11 of Regulation 14A promulgated under the Exchange Act) shall be, for purposes of the Plan, considered as though such person were a member of the Incumbent Board; or
(iii) immediately prior to the consummation by the Company of a reorganization, merger, consolidation, (in each case, with respect to which persons who were the stockholders of the Company immediately prior to such reorganization, merger or consolidation do not, immediately thereafter, own more than fifty percent (50%) of the
combined voting power entitled to vote generally in the election of directors of the reorganized, merged or consolidated company's then outstanding voting securities) or a liquidation or dissolution of the Company or of the sale of all or substantially all of the assets of the Company; or
(iv) the occurrence of any other event which the Incumbent Board in its sole discretion determines constitutes a Change of Control.
(a) Anything in the Plan to the contrary notwithstanding, rights under Stock Awards may be assigned to an Alternate Payee to the extent that a QDRO so provides. (The terms "Alternate Payee" and "QDRO" are defined in paragraph 13(c) below.) The assignment of a Stock Award to an Alternate Payee pursuant to a QDRO shall not be treated as having caused a new grant. The transfer of an Incentive Stock Option to an Alternate Payee may, however, cause it to fail to qualify as an Incentive Stock Option. If a Stock Award is assigned to an Alternate Payee, the Alternate Payee generally has the same rights as the grantee under the terms of the Plan; provided however, that (i) the Stock Award shall be subject to the same vesting terms and exercise period as if the Stock Award were still held by the grantee, (ii) an Alternate Payee may not transfer a Stock Award and (iii) an Alternate Payee is ineligible for Re-Load Options described at paragraph 5(j) or Director Re-Load Options described at paragraph 6(j).
(b) In the event of the Plan administrator's receipt of a domestic relations order or other notice of adverse claim by an Alternate Payee of a grantee of a Stock Award, transfer of the proceeds of the exercise of such Stock Award, whether in the form of cash, stock or other property, may be suspended. Such proceeds shall thereafter be transferred pursuant to the terms of a QDRO or other agreement between the grantee and Alternate Payee. A grantee's ability to exercise a Stock Award may be barred if the Plan administrator receives a court order directing the Plan administrator not to permit exercise.
(c) The word "QDRO" as used in the Plan shall mean a court order (i) that creates or recognizes the right of the spouse, former spouse or child (an "Alternate Payee") of an individual who is granted a Stock Award to an interest in such Stock Award relating to marital property rights or support obligations and (ii) that the administrator of the Plan determines would be a "qualified domestic relations order," as that term is defined in section 414(p) of the Code and section 206(d) of the Employee Retirement Income Security Act ("ERISA"), but for the fact that the Plan is not a plan described in section 3(3) of ERISA.
(a) The Board at any time, and from time to time, may amend the Plan. However, except as provided in Section 10 relating to adjustments upon changes in the Common Stock, no amendment shall be effective unless approved by the stockholders of the Company within twelve (12) months before or after the adoption of the amendment, where the amendment will:
(i) increase the number of shares reserved for Stock Awards under the Plan;
(ii) modify the requirements as to eligibility for participation in the Plan (to the extent such modification requires stockholder approval in order for the Plan to satisfy the requirements of Section 422(b) of the Code); or
(iii) modify the Plan in any other way if such modification requires stockholder approval in order for the Plan to satisfy the requirements of Section 422(b) of the Code.
(b) The Board may in its sole discretion submit any other amendment to the Plan for stockholder approval, including, but not limited to, amendments to the Plan intended to satisfy the requirements of Section 162(m) of the Code and the regulations promulgated thereunder regarding the exclusion of performance- based compensation from the limit on corporate deductibility of compensation to certain executive officers.
(c) It is expressly contemplated that the Board may amend the Plan in
any respect the Board deems necessary or advisable to provide optionees with the
maximum benefits provided or to be provided under the provisions of the Code and
the regulations promulgated thereunder relating to employee Incentive Stock
Options and/or to bring the Plan and/or Options granted under it into compliance
therewith.
(d) Rights and obligations under any Stock Award granted before
amendment of the Plan shall not be impaired by any amendment of the Plan,
unless: (i) the Company requests the consent of the person to whom the Stock
Award was granted; and (ii) such person consents in writing.
(a) The Board may suspend or terminate the Plan at any time. No Stock Awards may be granted under the Plan while the Plan is suspended or after it is terminated. No Incentive Stock Options may be granted under the Plan after February 22, 2009.
(b) Rights and obligations under any Stock Awards granted while the Plan is in effect shall not be impaired by suspension or termination of the Plan, except with the consent of the person to whom the Stock Award was granted.
The Plan shall become effective as determined by the Board.
EXHIBIT 10.2
AMGEN INC.
AMENDED AND RESTATED 1997 SPECIAL NON-OFFICER EQUITY INCENTIVE PLAN
(a) The purpose of the 1997 Special Non-Officer Equity Incentive Plan (the "Plan") is to provide a means by which non-Officer employees of and consultants to Amgen Inc., a Delaware corporation (the "Company"), and employees of and consultants to the Company's Affiliates, as defined in paragraph 1(b), directly, or indirectly through Trusts, may be given an opportunity to benefit from increases in value of the stock of the Company through the granting of (i) stock options, (ii) stock bonuses, and (iii) rights to purchase restricted stock, all as defined below.
(b) The word "Affiliate" as used in the Plan means any parent corporation or subsidiary corporation of the Company, as those terms are defined in Sections 424(e) and (f), respectively, of the Internal Revenue Code of 1986, as amended (the "Code").
(c) The Company, by means of the Plan, seeks to retain the services of non-Officer employees of the Company and persons serving as consultants to the Company, to secure and retain the services of persons capable of filling such positions, and to provide incentives for such persons to exert maximum efforts for the success of the Company.
(d) The Company intends that the rights issued under the Plan ("Stock Awards") shall, in the discretion of the Board of Directors of the Company (the "Board") or any committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), be either (i) stock options granted pursuant to Section 5 hereof, which option shall not qualify as incentive stock options as that term is used in Section 422 of the Code ("Options") or (ii) stock bonuses or rights to purchase restricted stock granted pursuant to Section 6 hereof.
(e) The word "Trust" as used in the Plan shall mean a trust created for the benefit of the employee or consultant, his or her spouse, or members of their immediate family. The word optionee shall mean the person to whom the option is granted or the employee or consultant for whose benefit the option is granted to a Trust, as the context shall require.
(a) The Plan shall be administered by the Board unless and until the Board delegates administration to a committee, as provided in paragraph 2(c).
(b) The Board shall have the power, subject to, and within the limitations of, the express provisions of the Plan:
(1) To determine from time to time which of the persons eligible under the Plan shall be granted Stock Awards; when and how Stock Awards shall be granted; whether a Stock Award will be an Option, a stock bonus, a right to purchase restricted stock, or a combination of the foregoing; the provisions of each Stock Award granted (which need not be identical), including the time or times when a person shall be permitted to purchase or receive stock pursuant to a Stock Award; and the number of shares with respect to which Stock Awards shall be granted to each such person.
(2) To construe and interpret the Plan and Stock Awards granted under it, and to establish, amend and revoke rules and regulations for its administration. The Board, in the exercise of this power, may correct any defect, omission or inconsistency in the Plan or in any Stock Award, in a manner and to the extent it shall deem necessary or expedient to make the Plan fully effective.
(3) To amend the Plan as provided in Section 13.
(4) Generally, to exercise such powers and to perform such acts as the Board deems necessary or expedient to promote the best interests of the Company.
(c) The Board may delegate administration of the Plan to a committee composed of not fewer than two (2) members of the Board (the "Committee") which members may be non-employee directors and outside directors. If administration is delegated to a Committee, the Committee shall have, in connection with the administration of the Plan, the powers theretofore possessed by the Board, subject, however, to such resolutions, not inconsistent with the provisions of the Plan, as may be adopted from time to time by the Board. Notwithstanding anything else in this paragraph 2(c) to the contrary, at any time the Board or the Committee may delegate to a committee of one or more members of the Board the authority to grant or amend options to all employees or consultants or any portion or class thereof.
(d) The term "non-employee director" shall mean a member of the Board who (i) is not currently an officer of the Company or a parent or subsidiary of the Company (as defined in Rule 16a-1(f) promulgated by the Securities and Exchange Commission under Section 16 of the Securities Exchange Act of 1934, as amended (the "Exchange Act")) or an employee of the Company or a parent or subsidiary of the Company; (ii) does not receive compensation from the Company or a parent or subsidiary of the Company for services rendered in any capacity other than as a member of the Board (including a consultant) in an amount required to be disclosed to the Company's stockholders under Rule 404 of Regulation S-K promulgated by the Securities and Exchange Commission ("Rule 404"); (iii) does not possess an interest in any other transaction required to be disclosed under Rule 404; or (iv) is not engaged in a business relationship required to be disclosed under Rule 404, as all of these provisions are interpreted by the Securities and Exchange Commission under Rule 16b-3 promulgated under the Exchange Act.
(e) The term "outside director," as used in this Plan, shall mean an administrator of the Plan, whether a member of the Board or of any Committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), who is considered to be an "outside director" in accordance with the rules, regulations or interpretations of Section 162(m) of the Code.
(a) Subject to the provisions of Section 10 relating to adjustments upon changes in stock, the stock that may be issued pursuant to Stock Awards granted under the Plan shall not exceed in the aggregate Eighty-Nine Million (89,000,000) shares of the Company's $.0001 par value common stock (the "Common Stock"). If any Stock Award granted under the Plan shall for any reason expire or otherwise terminate without having been exercised in full, the Common Stock not purchased under such Stock Award shall again become available for the Plan. Shares repurchased by the Company pursuant to any repurchase rights reserved by the Company pursuant to the Plan shall not be available for subsequent issuance under the Plan.
(b) The Common Stock subject to the Plan may be unissued shares or reacquired shares, bought on the market or otherwise.
(a) Stock Awards may be granted to non-Officer employees of the Company, or employees of any Affiliate, or consultants to the Company or any Affiliate, or to Trusts of any such employee or consultant. Notwithstanding any other provisions in this Plan to the contrary, Officers of the Company shall not be eligible to receive Stock Awards. The term "Officer" shall include any natural person who is elected as a corporate officer of the Company by the Board.
(b) Stock Awards shall be limited to a maximum of 2,000,000 shares of Common Stock per person per calendar year.
An Option granted pursuant to this Section 5 shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Options need not be identical, but each Option shall include (through incorporation of provisions hereof by reference in the Option or otherwise) the substance of each of the following provisions:
(a) No Option shall be exercisable after the expiration of ten (10) years from the date it was granted.
(b) The exercise price of each Option shall be not less than one hundred percent (100%) of the fair market value of the Common Stock subject to the Option on the date the Option is granted.
(c) The purchase price of Common Stock acquired pursuant to an Option shall be paid, to the extent permitted by applicable statutes and regulations, either: (i) in cash at the time the Option is exercised; or (ii) at the discretion of the Board or the Committee, either at the time of grant or exercise of the Option (A) by delivery to the Company of shares of Common Stock that have been held for the period required to avoid a charge to the Company's reported earnings and valued at the fair market value of the shares of Common Stock on the date of exercise, (B) according to a deferred payment or other arrangement with the person to whom the Option is granted or to whom the Option is transferred pursuant to paragraph 5(d), or (C) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion, including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or, prior to the issuance of Common Stock, receipt by the Company of evidence from the person authorized to sell the underlying stock that they have received irrevocable instructions from the option holder to pay to the Company the aggregate exercise price of the Option from the sale proceeds.
In the case of any deferred payment arrangement, interest shall be payable at least annually and shall be charged at not less than the minimum rate of interest necessary to avoid the treatment as interest, under any applicable provisions of the Code, of any amounts other than amounts stated to be interest under the deferred payment arrangement.
(d) An Option granted to a natural person shall be exercisable during the lifetime of such person only by such person, provided that such person during such person's lifetime may designate a Trust to be such person's beneficiary, and such beneficiary shall, after the death of the person to whom the Option was granted, have all the rights that such person had while living, including the right to exercise the Option. In the absence of such designation, after the death of the person to whom the Option is granted, the Option shall be exercisable by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution.
(e) The total number of shares of Common Stock subject to an Option may, but need not, be allotted in periodic installments (which may, but need not, be equal). From time to time during each of such installment periods, the Option may become exercisable ("vest") with respect to some or all of the shares allotted to that period, and may be exercised with respect to some or all of the shares allotted to such period and/or any prior period as to which the Option was not fully exercised. During the remainder of the term of the Option (if its term extends beyond the end of the installment periods), the Option may be exercised from time to time with respect to any shares then remaining subject to the Option. The provisions of this paragraph 5(e) are subject to any Option provisions governing the minimum number of shares as to which an Option may be exercised.
(f) The Company may require any optionee, or any person to whom an Option is transferred under paragraph 5(d), as a condition of exercising any such Option: (i) to give written assurances satisfactory to the Company as to such person's knowledge and experience in financial and business matters and/or the employment of such person's purchaser
representative who has such knowledge and experience in financial and business
matters, and that such person is capable of evaluating, alone or together with
the purchaser representative, the merits and risks of exercising the Option; and
(ii) to give written assurances satisfactory to the Company stating that such
person is acquiring the Common Stock subject to the Option for such person's own
account and not with any present intention of selling or otherwise distributing
the Common Stock. These requirements, and any assurances given pursuant to such
requirements, shall be inoperative if: (x) the issuance of the shares upon the
exercise of the Option has been registered under a then currently effective
registration statement under the Securities Act of 1933, as amended (the
"Securities Act"); or (y) as to any particular requirement, a determination is
made by counsel for the Company that such requirement need not be met in the
circumstances under the then applicable securities law.
(g) An Option shall terminate three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate, unless: (i) such termination is due to the optionee's permanent and total disability, within the meaning of Section 422(c)(6) of the Code and with such permanent and total disability being certified by the Social Security Administration prior to such termination, in which case the Option may, but need not, provide that it may be exercised at any time within one (1) year following such termination of employment or relationship as a consultant; (ii) the optionee dies while in the employ of or while serving as a consultant to the Company or an Affiliate, or within not more than three (3) months after termination of such employment or relationship as a consultant, in which case the Option may, but need not, provide that it may be exercised at any time within eighteen (18) months following the death of the optionee by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution; or (iii) the Option by its term specifies either (A) that it shall terminate sooner than three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate; or (B) that it may be exercised more than three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate. Notwithstanding any other provision in this Plan to the contrary, (x) no portion of an Option shall be exercisable by any person to the extent that the Company's federal income tax deduction with respect to the exercise of such portion of the Option would be subject to disallowance pursuant to Section 162(m) of the Code, or any successor thereto, and (y) subject to paragraph 5(a), if any portion of an Option is not exercisable solely because of the preceding clause (x) on the date on which such Option would otherwise terminate pursuant to the foregoing provisions of this paragraph 5(g), such Option shall not terminate until three (3) months after such Option thereafter ceases to be subject to the preceding clause (x). Subject to the preceding sentence, any portion of an Option which is not exercisable on the date on which an optionee's employment or relationship as a consultant with the Company or an Affiliate ceases shall terminate immediately on such date. This paragraph 5(g) shall not be construed to extend the term of any Option or to permit anyone to exercise the Option after expiration of its term, nor shall it be construed to increase the number of shares as to which any Option is exercisable from the amount exercisable on the date of termination of the optionee's employment or relationship as a consultant.
(h) The Option may, but need not, include a provision whereby the optionee may elect at any time during the term of the optionee's employment or relationship as a
consultant with the Company or any Affiliate to exercise the Option as to any part or all of the shares subject to the Option prior to the stated vesting dates of the Option. Any shares so purchased from any unvested installment or Option may be subject to a repurchase right in favor of the Company or to any other restriction the Board or the Committee determines to be appropriate.
(i) To the extent provided by the terms of an Option, each optionee may satisfy any federal, state or local tax withholding obligation relating to the exercise of such Option by any of the following means or by a combination of such means: (i) tendering a cash payment; (ii) authorizing the Company to withhold from the shares of the Common Stock otherwise issuable to the optionee as a result of the exercise of the Option a number of shares having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding; or (iii) delivering to the Company owned and unencumbered shares of the Common Stock having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding.
Each stock bonus or restricted stock purchase agreement shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The terms and conditions of stock bonus or restricted stock purchase agreements may change from time to time, and the terms and conditions of separate agreements need not be identical, but each stock bonus or restricted stock purchase agreement shall include (through incorporation of provisions hereof by reference in the agreement or otherwise) the substance of each of the following provisions as appropriate:
(a) The purchase price under each stock purchase agreement shall be such amount as the Board or Committee shall determine and designate in such agreement. Notwithstanding the foregoing, the Board or the Committee may determine that eligible participants in the Plan may be awarded stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.
(b) No rights under a stock bonus or restricted stock purchase agreement shall be assignable by any participant under the Plan, either voluntarily or by operation of law, except where such assignment is required by law or expressly authorized by the terms of the applicable stock bonus or restricted stock purchase agreement.
(c) The purchase price of stock acquired pursuant to a stock purchase agreement shall be paid either: (i) in cash at the time of purchase; (ii) at the discretion of the Board or the Committee, according to a deferred payment or other arrangement with the person to whom the Common Stock is sold; or (iii) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion; including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instruction to pay the aggregate exercise price of the Company from the sales proceeds before Common Stock is
issued. Notwithstanding the foregoing, the Board or the Committee to which administration of the Plan has been delegated may award Common Stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.
(d) Shares of Common Stock sold or awarded under the Plan may, but need not, be subject to a repurchase option in favor of the Company in accordance with a vesting schedule to be determined by the Board or the Committee.
(e) In the event a person ceases to be an employee of or ceases to serve as a consultant to the Company or an Affiliate, the Company may repurchase or otherwise reacquire any or all of the shares of Common Stock held by that person which have not vested as of the date of termination under the terms of the stock bonus or restricted stock purchase agreement between the Company and such person.
(a) During the terms of the Stock Awards granted under the Plan, the Company shall keep available at all times the number of shares of Common Stock required to satisfy such Stock Awards up to the number of shares of Common Stock authorized under the Plan.
(b) The Company shall seek to obtain from each regulatory commission or agency having jurisdiction over the Plan such authority as may be required to issue and sell shares of Common Stock under the Stock Awards granted under the Plan; provided, however, that this undertaking shall not require the Company to register under the Securities Act either the Plan, any Stock Award granted under the Plan or any Common Stock issued or issuable pursuant to any such Stock Award. If, after reasonable efforts, the Company is unable to obtain from any such regulatory commission or agency the authority that counsel for the Company deems necessary for the lawful issuance and sale of Common Stock under the Plan, the Company shall be relieved from any liability for failure to issue and sell Common Stock upon exercise of such Stock Awards unless and until such authority is obtained.
Proceeds from the sale of Common Stock pursuant to Stock Awards granted under the Plan shall constitute general funds of the Company.
(a) The Board or Committee shall have the power to accelerate the time during which a Stock Award may be exercised or the time during which a Stock Award or any part thereof will vest, notwithstanding the provisions in the Stock Award stating the time during which it may be exercised or the time during which it will vest. Each Option providing for vesting pursuant to paragraph 5(e) shall also provide that if the employee's employment or a consultant's affiliation with the Company is terminated by reason of death or disability (within the meaning of Title II or XVI of the Social Security Act and with such permanent and total disability certified by the Social Security Administration prior to such termination), then the
vesting schedule of Options granted to such employee or consultant or to the Trusts of such employee or consultant shall be accelerated as of the date of such termination by twelve months for each full year the employee has been employed by or the consultant has been affiliated with the Company.
(b) Neither an optionee nor any person to whom an Option is transferred under the provisions of the Plan shall be deemed to be the holder of, or to have any of the rights of a holder with respect to, any shares subject to such Option unless and until such person has satisfied all requirements for exercise of the Option pursuant to its terms.
(c) Nothing in the Plan or any instrument executed or Stock Award granted pursuant thereto shall confer upon any eligible employee, consultant, optionee or holder of Stock Awards under the Plan any right to continue in the employ of the Company or any Affiliate or to continue acting as a consultant or shall affect the right of the Company or any Affiliate to terminate the employment or consulting relationship of any eligible employee, consultant, optionee or holder of Stock Awards under the Plan with or without cause, at any time and with or without notice. In the event that a holder of Stock Awards under the Plan is permitted or otherwise entitled to take a leave of absence, the Company shall have the unilateral right to (i) determine whether such leave of absence will be treated as a termination of employment or relationship as consultant for purposes hereof, and (ii) suspend or otherwise delay the time or times at which exercisability or vesting would otherwise occur with respect to any outstanding Stock Awards under the Plan.
(a) In the event that any dividend or other distribution (whether in the form of cash, Common Stock, other securities, or other property), recapitalization, reclassification, stock split, reverse stock split, reorganization, merger, consolidation, split-up, spin-off, combination, repurchase, liquidation, dissolution, or sale, transfer, exchange or other disposition of all or substantially all of the assets of the Company, or exchange of Common Stock or other securities of the Company (other than pursuant to the conversion of convertible securities), issuance of warrants or other rights to purchase Common Stock or other securities of the Company, or other similar corporate transaction or event, in the Board's or the Committee's sole discretion, affects the Common Stock such that an adjustment is determined by the Board or the Committee to be appropriate in order to prevent dilution or enlargement of the benefits or potential benefits intended to be made available under the Plan or with respect to Stock Awards, then the Committee or the Board shall, in such manner as it may deem equitable, may make the following adjustments to the Plan and with respect to any or all of the outstanding Stock Awards:
a. the number and kind of shares of Common Stock (or other securities or property) with respect to which Stock Awards may be granted under the Plan (including, but not limited to, adjustments of the limitations in paragraph 3(a) on the maximum number and kind of shares which may be issued under the Plan and in paragraph 4(b) on the maximum number of shares subject to Stock Awards which can be granted any person in a calendar year),
b. the number and kind of shares of Common Stock (or other securities or property) subject to outstanding Stock Awards, including by providing, either by the terms of such Stock Awards or by action taken prior to the occurrence of such transaction or event, that upon such event, such Stock Award shall be assumed by a successor or survivor corporation, or a parent or subsidiary thereof, or shall be substituted for by similar Stock Awards covering the stock of a successor or survivor corporation, or a parent or subsidiary thereof, with appropriate adjustments as to the number and kind of shares and prices, and
c. the grant or exercise price with respect to any Stock Award.
(b) In the event that the Board or Committee adjusts any or all of the outstanding Stock Awards by providing that such Stock Awards shall be assumed by a successor or survivor corporation, or a parent or subsidiary thereof, or shall be substituted for by similar options, rights or awards covering the stock of a successor or survivor corporation, or a parent or subsidiary thereof, the Board or the Committee may, in its sole discretion, determine that the transfer of the optionee's or other holder's employment or consulting relationship to such successor or survivor corporation or a parent or subsidiary thereof shall not constitute a cessation of the optionee's or holder's employment or consulting relationship with the Company or an Affiliate for the purposes of paragraph 5(g).
(c) Any adjustments made by the Board or the Committee under paragraphs 10(a) and 10(b) shall be final, binding and conclusive on all persons.
(a) Notwithstanding anything to the contrary in this Plan, in the event of a Change in Control (as hereinafter defined), then, to the extent permitted by applicable law: (i) the time during which Stock Awards become vested shall automatically be accelerated so that the unvested portions of all Stock Awards shall be vested prior to the Change in Control and (ii) the time during which the Options may be exercised shall automatically be accelerated to immediately prior to the Change in Control. Upon and following the acceleration of the vesting and exercise periods, at the election of the holder of the Stock Award, the Stock Award may be: (x) exercised (with respect to Options) or, if the surviving or acquiring corporation agrees to assume the Stock Awards or substitute similar stock awards, (y) assumed; or (z) replaced with substitute stock awards. Options not exercised, substituted or assumed prior to or upon the Change in Control shall be terminated.
(b) For purposes of the Plan, a "Change of Control" shall be deemed to have occurred at any of the following times:
(i) upon the acquisition (other than from the Company) by any person, entity or "group," within the meaning of Section 13(d)(3) or 14(d)(2) of the Exchange Act (excluding, for this purpose, the Company or its affiliates, or any employee benefit plan of the Company or its affiliates which acquires beneficial ownership of voting securities of the Company), of beneficial ownership (within the meaning of Rule 13d-3 promulgated under the
Exchange Act) of fifty percent (50%) or more of either the then outstanding shares of Common Stock or the combined voting power of the Company's then outstanding voting securities entitled to vote generally in the election of directors; or
(ii) at the time individuals who, as of December 9, 1997, constitute the Board (the "Incumbent Board") cease for any reason to constitute at least a majority of the Board, provided that any person becoming a director subsequent to December 9, 1997, whose election, or nomination for election by the Company's stockholders, was approved by a vote of at least a majority of the directors then comprising the Incumbent Board (other than an election or nomination of an individual whose initial assumption of office is in connection with an actual or threatened election contest relating to the election of the directors of the Company, as such terms are used in Rule 14a-11 of Regulation 14A promulgated under the Exchange Act) shall be, for purposes of the Plan, considered as though such person were a member of the Incumbent Board; or
(iii) immediately prior to the consummation by the Company of a reorganization, merger, consolidation, (in each case, with respect to which persons who were the stockholders of the Company immediately prior to such reorganization, merger or consolidation do not, immediately thereafter, own more than fifty percent (50%) of the combined voting power entitled to vote generally in the election of directors of the reorganized, merged or consolidated company's then outstanding voting securities) or a liquidation or dissolution of the Company or of the sale of all or substantially all of the assets of the Company; or
(iv) the occurrence of any other event which the Incumbent Board in its sole discretion determines constitutes a Change of Control.
(a) Anything in the Plan to the contrary notwithstanding, rights
under Stock Awards may be assigned to an Alternate Payee to the extent that a
QDRO so provides. (The terms "Alternate Payee" and "QDRO" are defined in
paragraph 12(c) below.) The assignment of a Stock Award to an Alternate Payee
pursuant to a QDRO shall not be treated as having caused a new grant. If a Stock
Award is assigned to an Alternate Payee, the Alternate Payee generally has the
same rights as the grantee under the terms of the Plan; provided however, that
(i) the Stock Award shall be subject to the same vesting terms and exercise
period as if the Stock Award were still held by the grantee, and (ii) an
Alternate Payee may not transfer a Stock Award.
(b) In the event of the Plan administrator's receipt of a domestic relations order or other notice of adverse claim by an Alternate Payee of a grantee of a Stock Award, transfer of the proceeds of the exercise of such Stock Award, whether in the form of cash, stock or other property, may be suspended. Such proceeds shall thereafter be transferred pursuant to the terms of a QDRO or other agreement between the grantee and Alternate Payee. A grantee's ability to exercise a Stock Award may be barred if the Plan administrator receives a court order directing the Plan administrator not to permit exercise.
(c) The word "QDRO" as used in the Plan shall mean a court order (i) that creates or recognizes the right of the spouse, former spouse or child (an "Alternate Payee") of an individual who is granted a Stock Award to an interest in such Stock Award relating to marital property rights or support obligations and (ii) that the administrator of the Plan determines would be a "qualified domestic relations order," as that term is defined in section 414(p) of the Code and section 206(d) of the Employee Retirement Income Security Act ("ERISA"), but for the fact that the Plan is not a plan described in section 3(3) of ERISA.
The Board at any time, and from time to time, may amend the Plan. Rights and obligations under any Stock Award granted before amendment of the Plan shall not be impaired by any amendment of the Plan, unless: (i) the Company requests the consent of the person to whom the Stock Award was granted; and (ii) such person consents in writing.
(a) The Board may suspend or terminate the Plan at any time. Unless sooner terminated, the Plan shall terminate on December 9, 2007. No Stock Awards may be granted under the Plan while the Plan is suspended or after it is terminated.
(b) Rights and obligations under any Stock Awards granted while the Plan is in effect shall not be impaired by suspension or termination of the Plan, except with the consent of the person to whom the Stock Award was granted.
The Plan shall become effective as determined by the Board.
SHAREHOLDERS' AGREEMENT
OF
KIRIN-AMGEN, INC.,
a California corporation
Page
----
RECITALS......................................................................... 1
1. CERTAIN DEFINITIONS........................................................ 3
1.01 Stock.............................................................. 3
1.02 EPO................................................................ 3
1.03 Field of Activity.................................................. 4
1.04 Expression Systems................................................. 4
1.05 Transferred Technology............................................. 4
1.06 EPO Technology..................................................... 5
1.07 EPO Organisms...................................................... 6
1.08 Core Technology.................................................... 6
1.09 Development Program................................................ 6
1.10 Party.............................................................. 7
2. FORMATION.................................................................. 7
2.01 Formation.......................................................... 7
2.02 Name............................................................... 7
2.03 Principal Office................................................... 8
2.04 Articles of Incorporation.......................................... 8
2.05 Bylaws............................................................. 8
2.06 Business Purpose................................................... 8
2.07 Fiscal Year ....................................................... 8
2.08 California Agent for Service of Process............................ 9
2.09 Counsel to Corporation ............................................ 9
2.10 Accountants to Corporation......................................... 9
2.11 Initial Capital.................................................... 9
2.12 Subscription....................................................... 10
2.13 Additional Capital................................................. 11
2.14 Withdrawals........................................................ 12
2.15 Default on Additional Capital Contribution Obligation.............. 12
2.16 Title to Property.................................................. 13
2.17 Occurrence of the Conversion Event................................. 13
3. CLOSING.................................................................... 14
4. CLOSING DOCUMENTS.......................................................... 14
|
Page
----
5. REPRESENTATIONS AND WARRANTIES OF AMGEN............................. 15
5.01 Good Standing............................................... 15
5.02 Authorization............................................... 15
5.03 No Breach................................................... 15
5.04 Title....................................................... 16
5.05 No Violations............................................... 17
5.06 No Litigation............................................... 18
5.07 Representations and Warranties.............................. 18
6. REPRESENTATIONS AND WARRANTIES OF KIRIN............................. 19
6.01 Good Standing............................................... 19
6.02 Authorization............................................... 19
6.03 No Breach................................................... 19
6.04 No Violations............................................... 20
6.05 No Litigation............................................... 20
6.06 Representations and Warranties.............................. 20
7. [INTENTIONALLY OMITTED]............................................. 21
8. CONDITIONS PRECEDENT TO THE OBLIGATIONS OF KIRIN.................... 21
8.01 No Misrepresentations....................................... 21
8.02 Compliance with Agreement................................... 21
8.03 Delivery.................................................... 21
8.04 Opinion of Counsel.......................................... 23
8.05 No Litigation............................................... 24
8.06 Additional Documents........................................ 24
8.07 Hart-Scott-Rodino Clearance................................. 25
9. CONDITIONS PRECEDENT TO THE OBLIGATIONS OF AMGEN.................... 25
9.01 No Misrepresentations....................................... 25
9.02 Compliance with Agreement................................... 25
9.03 Delivery.................................................... 25
9.04 Opinion of Counsel.......................................... 26
9.05 No Litigation............................................... 28
9.06 Additional Documents........................................ 28
10. SURVIVAL AND INDEMNIFICATION........................................ 28
10.01 Survival of Representations and Warranties.................. 28
10.02 Indemnification............................................. 28
10.03 Mechanism................................................... 29
|
Page
----
11. BROKERS............................................................. 30
12. MANAGEMENT.......................................................... 31
12.01 Board of Directors.......................................... 31
12.02 Officers.................................................... 31
12.03 Actions Requiring Consent................................... 32
12.04 Accounting and Internal Controls............................ 33
12.05 Financial and Business Information and Tax Returns.......... 34
12.06 Bank Accounts............................................... 35
12.07 Independent Enterprise...................................... 35
12.08 Compensation of Officers and Directors...................... 35
12.09 Fiduciary Duty.............................................. 36
12.10 Other Activities............................................ 36
12.11 Non-Competition............................................. 36
13. BUSINESS MATTERS.................................................... 37
13.01 License Agreements.......................................... 37
13.02 Development Program......................................... 38
13.03 Services Agreements......................................... 39
14. RESTRICTIONS ON SHARES.............................................. 39
14.01 Overall Restrictions........................................ 39
14.02 Additional Restrictions..................................... 40
14.03 Purchase Price and Payment Date............................. 41
14.04 Delivery of Shares.......................................... 42
15. ADDITIONAL SHARES................................................... 42
16. ENDORSEMENT OF CERTIFICATE.......................................... 42
17. [INTENTIONALLY OMITTED]............................................. 43
18. COSTS AND EXPENSES.................................................. 43
19. EXPORT CONTROL LAWS................................................. 44
19.01 Export Law Compliance....................................... 44
19.02 Specific Authorization...................................... 44
20. DISTRIBUTIONS OF CASH............................................... 45
|
Page
----
21. DISSOLUTION/LIQUIDATION............................................ 45
21.01 Event of Dissolution...................................... 45
21.02 Final Accounting and Tax Returns.......................... 46
21.03 Liquidation............................................... 46
21.04 Cancellation of Certificates.............................. 47
22. MISCELLANEOUS PROVISIONS........................................... 48
22.01 Notices................................................... 48
22.02 Publicity and Disclosure.................................. 49
22.03 Entire Agreement; Amendment............................... 49
22.04 Waiver.................................................... 50
22.05 Enforcement............................................... 50
22.06 Remedies.................................................. 51
22.07 Headings.................................................. 51
22.08 Effectiveness............................................. 51
22.09 Attorneys' Fees and Costs................................. 52
22.10 Governing Law............................................. 52
22.11 Binding Effect............................................ 52
22.12 Exhibits.................................................. 52
22.13 Number and Gender......................................... 53
22.14 Counterparts.............................................. 53
22.15 Agreement to Perform Necessary Acts....................... 53
22.16 Validity.................................................. 53
22.17 Representations........................................... 54
22.18 Force Majeure............................................. 54
22.19 Expansion of Business..................................... 55
SIGNATURES.................................................................... 55
|
EXHIBIT SCHEDULE
THIS SHAREHOLDERS' AGREEMENT ("Agreement") is made and entered into at Los Angeles, California, U.S.A. this 11th day of May, 1984, by and among AMGEN, a California corporation, having its principal office at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A . ("Amgen"), KIRIN BREWERY COMPANY, LIMITED, a Japanese corporation, having its principal office at 26-1, Jingumae, 6 Chome, Shibuya-Ku, Tokyo 150, Japan ("Kirin"), and KIRIN-AMGEN, INC., a California corporation, having its principal office at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A. ("Corporation").
R E C I T A L S
A. Amgen has conducted research, has developed and possesses certain existing proprietary technical information, technology and know-how relating to genetic engineering which has enabled it to clone and express the gene for human erythropoietin, and Amgen is continuing to develop human erythropoietin.
B. Kirin and Amgen believe that the aforementioned genetic engineering techniques will have important application to the development of human therapeutic products.
C. Kirin and Amgen desire to form Corporation for purposes of development, manufacture, production and worldwide commercial sale of erythropoietin for human therapeutic use.
D. Kirin and Amgen believe that a joint business effort between them dedicated to such purposes would be of mutual benefit to the accomplishment thereof and that the compatibility between Amgen and Kirin is such that substantial economic returns may be gained by each through cooperative effort.
E. Amgen intends to contribute cash to Corporation, to assign to Corporation, perpetually and irrevocably, all of its right, title and interest in and to the Transferred Technology (as defined in Paragraph 1.05 below), and to license to Corporation the Core Technology (as defined in Paragraph 1.08 below), exclusively with respect to its direct application to the Field of Activity (as defined in Paragraph 1.03 below), as more fully set forth herein, in consideration of the issuance to Amgen of capital stock in Corporation as more fully set forth herein.
F. Kirin intends to contribute cash to Corporation in consideration of the issuance to Kirin of capital stock in Corporation as more fully set forth herein.
G. The simultaneous transfers and resultant issuances contemplated in Recitals E. and F. above are intended to qualify as a tax-free incorporation of Corporation pursuant to Section 351 of the Internal Revenue Code of 1954, as amended.
H. It is the desire of Kirin and Amgen to cooperate in other mutually agreeable areas of business interest.
NOW, THEREFORE, it is agreed as follows:
As used in this Agreement, the following terms shall have the following meanings:
(a) The term Class A Common Stock shall mean the duly authorized no par common stock of Corporation with no preference rights on liquidation.
(b) The term Class B Common Stock shall mean the duly authorized no par common stock of Corporation which contains certain preference rights on liquidation (as set forth in Para- graph 21 below), which preference rights shall be in effect until the occurrence of the Conversion Event (as defined in Paragraph 2.17 below), at which time all issued and outstanding Class B Common Stock shall be automatically converted into Class A Common Stock on a share-for- share basis eliminating any shareholder preference rights on liquidation of Corporation.
1.02 EPO
The term EPO shall mean erythropoietin or a fragment thereof for use in human therapeutic applications, whether
manufactured or isolated from natural materials, and whether glycosylated or not glycosylated.
The term Field of Activity shall mean- the areas of development, manufacture, production and worldwide commercial sale of EPO, including EPO pharmaceuticals, for human therapeutic use, but not for animal therapeutic use nor- for commercial diagnostic use (collectively "EPO Products"), and shall include but not be limited to, toxicology, dosage studies, pre-clinical studies, clinical trials, product registration and government approvals, all relative to the development, manufacture, production and worldwide commercial sale of such EPO Products.
The term Expression Systems shall mean any system of production of EPO utilizing natural or synthetic genes or vectors or recombinant DNA materials, including but not limited to, expression in e. coli, mammalian and/or yeast cell systems.
The term Transferred Technology shall mean all proprietary technical information, technology and know-how, heretofore developed by Amgen, relating specifically to EPO Products which are owned by Amgen, or which is covered or protected by letters patent, patent applications, trademarks, service marks, trade names, copyrights or licenses held by Amgen,
as of the Closing Date, and which are required in the development, manufacture, production, testing, assay, use or sale of EPO Products, including the EPO Organisms (as defined in Paragraph 1.07 below) in existence as of the Closing Date. By way of illustration, but not limitation, with respect to the foregoing, Transferred Technology shall include the sequence of the EPO gene and restriction map of the related vector and any information, know-how, data, process, technique, algorithm, program, design, drawing, formula or test data relating to any toxicology, dosage studies, pre-clinical studies, clinical trials or testing in progress relating to EPO,as more fully set forth on Exhibit "A" attached hereto. The Transferred Technology shall be assigned to Corporation effective on the Closing Date pursuant to that certain Assignment and License Agreement which is attached hereto as Exhibit "B" ("Amgen Assignment"); provided, however, that until such time as the Conversion Event occurs, Amgen shall hold as custodian for Corporation and Kirin, the sequence of the EPO gene and restriction map of the related vector.
The term EPO Technology shall mean the Transferred Technology, as well as all improvements and enhancements thereto developed by the Parties hereafter- under the Development Program, and the Core Technology (as defined in Paragraph 1.08 below), as well as all improvements and enhancements thereto developed by the Parties hereafter which have been used in the development of EPO Products whether within or without of the Development Program
The term EPO Organisms shall mean any and all organisms developed by Amgen which are assigned perpetually and irrevocably to Corporation pursuant to the Amgen Assignment, and which have been genetically engineered to produce biologically active EPO, as well as all improvements and enhancements thereto developed by Amgen subsequent to the Closing Date pursuant to the Development Program.
The term Core Technology shall mean Amgen's proprietary technical information, technology and know-how, including without limitation, protein purification, fermentation, process development and hybridomas, other than Transferred Technology, which is required to conduct Corporation's business in the Field of Activity. The Core Technology shall be licensed to Corporation exclusively with respect to its direct application to the Field of Activity pursuant to the Amgen Assignment.
The term Development Program, as more fully set forth in the Development and Supply Agreement attached hereto as Exhibit "C," and which shall have appended thereto the preliminary R&D Plan and Budget therefor, shall mean any development conducted by Amgen, Kirin and/or Corporation and paid for by Corporation relating to (i) toxicology, dosage studies, preclinical studies, clinical trials and product registration of EPO
in accordance with the laws, regulations and guidelines of the United States and Japan, respectively, (ii) commercial manufacturing scale production of EPO in one or more Expression Systems, and (iii) other mutually agreed upon development activities related to the Field of Activity.
The term Party shall mean Kirin, Amgen or Corporation, as the context shall indicate, or, when used in the plural, Kirin, Amgen and Corporation, as the context shall indicate.
On or before the Closing Date (as defined in Paragraph 3 below), Kirin and Amgen shall establish or cause to be established, "Kirin-Amgen, Inc.," which shall be a corporation organized under the laws of the State of California. Immediately after its formation, Kirin-Amgen, Inc. shall become a Party to this Agreement.
The corporate designation of Corporation shall be "Kirin-Amgen, Inc." or such other name as may be mutually agreed to by Kirin and Amgen.
The principal office and place of business of Corporation shall be located at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A., or at such other place as may be mutually agreed to by Kirin and Amgen.
The Articles of Incorporation of Corporation ("Articles") shall be as attached hereto as Exhibit "D," as may be amended from time to time as may be mutually agreed to by Kirin and Amgen.
The Bylaws of Corporation ("Bylaws") shall be as attached hereto as Exhibit "E", as may be amended from time to time as may be mutually agreed to by Kirin and Amgen.
The business of Corporation shall be to engage in the development, manufacture, production and sale of EPO Products for human therapeutic use in the Field of Activity and to otherwise exploit such EPO Technology for commercial purposes by whatever means including, but not limited to, the license or sale of such EPO Technology by mutual agreement of Kirin and Amgen, and to do all things necessary, appropriate or advisable in furtherance thereof.
The fiscal year of Corporation shall be the calendar year ("Corporate Year").
The name of the initial agent for service of process on Corporation in California is Joel S. Marcus, Esq., Musick, Peeler & Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017.
The law firm of Musick, Peeler and Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017, shall act as general counsel for Corporation until otherwise mutually agreed between Kirin and Amgen pursuant to that certain Conflicts Letter of even date herewith which is attached hereto as Exhibit "F".
The independent certified public accounting firm of Arthur Young and Company, 515 South Flower Street, Suite 2600, Los Angeles, California 90071, shall act as independent accountants to Corporation pursuant to that certain engagement letter attached hereto as Exhibit "G".
2.11 Initial Capital
The initial capital of Corporation pursuant to the two (2) subscriptions described in Paragraph 2.12 below, shall consist of a total of twelve million (12,000,000) shares of no par value Class A Common Stock with the right to one (1) vote per share ("Class A Common Stock"), and twelve million (12,000,000) shares of no par value Class B Common Stock with the right to one
(1) vote per share ("Class B Common Stock"). Upon the occurrence of the Conversion Event (as defined in Paragraph 2.17 below), Kirin's shares of Class B Common Stock shall be automatically converted on a share-for-share basis into shares of Class A common stock subject to the terms of Paragraph 2.17 below and the provisions contained in Corporation's Articles.
2.12 Subscription
Kirin hereby subscribes for twelve million (12,000,000) shares of Class B Common Stock of Corporation, and Amgen hereby subscribes for twelve million shares (12,000,000) shares of Class A Common Stock of Corporation. The subscription price for all shares, whether of Class A Common Stock or Class B Common Stock, shall be ONE DOLLAR (U.S. $1.00) per share, and shall be payable as follows:
2.12.1 Kirin shall pay its full subscription price for the Class B Common Stock by cashiers or certified check or by wire transfer from Kirin to Corporation's account at a bank to be designated by both Kirin and Amgen ("Corporate Bank Account") on the Closing Date of the full subscription price of TWELVE MILLION DOLLARS (US $12,000,000.00).
2.12.2 Amgen shall pay its full subscription price for the Class A Common Stock as follows: (i) FOUR MILLION DOLLARS (U.S. $4,000,000.00) by cashiers or certified check or by wire transfer from Amgen to the Corporate Bank Account on the Closing Date, and (ii) a contribution and complete assignment in
kind to Corporation on the Closing Date of all of the Transferred Technology, such transfer to be made pursuant to the Amgen Assignment. Kirin and Amgen acknowledge that the fair market value of Amgen's capital contribution to Corporation described in subparagraph (ii) above shall be EIGHT MILLION DOLLARS (U.S. $8,000,000.00).
2.13.1 Subject to Paragraph 2.15 below, no additional capital stock may be issued by Corporation other than by the mutual written consent of Kirin and Amgen. The Parties hereto shall meet no less frequently than annually following the formation of Corporation to determine its capital needs and the business and Development Program for the next succeeding year.
2.13.2 In the event that the initial capital contributions to Corporation pursuant to Paragraph 2.11 above (together with interest earned by Corporation on the cash so contributed) are insufficient to fund the activities of Corporation and the Development Program until such time as all approvals (governmental or otherwise) have been obtained for the manufacture and sale of EPO Products in the Field of Activity in the Kirin Territory and the Amgen Territory (as defined in Paragraph 13 below), then in such event, Kirin and Amgen may, but shall not be obligated to, agree to make additional capital contributions to Corporation. Any such agreed upon capital contributions shall be made in the proportion to which each Party's total capital contribution bears to the
aggregate capital contributions of Kirin and Amgen, from time to time existing. Upon written notification by Corporation's Board of Directors to Kirin and Amgen that Corporation does not have sufficient capital to complete the development of the EPO Technology and to accomplish the business purposes of Corporation as contemplated by this Agreement, Kirin and Amgen shall promptly meet with management of Corporation to ascertain the amount of funding reasonably required by Corporation under the circumstances. Kirin and Amgen shall thereafter enter into a mutually acceptable agreement with respect to such additional capital contributions, if any.
Except as otherwise specifically provided in this Agreement, neither Kirin nor Amgen shall have the right to withdraw or to demand a return of all or any part of its capital contribution.
To the extent that either Kirin or Amgen fails to contribute its proportionate share of the additional capital called for under Paragraph 2.13 above, then from and after the date such capital was to have been contributed to Corporation, the shareholding percentages of Kirin or Amgen shall promptly be adjusted by Corporation to reflect the increase in capital contributed by either Kirin or Amgen such that the shareholding interest of Kirin and Amgen shall accurately reflect the percent-
age of each Party's total Capital contribution as it bears to the aggregate capital contributions of both Kirin and Amgen.
Legal title to any and all property of Corporation shall be taken and at all times held in the name of "Kirin-Amgen, Inc."
2.17.1 The "Conversion Event" shall occur when the EPO Organisms produce biologically active EPO in sufficient levels, as set forth below, which Kirin can reasonably verify within thirty (30) days after receiving written notice of the attainment thereof, to enable Corporation to conduct pre-clinical studies in the E. Coli (50 mg EPO/1), Mammalian (50 Units EPO/ml), or Yeast Cell (50 mg EPO/1) systems, both in Japan and in the United States.
2.17.2 The occurrence of the Conversion Event as set forth in Paragraph 2.17.1 above, shall give rise to the automatic conversion of all of Kirin's Class B Common Stock into Class A Common Stock on a share-for-share basis. All Class B Common Stock shall thereafter be promptly cancelled, the Articles amended, and only one class of common stock (to be designated common stock) of Corporation shall thereafter be issued and outstanding.
The Closing hereunder shall take place at the offices of Musick, Peeler & Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017, USA, at 1:00 p.m. Pacific Daylight Time on June 15, 1984 ("Closing" and the "Closing Date"), or such other date and/or place as shall be mutually agreed to by Kirin and Amgen.
At the Closing, each Party shall deliver such documents, instruments and materials as are called for by this Agreement or as may be reasonably required in order to carry out the provisions and purposes hereof, all of which shall be satisfactory in substance and form to legal counsel for each Party. Without limitation as to the foregoing and in addition to the various documents, instruments and agreements contemplated in Paragraphs 8 and 9 below, the Parties agree that, upon the request of any Party, each of them will from time to time after the Closing Date execute, acknowledge and deliver or cause to be so done, at their expense, any and all such further documents and instruments as may be reasonably required for carrying out the purposes of this Agreement. Simultaneously with such delivery and Closing, all steps shall be taken as may be reasonably required to put
Corporation in actual possession and operating control of the Transferred Technology.
5. REPRESENTATIONS AND WARRANTIES OF AMGEN
To induce Kirin to enter into this Agreement, Amgen represents and warrants to Kirin as of the date hereof as follows:
Amgen is a corporation duly organized, validly existing and in good standing under the laws of the State of California and has all requisite power and authority to: (i) own its assets to be conveyed in connection with this Agreement; (ii) lawfully carry on its business as now being conducted; and (iii) to make, execute, deliver and perform this Agreement and all contracts -and documents to be executed in connection herewith.
This Agreement has been duly authorized and, prior to the Closing Date, will be approved by all necessary corporate action of Amgen and will be a valid and legally binding obligation of Amgen in accordance with its terms.
Neither execution or delivery of this Agreement, the contracts and instruments to be executed in connection herewith, nor its performance by Amgen will conflict with, violate or
result in a breach of any term, condition or provision of, nor constitute a material default under, or result in the acceleration of any material obligation under, or permit the termination of any indenture, material contract or other material agreement to which Amgen is a party or by which Amgen or its properties is subject or bound; nor will such execution, delivery or performance by Amgen conflict with or violate the provisions of any judgment, decree, order to which Amgen is subject or Amgen's restated Articles of Incorporation or Bylaws, or to the best of its knowledge, any law or regulation.
Amgen has valid legal title in and to all of the assets to be transferred and/or licensed to Corporation on the Closing Date pursuant to the Amgen Assignment, including but not limited to, the Transferred Technology, the Core Technology, free and clear of all security interests, liens, charges and encumbrances whatsoever, and to the best of Amgen's knowledge, tax or other inchoate liens. Amgen owns and has the right to use the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date. To the best of Amgen's knowledge: (i) the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date do not conflict with the rights of others; (ii) there are no infringements by third parties of any letters patent or patent applications which are part of the Transferred Technology and Core Technology in exis-
tence as of the date hereof and to be in existence as of the Closing Date; and
(iii) Amgen's operations and business as conducted as of and prior to the
Closing Date with respect to patent applications which are part of the
Transferred Technology and Core Technology in existence as of the date hereof
and to be in existence as of the Closing Date do not infringe upon the rights of
any person and/or entity not a Party hereto. No right, privilege, permission or
license, express or implied, under the Transferred Technology or Core Technology
in existence as of the date hereof and to be in existence as of the Closing
Date, has been granted or is in force pursuant to which any party, other than
Corporation, Kirin or Amgen, may make, have made, use or sell any Transferred
Technology or Core Technology in existence as of the date hereof and to be in
existence as of the Closing Date. No claims have been asserted by any person
relating to the EPO Technology in existence as of the date hereof and to be in
existence as of the Closing Date or challenging or questioning the validity or
effectiveness of any license or agreement related thereto, and there is no valid
basis for any such claim.
Amgen is not in violation of any applicable ordinance or statute, or, to the best of its knowledge, any law or regulation, with respect to its ownership and operation of the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date, nor has it received any notices or citations from any public or
quasi-public authority in respect thereto, including but not limited to, the Food and Drug Administration.
Amgen is not a party to any pending or threatened suit, action or legal, administrative, arbitration or other proceeding which might materially and adversely affect the business of Corporation, the Transferred Technology or the Core Technology, in existence as of the date hereof or to be in existence as of the Closing Date, or the transactions contemplated by this Agreement, nor does Amgen know of any facts which are likely with the passage of time to give rise to such a suit, action or proceeding.
No representation or warranty of Amgen, nor any exhibit, document, statement, certificate or schedule furnished to Kirin pursuant hereto or in connection with the transactions contemplated hereby, contains any untrue statement of a material fact, or omits to state a material fact necessary to make statements or facts contained therein not misleading. The representations and warranties of Amgen set forth in this Agreement and in any exhibit, document, statement, certificate or schedule furnished or to be furnished pursuant hereto shall be true on and as of the Closing Date as though such representations and warranties were made on and as of Closing Date.
To induce Amgen to enter into and perform this Agreement, Kirin represents and warrants to Amgen as of the date hereof as follows:
Kirin is a corporation duly organized and validly existing and in good standing under the laws of the country of Japan and has all requisite power and authority to lawfully carry on its business as now being conducted and to make, execute, deliver and perform this Agreement and all instruments and documents to be executed in connection herewith.
This Agreement has been duly authorized and, prior to the Closing Date will be approved by all necessary corporate action of Kirin and will be a valid and legally binding obligation of Kirin in accordance with its terms.
Neither execution or delivery of this Agreement, the contracts and instruments to be executed in connection herewith, nor its performance by Kirin will conflict with, violate or result in a breach of any term, condition or provision of, nor constitute a material default under, or result in the acceleration of any material obligation under, or permit the termination of any indenture, material contract or other material agreement to which Kirin is a party or by which Kirin or its properties is
subject or bound; nor will such execution, delivery or performance by Kirin conflict with or violate the provisions of any judgment, decree, order to which Kirin is subject or Kirin's Bylaws, or to the best of its knowledge, any law or regulation.
Kirin is not in violation of any applicable ordinance or statute, or to the best of its knowledge, any law or regulation, nor has it received any notices or citations from any public or quasi-public authority in respect thereto.
Kirin is not a party to any pending or threatened suit, action or legal, administrative, arbitration or other proceeding which might materially and adversely affect the transactions contemplated by this Agreement, nor does Kirin know of any facts which are likely with the passage of time to give rise to such a suit, action or proceeding.
No representation or warranty of Kirin, nor any exhibit, document, statement, certificate or schedule furnished or to be furnished to Amgen pursuant hereto or in connection with the transactions contemplated hereby, contains or will contain any untrue statement of a material fact, or omits or will omit to state a material fact necessary to make statements or facts contained therein not misleading. The representations and warranties of Kirin set forth in this Agreement and in any
exhibit, document, statement, certificate or schedule furnished or to be furnished pursuant hereto shall be true on and as of the Closing Date as though such representations and warranties were made on and as of Closing Date.
All of the obligations of Kirin under this Agreement are subject to the fulfillment, at or prior to the Closing Date, of each of the following conditions:
8.01 No Misrepresentations
Kirin shall not have discovered any material error, misstatement or omission in the representations and warranties made by Amgen in Paragraph 5 above.
8.02 Compliance with Agreement
Amgen shall have performed and complied with all agreements, covenants and conditions required by this Agreement prior to the Closing Date.
8.03 Delivery
Kirin shall have had delivered to it each of the following:
8.03.1 Confirmation in form and substance reasonably satisfactory to Kirin evidencing receipt of Amgen's monetary
capital contribution in the amount specified in Paragraph 2.12 above;
8.03.2 Duly executed counterpart of the Amgen Assignment effective
to (i) vest valid legal title to all Transferred Technology in Corporation, and
(ii) license the Core Technology exclusively to Corporation with respect to its
direct application to the Field of Activity, together with such other documents
and instruments as may be necessary to effectuate the assignments and licensing
contemplated by this Agreement;
8.03.3 Duly executed counterparts of the Bylaws and organizational minutes of Corporation;
8.03.4 Duly executed, validly authorized and issued, fully paid and non-assessable Class B Common Stock represented by Certificate No. 1, duly issuing twelve million (12,000,000) shares thereof to Kirin;
8.03.5 Duly executed counterpart of the Development and Supply
Agreement;
8.03.6 Duly executed counterparts of the Kirin/ Kirin-Amgen, Inc.
|
and Amgen/Kirin-Amgen, Inc. Services Agreements which are attached hereto as Exhibits "H" and "I", respectively ("Services Agreements");
8.03.7 Duly executed counterparts of the Kirin/ Kirin-Amgen, Inc. and Amgen/Kirin-Amgen, Inc. License Agreements which are attached hereto as Exhibits "J" and "K", respectively ("License Agreements"); and
8.03.8 Opinion of Amgen's counsel (as defined in Paragraph 8.04
below).
-22-
|
8.04 Opinion of Counsel
------------------
Amgen shall have delivered to Kirin an opinion of Cooley,
|
Godward, Castro, Huddleson & Tatum, legal counsel for Amgen, in a form satisfactory to counsel for Kirin, dated as of the Closing Date, to the effect that (i) Amgen is a corporation duly organized, validly existing and in good standing under the laws of the State of California, and Amgen has the corporate power to conduct its business where such business is now conducted and to execute and deliver the Agreement; (ii) the execution, delivery and performance of this Agreement, together with all instruments and documents executed in connection therewith, and the transactions contemplated hereby have been duly authorized and approved by the Board of Directors of Amgen; (iii) the Agreement, together with all instruments and documents executed in connection therewith, constitute valid and binding obligations of Amgen, enforceable in accordance with their terms, except as limited by bankruptcy, insolvency or other laws of general application relating to or affecting the enforcement of creditors' rights; (iv) the execution, delivery and performance by Amgen, together with all instruments and documents executed in connection therewith, and the consummation of the transactions contemplated hereby will not result in any conflict with or material breach or violation by Amgen of, or default by Amgen under, its Articles of Incorporation, Bylaws, or any judgment, decree, order, or indenture, material obligation or agreement, or other
material instrument or document of or applicable to them known to such legal counsel; and (v) the Amgen Assignment has been duly authorized, executed and delivered by and on behalf of Amgen and effectively transfers to and vests in Corporation (i) valid legal title to the Transferred Technology, and (ii) a valid license of the Core Technology, free and clear of all claims, liens, encumbrances or security interests of any kind.
In rendering the foregoing opinion, Cooley, Godward, Castro, Huddleson & Tatum may rely on opinions of other counsel, reasonably acceptable to Kirin, and, as to matters of fact, on searches of public records and certificates of officers and directors of Amgen.
No suit, action or proceeding against Amgen shall be pending or threatened before any court or governmental agency in which it is sought to restrain or prohibit or to obtain damages or other relief in connection with this Agreement or the transaction contemplated hereby.
Amgen shall have delivered to Kirin such other instruments and documents as may be, in the opinion of counsel for Kirin, reasonably necessary to effectuate the transactions contemplated by this Agreement, and all legal matters in connection with this Agreement and the transactions contemplated hereby shall have been approved by counsel for Kirin.
The waiting period described in Section 7A of the Clayton Act, 15 U.S.C.ss.18a has expired without adverse action by the Federal Trade Commission ("FTC") or Department of Justice ("DJ") of the United States, or an affirmative response has been received from the FTC or DJ which has the effect of shortening the waiting period.
9. CONDITIONS PRECEDENT TO THE OBLIGATIONS OF AMGEN
All of the obligations of Amgen under this Agreement are subject to the fulfillment, at or prior to the Closing Date, of each of the following conditions:
Amgen shall not have discovered any material error, misstatement or omission in the representations and warranties made by Kirin in Paragraph 6 above.
Kirin shall have performed and complied with all agreements, covenants and conditions required by this Agreement prior to the Closing Date.
Amgen shall have had delivered to it each of the following:
9.03.1 Confirmation in form and substance reasonably satisfactory to Amgen evidencing receipt of Kirin's monetary capital contribution in the amount specified in Paragraph 2.12 above;
9.03.2 Duly executed counterparts of the Articles, Bylaws and Organizational Minutes of Corporation;
9.03.3 Duly executed, validly authorized and issued, fully paid and non-assessable Class A Common Stock represented by Certificate No. 1, duly issuing twelve million (12,000,000) shares thereof to Amgen;
9.03.4 Duly executed counterpart of the Development and Supply
Agreement;
9.03.5 Duly executed counterparts of the Services Agreements;
9.03.6 Duly executed counterparts of the License Agreements; and
9.03.7 Opinion of Counsel to Kirin (as defined in Paragraph 9.04
below).
|
Kirin shall have delivered to Amgen an opinion of Musick, Peeler & Garrett, legal counsel for Kirin, in a form satisfactory to counsel for Amgen, dated as of the Closing Date, to the effect that (i) Kirin is a corporation duly organized, validly existing and in good standing under the laws of Japan and Kirin has the corporate power to conduct its business where such
business is now conducted and to execute and deliver the Agreement; (ii) the execution, delivery and performance of this Agreement, together with all instruments and documents executed in connection therewith, and the transactions contemplated hereby have been duly authorized and approved by the Board of Directors of Kirin; (iii) the Agreement, together with all instruments and documents executed in connection therewith, constitute valid and binding obligations of Kirin, enforceable in accordance with their terms, except as limited by bankruptcy, insolvency or other laws of general application relating to or affecting the enforcement of creditors' rights; and (iv) the execution, delivery and performance by Kirin, together with all instruments and documents executed in connection therewith, and the consummation of the transactions contemplated hereby will not result in any conflict with or material breach or violation by Kirin of, or default by Kirin under, its Articles of Incorporation, Bylaws, or any judgment, decree, order, or indenture, material obligation or agreement, or other material instrument or document of or applicable to them known to such legal counsel.
In rendering the foregoing opinion, Musick, Peeler & Garrett may rely on opinions of other counsel, reasonably acceptable to Amgen, and, as to matters of fact, on searches of public records and certificates of officers and directors of Kirin.
No suit, action or proceeding against Kirin shall be pending or threatened before any court or governmental agency in which it is sought to restrain or prohibit or to obtain damages or other relief in connection with this Agreement or the transaction contemplated hereby.
Kirin shall have delivered to Amgen such other instruments and documents as may be, in the opinion of counsel for Amgen; reasonably necessary to effectuate the transactions contemplated by this Agreement, and all legal matters in connection with this Agreement and the transactions contemplated hereby shall have been approved by counsel for Amgen.
The respective representations and warranties of Kirin and of Amgen shall survive the Closing and continue in full force and effect for a period thereafter equal to the earlier of (i) five (5) years following the Closing Date, or (ii) four (4) years after the Conversion Event.
Amgen shall indemnify and hold Kirin, Corporation and their respective directors, officers, employees and agents harm-
less from and against any and all claims, liabilities, losses, costs, damages and expenses, including costs of investigation, court costs, reasonable attorneys' fees, to which any of them may become subject arising from or in any manner connected with, directly or indirectly, any material misstatement, error or omission in any representation or warranty of Amgen contained in this Agreement (without effect upon Amgen's liability under the various instruments and documents to be executed in connection herewith). Kirin agrees to indemnify Amgen, Corporation and their respective directors, officers, employees and agents, to the same extent that Kirin is being indemnified pursuant to the immediately preceding section.
The Party seeking indemnification hereunder ("Indemnified Party") shall give written notice to the indemnifying party or parties ("Indemnifying Party") of its indemnification claims hereunder, specifying the amount and nature of the claim, and giving the Indemnifying Party the right to contest any such claim represented by counsel of its choice; if any such claim is made hereunder by the Indemnified Party and such claim arises from the claims of a third party against the Indemnified Party and the Indemnifying Party does not elect to undertake the defense thereof by written notice within fifteen (15) days after receipt of the original notice from the Indemnified Party, the Indemnified Party shall be entitled to indemnity pursuant to the
terms of this Agreement to the extent of its payment in respect of such claim. To the extent that the Indemnifying Party undertakes the defense of such claim in good faith by proceeding diligently at its expense, and without materially impairing the financial conditions or operations of the Indemnified Party, the Indemnified Party shall be entitled to indemnity hereunder only if, and to the extent that, such defense is unsuccessful as determined by a final judgment of a court of competent jurisdiction or is settled with the consent of the Indemnifying Party. The Party defending a third party claim shall have the right to choose its own counsel.
Each of the Parties represents and warrants that it has dealt with no broker or finder in connection with any of the transactions contemplated by this Agreement, and, insofar as it knows, no broker or other person is entitled to any commission or finder's fee in connection with any of these transactions. The Parties hereto each agree to indemnify and hold harmless one another against any loss, liability, damage, cost, claim, or expense, including reasonable attorneys' fees, incurred by reason of any brokerage, commission, or finder's fee alleged to be payable because of any act, omission, or statement of the Indemnifying Party.
Corporation shall be managed by a Board of Directors consisting initially of six (6) members. Kirin and Amgen shall each have the right to nominate three (3) members of the Board of Directors. In the event of a default in the payment of any additional capital contribution, as described in Paragraph 2.15 above, the authorized number of members of the Board of Directors shall be increased to seven (7) and four (4) of such members shall be nominees of the non-defaulting party. The number of members of the Board of Directors cannot be decreased or otherwise increased without the mutual written consent of Kirin and Amgen. All actions by the Board of Directors shall require the affirmative vote of a majority of the total members of Board of Directors at a meeting at which a quorum is present, except for such actions as to which a higher than majority vote is required pursuant to the provisions of this Agreement, the Articles, the Bylaws or applicable law.
Corporation shall have a Chairman of the Board, a President, Vice President - Amgen, Vice President - Kirin, a Secretary, an Assistant Secretary, a Chief Financial Officer and such other officers with such titles and duties as the Board of Directors may determine. Any two or more offices may be held by
the same person. The Chairman of the Board, the Vice President - Kirin, the Chief Financial Officer and the Assistant Secretary shall be nominees of Kirin. The President, the Vice President - Amgen and the Secretary shall be nominees of Amgen.
In addition to any other items referred to in this Agreement requiring consent of both of Kirin and Amgen, none of the following actions shall be permitted to be taken by Corporation unless it shall have obtained the consent of both Kirin and Amgen:
(i) The entry by Corporation into any business outside the Field of Activity;
(ii) Any lending or borrowing of money by Corporation;
(iii) The acquisition, mortgage, pledge, sale, assignment, transfer, or other disposition of any property of Corporation having a fair market value in excess of ONE HUNDRED THOUSAND DOLLARS (US $100,000.00) by Corporation (other than in connection with the sale of products and services in the ordinary course of its business) or of any interest (regardless of value) in the legal or beneficial ownership of any other corporation or enterprise;
(iv) The adoption of a business plan, annual capital, operating and development plans and budgets,
including any material modification thereof pursuant to Paragraph 12.07 below ("Business Documents");
(v) Any capital expenditure in excess of ONE HUNDRED THOUSAND DOLLARS (US $100,000.00) by Corporation; and
(vi) Any material act in material contravention of this Agreement.
Kirin and Amgen shall cause the management of Corporation to conduct the business of Corporation at all times in accordance with high standards of business ethics and to maintain Corporation's accounts in accordance with generally accepted accounting principles consistently applied and, specifically, to:
(i) Maintain full and accurate books, records, and accounts which shall, in reasonable detail, accurately and fairly reflect all transactions of Corporation; and
(ii) Devise and maintain a system of internal accounting controls sufficient to provide reasonable assurances that (a) transactions are executed in accordance with general or specific authorizations, and (b) transactions are recorded as necessary to permit preparation of financial statements in conformity with generally accepted accounting principles, all tax returns and to maintain accountability for assets.
Kirin and Amgen shall cause the management of Corporation to:
(i) Present Business Documents to the Board of Directors and Kirin and Amgen for approval;
(ii) Make available to all members of the Board of Directors together with Kirin and Amgen on a regular basis, and as reasonably requested, all such information and/or documents as may be required to permit the Board of Directors and/or Kirin and Amgen, as the case may be, to make informed judgments with respect to such Business Documents and all other matters of interest to them;
(iii) Prior to March 15 of each Corporate Year, provide to Kirin and Amgen regular annual audited financial statements by Corporation's independent certified public accountants which shall include a statement of profits and losses, changes in financial position and a balance sheet for the year then ended, and including such other appropriate financial information reasonably requested by the Parties; and
(iv) Cause to be prepared all federal, state and local tax returns of Corporation ("Returns").
All funds of Corporation shall be deposited in the name of Corporation in such bank account or accounts as shall be determined by mutual agreement of Kirin and Amgen. All withdrawals therefrom shall be made upon checks signed on behalf of Corporation by any one officer, except for (i) amounts in excess of FIVE THOUSAND DOLLARS (US $5,000.00), and (ii) any payments to be made to Kirin and/or Amgen, in which case all such checks shall require the signature of one (1) Kirin officer and one (1) Amgen officer. The Parties hereto shall not make deposits in or issue any checks against the Corporation bank account(s) without full, proper and complete supporting records.
Kirin and Amgen agree to cause Corporation at all times to be conducted as an independent enterprise for profit. Except as otherwise provided herein, all commercial transactions between Corporation and Kirin and/or Amgen (or their affiliates) shall be conducted on an arm's-length basis with neither granting to the other terms or conditions more favorable than would be accorded non-related third-parties, except as Kirin and Amgen may otherwise mutually agree prior to such transaction.
The officers and directors of Corporation will serve in their respective positions for no compensation or remuneration whatsoever.
Kirin, Amgen, the officers and members of the Board of Directors of Corporation shall all have the fiduciary responsibility for the safekeeping and use of all funds and assets (including records) of Corporation, whether or not in immediate possession or control, for the exclusive benefit of Corporation and its shareholders.
Kirin and Amgen may engage in or possess an interest in other business ventures of any nature or description, independently or with others, whether presently existing or hereafter created, other than for the purpose of development, manufacture, production and sale of EPO Products.
Kirin and Amgen agree that, except as specifically authorized by the respective License Agreements, they shall not, directly or indirectly, nor shall they permit any of their respective subsidiaries or affiliates, as applicable, to engage in any business of a substantially similar nature to the business of Corporation in the Field of Activity for a period of twenty (20) years from and after the Closing Date, anywhere throughout the world, it being acknowledged that the business of Corporation shall be worldwide.
As more fully set forth in those certain License Agreements, Kirin and Amgen agree that:
(i) Kirin will have an exclusive right to manufacture and sell EPO Products in the Field of Activity in the territory composed of the country of Japan ("Kirin Territory") pursuant to the Kirin License Agreement and in no other territory without the prior written consent of Amgen and Corporation.
(ii) Amgen will have an exclusive right to manufacture and sell
EPO Products in the Field of Activity in the territory composed of the fifty
(50) states of the United States of America, including the District of Columbia
and U.S. territories and possessions ("Amgen Territory") pursuant to the Amgen
License Agreement and in no other territory without the prior written consent of
Kirin and Corporation.
(iii) The Parties agree that Corporation may license one (1) other entity in addition to Kirin and Amgen for the manufacture of EPO Products in the Field of Activity outside of the Amgen Territory and Kirin Territory and may license other entities in addition to Kirin and Amgen for the marketing of EPO Products in the Field of Activity outside of the Amgen Territory and Kirin Territory (that area of the world outside of the Amgen Territory and Kirin Territory is herein referred to as
"Corporation Territory"); provided, however, that the Parties may mutually agree to amend this Agreement and the appropriate License Agreement at any time to permit Kirin and/or Amgen to manufacture and sell EPO Products in the Field of Activity in parts of Corporation Territory. The rights of Corporation to grant further licenses as set forth above shall not be diminished thereafter with respect to the remainder of Corporation Territory.
As more fully set forth in the Development and Supply Agreement, Kirin and Amgen agree to conduct on behalf of Corporation, on an accelerated and coordinated basis, development, toxicology, dosage studies, pre-clinical studies, clinical trials and/or product registration for the purpose of securing all approvals (governmental or otherwise) necessary for Kirin and Amgen to engage in the Field of Activity and manufacture and sell EPO Products in their respective territories. Corporation will retain responsibility for (and with the consent of both Kirin and Amgen may enter into agreements similar to those contemplated hereunder) the conduct of toxicology, dosage studies, pre-clinical studies, clinical trials and product registration for the purpose of securing all approvals (governmental or otherwise) necessary for Corporation to engage in the Field of Activity and manufacture and sell EPO Products in the Corporation Territory.
As more fully set forth in those certain Service Agreements, Kirin and Amgen agree that each will provide certain services to Corporation in order to promote the business of Corporation in the Field of Activity.
Corporation will be owned on the Closing Date by two (2) entities which have the compatability and financial stability which are major elements contributing toward the prospect of the future success of Corporation. Except in accordance with the terms of this Agreement, neither Kirin nor Amgen shall sell, transfer, assign, pledge, hypothecate or in any other way dispose of or encumber, voluntarily or involuntarily, by bankruptcy, operation of law or otherwise (any such event is referred to as a "Transfer") any of its shares or any right or interest therein without the prior written consent of the other ("Nontransferring Shareholder"). Unless such prior written consent is given, the proposed transfer may not take place, and any attempted Transfer in derogation hereof shall be deemed null and void. If for any reason any clause or provision of this Paragraph 14.01 should be held unenforceable, invalid or in violation of law by any court or tribunal, then the Nontransferring Shareholder shall have the
right, exercisable in writing within ninety (90) days of the date of final determination of invalidity or unenforceability, to purchase all of the shares of the transferring shareholder pursuant to the terms of Paragraph 14.03 below which such transferring shareholder purported to Transfer.
Upon the occurrence of any of the following events with respect to
Kirin or Amgen ("Occurrence Shareholder") (wherein there is not a continuity of
proprietary interest of the Shareholders of Kirin or Amgen who owned shares of
Kirin or Amgen, as the case may be, prior to the occurrence of such an event):
(i) any transfer of substantially all of its assets, (ii) any transfer of more
than fifty percent (50%) of the duly issued and outstanding stock, (iii) a
liquidation, dissolution, merger, consolidation or reorganization, or (iv) any
insolvency or bankruptcy proceeding, the Party which is not involved with such
an occurrence, shall have the right, exercisable in writing within sixty (60)
days after the later of (a) receipt of written notice of such occurrence, or (b)
the conclusion of the appraisal contemplated in Paragraph 14.03 below, to
purchase all of the shareholding interest in Corporation which is held directly
or indirectly by the Occurrence Shareholder pursuant to the terms of Paragraph
14.03 below. The Occurrence Shareholder shall notify the other Party in writing
of any occurrence described above in this Paragraph 14.02 at the very earliest
time practicable.
For purposes of Paragraphs 14.01 and 14.02 above, the purchase price to be paid for each share of the Transferring or Occurrence Shareholder shall be computed as follows:
(ii) After the occurrence of the Conversion Event, and within
sixty (60) days after the occurrence of an event described in Paragraphs 14.01
or 14.02 above, Kirin and Amgen either (a) shall jointly appoint an investment
banking firm, or (b) failing this joint action, each separately shall designate
an investment banking firm and, within thirty (30) days after their appointment,
the designated investment banking firms shall designate an investment banking
firm which shall make the final determination of value ("Neutral Investment
Banker"). The failure by either Kirin or Amgen to appoint an investment banking
firm within the time allowed shall be deemed equivalent to appointing the other
Party's investment banking firm as the Neutral Investment Banker. Within sixty
(60) days after the
appointment of the Neutral Investment Banker, the Neutral Investment Banker shall render its appraisal of the fair market value of shares being purchased, which appraisal shall be binding and conclusive. Corporation shall bear all appraisal expenses.
(iii) The payment date of the purchase price pursuant to this Paragraph 14 shall not be later than sixty (60) days after the sixty (60) day period set forth in Paragraph 14.02 above.
Any purchase of shares pursuant to this Agreement shall take place on the payment date thereof. The certificates representing all of the shares so purchased shall be duly endorsed and delivered to the purchaser(s) thereof on the payment date.
In the event Kirin and/or Amgen acquire any additional shares of Corporation, then any and all such shares shall be subject to the terms and provisions of this Agreement.
Upon the execution of this Agreement, the certificates of stock subject hereto shall be endorsed to read as follows:
"Any sale, assignment, transfer, pledge, bequest or other disposition of the shares of stock represented by this Certificate is restricted by and subject to the terms and provisions of a Shareholders' Agreement dated May 11, 1984 by and among this Corporation, Kirin and Amgen, a copy of which Agreement is on file in the principal office of this Corporation, which Agreement may from time to time hereafter be amended. The shares of stock evidenced by this Certificate have not been registered with the Securities and Exchange Commission, but have been issued pursuant to the private offering exemption under the Securities Act of 1933, as amended." All certificates of stock hereafter issued to or transferred to Kirin and Amgen shall bear the same endorsement.
17. [INTENTIONALLY OMITTED]
Kirin and Amgen shall each bear and pay for their respective costs and expenses regarding the negotiation and preparation of this Agreement and all documents, instruments and agreements related thereto. The actual out-of-pocket cost to form Corporation shall be reimbursed by Corporation to Musick, Peeler &
Garrett promptly after the Closing Date. Costs and expenses incurred by Corporation after the Closing Date shall be paid by Corporation.
The Parties hereby agree that any Technical Data (as that term is defined in Section 379.1 of the U.S. Export Administration Regulations) exported from the United States pursuant to this Agreement and any other related agreements, and any direct product thereof, shall not be shipped, either directly or indirectly, to Afghanistan or any Group P, Q, S, W, Y or Z Countries (as specified in Supplement No. 1 to Part 370 of the Export Administration Regulations), unless (i) separate specific authorization to reexport such Technical Data or such direct products is provided by the U.S. Office of Export Administration or (ii) such specific authorization is not required pursuant to Part 379.8 of the U.S. Export Administration Regulations. The Parties further agree that the export and reexport of commodities pursuant to this Agreement and any other related agreements shall be subject to the licensing requirements of the U.S. Export Regulations.
In the event that a specific authorization of, or a validated license from, a government other than that of the
exporting party is required, Kirin and Amgen each agree that the Party, including (if applicable) Corporation, within the jurisdiction of such other government shall, upon the request of the Party proposing to make the export, use its best efforts to obtain, as expeditiously as applicable, the requisite authorization or license.
Subject to the terms of Paragraph 21 below, and upon the mutual consent of Kirin and Amgen, distributions (as defined in Section 166 of the California Corporate Securities Act of 1968, as amended) of cash shall be made to Kirin and Amgen in accordance with their respective aggregate capital contributions.
(i) Corporation shall be dissolved upon the mutual written consent of Kirin and Amgen. (ii) Kirin shall have the unilateral right to cause Corporation to be dissolved if the Conversion Event does not take place on or before December 31, 1985. (iii) Corporation may be dissolved for federal and California income tax purposes, but preserved in nominal form for California state law purposes, by either Kirin or Amgen upon the
bankruptcy, receivership or insolvency of the other Party or Corporation, or upon the material breach of this Agreement by the other Party.
Upon the dissolution of Corporation, a complete and accurate accounting shall be made by Corporation's independent certified public accountants from the date of the last previous accounting to the date of dissolution and all required tax returns shall be timely filed in connection therewith.
Upon the dissolution of Corporation, Kirin and Amgen shall each appoint three (3) individuals who shall jointly act as liquidator to wind up Corporation (collectively "Liquidator"). The Liquidator shall have full power and authority to take full account of Corporation's assets and liabilities and to wind up and liquidate the affairs of Corporation in an orderly and business- like manner as is consistent with obtaining the fair value thereof upon dissolution. Corporation shall engage in no further business thereafter other than as necessary to operate on an interim basis, collect its receivables, pay its liabilities and liquidate its assets. All proceeds from liquidation shall be distributed in the following order of priority: (i) first, to the payment of all creditors of Corporation and the expenses of liquidation; (ii) second, to the establishing of a reserve which the Liquidator deems reasonably necessary for any contingent,
known or unforeseen liabilities or obligations of Corporation; and (iii) third, the balance:
(a) If prior to the occurrence of the Conversion Event, first to Kirin an amount of cash equal to the original price paid to Corporation for its shares upon initial issuance, i.e., ONE DOLLAR (US $1.00) per share, plus three-fourths (3/4ths) of the aggregate interest income earned by Corporation from the Closing Date to the date of such liquidation distribution. Kirin and Amgen agree that Corporation shall not spend more than FOUR MILLION DOLLARS (US $4,000,000.00) prior to the occurrence of the Conversion Event, unless otherwise mutually agreed to in writing.
(b) If after the occurrence of the Conversion Event, Corporation's net assets shall be valued in accordance with the appraisal mechanism set forth in Paragraph 14.03(ii) above. Thereafter, the net assets of Corporation shall be divided between Kirin and Amgen in approximately equal value at the direction of the Neutral Investment Banker.
Upon the completion of the distributions in liquidation of Corporation as provided in this Paragraph 21, Liquidator shall cause the cancellation of all share certificates and shall take such other actions as may be appropriate to finally dissolve and liquidate Corporation.
All notices, requests, demands and other communications required or permitted to be given under this Agreement shall be in writing and shall be mailed to the Party to whom notice is to be given, by telex or facsimile, and confirmed by first class mail, registered or certified, return receipt requested, postage prepaid, and properly addressed as follows (in which case such notice shall be deemed to have been duly given on the third (3rd) day following the date of such sending):
"Kirin" Kirin Brewery Company, Limited
26-1, Jingumae 6-Chome
Shibuya-Ko, Tokyo 150
Japan
Telex No. 242-5401 Kirin B J
Attn: General Manager of R&D Department
With a copy to: Musick, Peeler & Garrett
One Wilshire Boulevard
Suite 2000
Los Angeles, CA 90017
U.S.A.
Telex No. 701357 (MPG LAW UD)
Attn: Joel S. Marcus, Esq.
"Amgen" Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
-48-
|
With a copy to: Cooley, Godward, Castro,
Huddleson & Tatum
One Maritime Plaza, 20th Floor
San Francisco, CA 94111
U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
"Corporation" Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Musick, Peeler & Garrett
One Wilshire Boulevard
Suite 2000
Los Angeles, CA 90017
U.S.A.
Telex No. 701357 (MPG LAW UD)
Attn: Joel S. Marcus, Esq.
|
Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 22.01.
All notices to third parties and all other publicity concerning the transactions contemplated by this agreement shall be jointly planned and coordinated by and between the Parties hereto.
This Agreement (together with all Exhibits attached hereto and all documents and instruments delivered in connection
herewith) constitutes the full and complete agreement and understanding between the Parties hereto and shall supersede any and all prior written and oral agreements concerning the subject matter contained herein. This Agreement may not be modified, amended nor may any provision hereof be waived without a written instrument executed by Kirin, Amgen and Corporation.
No failure or delay by any Party to insist upon the strict performance of any term, condition, covenant or agreement of this Agreement, or to exercise any right, power or remedy hereunder or thereunder or consequent upon a breach hereof or thereof shall constitute a waiver of any such term, condition, covenant, agreement, right, power or remedy or of any such breach or preclude such Party from exercising any such right, power or remedy at any later time or times.
The shares of stock of Corporation are unique and cannot be readily purchased or sold in the open market. For this reason, among others, the Parties hereto will be irreparably damaged in the event that this Agreement is not deemed to be specifically enforceable, and the Parties hereby agree that this Agreement shall be specifically enforceable. Such remedy shall be cumulative and not exclusive and shall be in addition to any other remedy which the Parties may have.
No right, power or remedy herein conferred upon or reserved to any Party is intended to be exclusive of any other right, power or remedy or remedies, and each and every right, power and remedy of any Party pursuant to this Agreement or now or hereafter existing at law or in equity or by statute or otherwise shall to the extent permitted by law be cumulative and concurrent, and shall be in addition to every other right, power or remedy pursuant to this Agreement, or now or hereafter existing at law or in equity or by statute or otherwise and the exercise or beginning of the exercise by any Party of any one or more of such rights, powers or remedies shall not preclude the simultaneous or later exercise by any Party of any or all such other rights, powers or remedies.
Headings in this Agreement are included herein for the convenience of reference only and shall not constitute a part of this Agreement for any purpose.
Any provision of this Agreement which is prohibited or unenforceable in any jurisdiction shall as to such jurisdiction be ineffective to the extent of such prohibition or unenforceability without invalidating the remaining provisions hereof or effecting the validity or enforceability of such provision in any other jurisdiction.
In the event of any action at law or in equity between the Parties hereto to enforce any of the provisions hereof, the unsuccessful party or parties to such litigation shall pay to the successful party or parties all costs and expenses, including actual attorneys' fees, incurred therein by such successful party or parties; and if such successful party or parties shall recover judgment in any such action or proceeding, such costs, expenses and attorneys' fees may be included in and as part of such judgment. The successful party shall be the party who is entitled to recover his costs of suit, whether or not the suit proceeds to final judgment. A party not entitled to recover his costs shall not recover attorneys' fees.
This Agreement shall be construed in accordance with the internal laws, and not the law of conflicts, of the State of California applicable to agreements made and to be performed in such state.
This Agreement shall be binding upon and inure to the benefit of the Parties hereto, their successors and assigns.
All exhibits attached hereto and referred to herein are hereby incorporated herein as though fully set forth at length.
Words in the singular shall include the plural, and words in a particular gender shall include either or both additional genders, when the context in which such words are used indicates that such is the intent.
This Agreement may be executed in one or more counterparts by the Parties hereto. All counterparts shall be construed together and shall constitute one agreement.
Each Party agrees to perform any further acts and execute and deliver any and all further documents and/or instruments which may be reasonably necessary to carry out the provisions of this Agreement and to carry out the business purpose of Corporation.
Each of the Parties hereto acknowledges and agrees (i) that no representation or promise not expressly contained in this Agreement has been made by any other Party hereto or by any of his or its agents, employees, representatives or attorneys; (ii) that this Agreement is not being entered into on the basis of, or in reliance on, any promise or representation, expressed or implied, covering the subject matter hereof, other than those which are set forth expressly in this Agreement; and (iii) that each has had the opportunity to be represented by counsel of its own choice in this matter, including the negotiations which preceded the execution of this Agreement.
Any Party shall be excused for failures and delays in performance of its respective obligations under this Agreement caused by war, riots or insurrections, laws and regulations (including, without limitation, imposition of export restrictions or controls), strikes, floods, fires, explosions or other catastrophes beyond the control and without the fault of such Party. This provision shall not, however, release such Party from using its best efforts to avoid or remove such cause and such Party shall continue performance hereunder with the utmost dispatch whenever such causes are removed. Upon claiming any such excuse
or delay for non-performance, such Party shall give prompt written notice thereof to the other Party.
The Parties contemplate that there may be additional opportunities for mutual development of other products or areas of interest by Corporation. At any time either Amgen or Kirin may suggest that such other opportunities be further discussed.
IN WITNESS WHEREOF, the undersigned have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding upon them.
KIRIN BREWERY COMPANY, LIMITED, a
Japanese corporation
By /s/ Shinkichi Kubo
Shinkichi Kubo
Its Managing Director
|
AMGEN, a California corporation
By /s/ George B. Rathmann
George B. Rathmann
Its President
|
KIRIN-AMGEN, INC., a California corporation
By Its
EXHIBIT SCHEDULE
----------------
EXHIBIT DESCRIPTION PARAGRAPH
A Transferred Technology........................ 1.05
B Assignment and License Agreement.............. 1.05
C Development and
Supply Agreement............................ 1.09
D Articles of Incorporation..................... 2.04
E Bylaws of Corporation......................... 2.05
F Legal Conflicts Letter........................ 2.09
G Arthur Young and Company
Engagement Letter............................. 2.10
H Kirin/Kirin-Amgen, Inc
Services Agreement.......................... 8.03.6
I Amgen/Kirin-Amgen, Inc
Services Agreement.......................... 8.03.6
J Kirin/Kirin-Amgen, Inc
License Agreement........................... 8.03.7
K -- Amgen/Kirin-Amgen, Inc
License Agreement........................... 8.03.8
|
The Transferred Technology is embodied in at least the following documents:
(1) The ASSIGNMENT relating to U.S. Patent Application Ser. No. 561.024, filed December 13, 1983, entitled "Recombinant Methods and Materials Applied to Microbial Expression of Erythropoietin", recorded in the Patent and Trademark Office on Reel 4217, Frame 916. [And related know-how]
(2) The ASSIGNMENT relating to U.S. Patent Application Ser. No. 463.724, filed February 4, 1983, entitled "ATCC HB8209 and Its Monoclonal Antibody to Erythropoietin", recorded in the Patent and Trademark office on Reel 4110, Frame 763. [And related know-how]
[Full Description]
EXHIBIT "A"
THIS ASSIGNMENT AND LICENSE AGREEMENT ("Agreement") is made this day of , 1984, by and between AMGEN, a California corporation ("Amgen"), in favor and for the benefit of, and with KIRIN-AMGEN, INC., a California corporation ("Company") pursuant to to terms and conditions of that certain Shareholders' Agreement, dated May 11, 1984, by and among Amgen, Company and Kirin Brewery Company, Ltd., a Japanese corporation ("Shareholders' Agreement").
WHEREAS, Amgen, Kirin and the Company have entered into the Shareholders' Agreement with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);
WHEREAS, in connection with the formation of the Company and the issuance of certain Common Stock of the Company to Amgen under Section 351 of the Internal Revenue Code of 1954, as amended, Amgen is willing to transfer certain technology (the "Transferred Technology", as hereinafter defined) to the Company and license certain other technology (the "Core Technology", as
EXHIBIT "B"
hereinafter defined) to the Company for use in the Field of Activity, as hereinafter defined, all in accordance with the Shareholders' Agreement;
NOW, THEREFORE, in partial consideration (along with cash payable by Amgen to the Company) of the sale and issuance to Amgen of twelve million (12,000,000) shares of Common Stock of the Company pursuant to the Shareholders' Agreement, Amgen and the Company hereby agree as follows:
defined below, solely with respect to its direct application to the Field of Activity.
to Amgen, retroactive to such termination, any sublicenses granted hereunder by the Company to any subsidiary of the Company. The Company shall include in all its sublicenses granted hereunder to any subsidiary of the Company provisions for such termination and assignment.
authorize, cause or aid anyone else to do so. Except as provided in Section 1.03 above, nothing in this Agreement shall be deemed to give the Company any right or license to use or to replicate or reproduce any of the Core Technology owned by Amgen, or to authorize, aid, or cause others so to do.
and effect until the earlier of (a) the liquidation or dissolution of the Company, or (b) termination pursuant to Section 7.02.
survive such termination and continue in full force and effect for an indefinite term. Upon termination of this Agreement for any reason, and without limitation of other remedies, the Company shall immediately return to Amgen (to the extent such return is technically feasible) all materials relating to the Core Technology in the possession of the Company or its subsidiaries, or of which the Company shall have the right to regain possession or, at the sole election of Amgen, shall destroy such material (to the extent technically feasible).
Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
Attn: Corporate Secretary
With a copy to: Musick, Peeler & Garrett
One Wilshire Boulevard, Suite 2000
Los Angeles, CA 90017
Attn: Joel S. Marcus, Esq.
|
10.02 Amgen Notice. All notices to Amgen under this Agreement shall be in writing and sent to:
Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
Attn: Corporate Secretary
With a copy to: Alan C. Mendelson, Esq.
Cooley, Godward, Castro,
Huddleson & Tatum
5 Palo Alto Square
Suite 400
Palo Alto, CA 94306
10.03 Changes. The addresses given above may be changed by notice as
specified above.
10.04 Notice Deemed Given. Notices required or permitted hereunder
-------------------
|
and sent as specified above shall be deemed given (a) immediately upon personal delivery, (b) one (1) busi-
ness day after notice given by telegram or telex, and (c) ten (10) business days after the date of posting notice, sent by registered or certified mail.
frustrated by Force Majeure. The party so affected shall give notice to the other party in writing promptly and thereupon shall be excused from such of its obligations hereunder as it is unable to perform on account of the Force Majeure throughout the duration thereof plus a period of thirty (30) days.
other or further exercise thereof or the exercise of any other right, power or remedy hereunder or the remedies provided by law.
IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their duly authorized represent-
atives in the manner legally binding on them as of the date first above written.
AMGEN, a California corporation
By
Its
KIRIN-AMGEN, INC., a California corporation
By
Its
TRANSFERRED TECHNOLOGY
Schedule "A"
THIS DEVELOPMENT AND SUPPLY AGREEMENT ("Agreement") is made this - day of -, 1984, by and among AMGEN, a California corporation, ("Amgen"), KIRIN BREWERY COMPANY, LTD., a Japanese corporation, ("Kirin"), and KIRIN-AMGEN, INC., a California corporation ("Company").
WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984 ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).
WHEREAS, Amgen has assigned to the Company, perpetually and irrevocably, certain current proprietary technology possessed by Amgen relating specifically to EPO;
EXHIBIT "C"
WHEREAS, the Company desires to have Amgen and Kirin conduct further development work with respect to the improvement and commercial development of the EPO Technology, as hereinafter defined, and Amgen and Kirin desire to conduct such development work;
WHEREAS, Amgen's and Kirin's research and development work within and without the Development Program (as hereinafter defined) may provide certain EPO Technology as hereinafter defined, relating to and useful in the Field of Activity;
WHEREAS, Amgen, Kirin and the Company wish to provide for a means by which they can jointly utilize the fruits of their activities in the Field of Activity;
WHEREAS, the work to be conducted hereunder may require materials, including the EPO Organisms (as hereinafter defined), which may be developed or have previously been developed by Amgen, and Amgen is willing to furnish such materials to the Company, the Company is willing to furnish such materials to Kirin, and the Company and Kirin desire to receive such materials.
NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:
ARTICLE I
ARTICLE II
(a) Amgen and Kirin hereby agree to conduct on behalf of the Company, on an accelerated and coordinated basis, development, toxicology, dosage studies, pre-clinical studies, clinical trials and product registration for the purpose of securing all approvals (governmental or otherwise) necessary for the Parties to engage in the Field of Activity and manufacture and sell EPO in their respective Territories, as defined in the Shareholders' Agreement. During the Term of Support, Amgen and
Kirin shall each make reasonably available to the Company its technical personnel and facilities required to perform such scientific and development projects relating to the Field of Activity as the Company requests and as Amgen and Kirin may agree from time to time. Amgen and Kirin may each have others perform or assist in performing the work under the Development Program; provided, however, that Amgen and Kirin shall cause such other parties to be bound by all the provisions hereof as if they were parties hereto.
(b) Amgen hereby agrees to use its best efforts to complete, as part of the Development Program, the development of commercial manufacturing scale production of EPO in one Expression System; provided, however, that Amgen may conduct work as part of the Development Program on the development of more than one of such Expression Systems and shall be compensated by the Company for all such work hereunder.
(c) Compensation for development work to be performed by Amgen shall be paid in accordance with the provisions of-Section 2.03 hereof.
(d) Notwithstanding the foregoing, no research performed by Amgen in developing the EPO Organisms shall be considered to be part of, or be compensated under, the Development Program pursuant to this Agreement, unless otherwise mutually agreed by Amgen and Kirin.
agreed to. Amgen and Kirin shall each prepare and supply to the Company written progress reports at the end of each three (3) month period. Each Party shall consult with the other Parties from time to time on the progress of the development projects and shall permit any other Party to visit its laboratories to observe the development work, to the extent reasonably required to coordinate and effectively conduct related development work. The Development Program shall initially be conducted with respect to the Field of Activity; provided, however, that the Parties may mutually agree upon additional activities and projects to be carried out in the Development Program.
commencing January 1, 1985 not later than the 31st day of January of each such year. At the end of each calendar month Amgen and Kirin shall each submit a written statement to the Company setting forth the number of man hours of work performed by such Party during such calendar month. Upon receipt of such statement and after-a reasonable period to allow for review thereof, the Company shall promptly pay Amgen and Kirin an amount equal to the total costs incurred by such Party in conducting the development projects for such month. Amgen and Kirin shall keep correct and complete records containing all information required for deter mination of costs to be paid hereunder for periods of not less than three (3) years and shall permit such books and records to be inspected and audited during reasonable business hours by a certified public accountant selected by the Company, to the extent necessary to verify such report. The Parties hereby acknowledge that any such work under the Development Program to be performed by Amgen and Kirin, respectively, for the Company shall be as independent contractors, and the Company shall not incur any direct obligations for the remuneration or other expenses (and relevant reporting obligations) of any employee of Amgen or Kirin by virtue of such employee's participation in the Development Program.
(a) For purposes of advancing the Development Program, Amgen and Kirin shall disclose to each other and the Company such of their respective information, including that on
inventions, relative to the Field of Activity (whether or not previously assigned or licensed to the Company by any Party hereunder and therefore already included as part of the EPO Technology) and available prior to the undertaking hereunder of the Development Program, as the disclosing Party in its reasonable discretion believes will be useful in furtherance of the Development Program and which it has the right to disclose. To further promote the purposes of the Development Program, each Party shall actively collaborate with the other Parties by disclosing to all other Parties on a regular and periodic basis such technical and other information developed by such Party as may be included in the definition of EPO Technology hereunder and the Company authorizes such disclosure amongst the Parties hereunder without regard to the restrictions on such disclosure which may otherwise be imposed by the License Agreements and this Agreement. In order to further facilitate the effective commercial development, registration, manufacture and marketing of EPO within the Field of Activity, the Parties shall permit representatives of any other Party to inspect its facilities and all technical reports, memoranda and other documents directly relating to the Development Program, and to make copies of any and all such reports, memoranda and other documents; provided, however, that the rights hereunder shall not extend beyond the EPO Technology and shall be limited solely to such information that has been actually used by a Party for the production and further development of EPO. Each of Amgen and Kirin acknowledge
that any such technical and other information disclosed hereunder shall be included in the definition of EPO Technology and agree that any such technical and other information so received shall not otherwise be disclosed except as permitted by this Agreement or the aforementioned License Agreements.
(b) Upon commencement of the Development Program, Amgen agrees to supply Kirin and the Company with sufficient technical information and assistance to (i) assess the progress of its product and process development work during the course of the Development Program, and (ii) instruct and assist Kirin in utilizing its rights in the EPO Technology, and the Parties shall establish mutually agreeable development milestones which shall be reviewed no less frequently than annually during the term of the Development Program. Any technical information supplied by any Party to another hereunder shall remain confidential and shall thereafter be deemed EPO Technology for purposes hereof.
(a) Amgen shall furnish to Kirin at Kirin's request the services of personnel of Amgen or its agents, hereinafter in this Section 2.06 referred to Amgen's "personnel", to give technical assistance and information for the start-up of a manufacturing facility for EPO. Such facility shall be constructed and said EPO shall be manufactured by Kirin with the use of EPO Technology furnished to Kirin hereunder and the use of which is authorized hereunder. It will be Kirin's responsibility to provide Amgen's personnel with suitable working quarters and
adequate clerical and other assistance in order to facilitate the performance of their services.
(b) Such service shall be available to Kirin at reasonable locations and times and for reasonable intervals agreeable to Amgen.
(c) Amgen shall without charge and in addition to the provisions set forth above, provide training, relating to the subject hereof, at Amgen's plant to personnel of Kirin, at Kirin's request. Such training shall be available to Kirin, at reasonable times, and for reasonable intervals, agreeable to Amgen.
(d) Promptly after the date of this Agreement, Amgen and Kirin shall each appoint an employee to administer activities and performance under this Section 2.05 and will notify each other of the name, address and telephone number of such employee. All requests for services under this Section 2.05 and arrangements for providing services will be coordinated by such appointed employees.
(e) Amgen and Kirin shall at all times retain the administrative supervision of their respective personnel.
(f) Kirin shall pay to Amgen for the work performed pursuant to Sections 2.04 (b) and this Section 2.05, including travel time outside of the Continental United States, at the rate determined in accordance with the provisions of Section 2.03 hereof. Kirin shall also reimburse Amgen for actual
expenditures for travel, living and other expenses incurred by Amgen's personnel performing services under Section 2.04 (b) and this Section 2.05(f). Amgen shall render to Kirin invoices for all payments to be made under this Section 2.05, and Kirin shall make payment of all amounts so billed within thirty (30) days after date of invoice. Any information which may be disclosed to personnel of Kirin by Amgen's personnel in the course of their performance under this Section 2.05 shall be deemed to be EPO Technology furnished to Kirin.
(g) All of Amgen's obligations under this Section 2.05 shall terminate effective with any termination of the rights of Kirin pursuant to Article VI of this Agreement without affecting any of Amgen's obligations under any other Article.
ARTICLE III
connection with the Development Program. All such records shall be available to the Company at all reasonable times for examination and copying at the Company's expense.
(a) was known to the receiving Party at the time of its disclosure and not previously subject to any obligation of confidentiality;
(b) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;
(c) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through
any act or omission of the receiving Party in breach of this Agreement; or
(d) became known to the receiving Party after its disclosure (i) from a source other than the disclosing Party (including from independent development by the receiving Party),
(ii) other than from a third party who had an obligation to the disclosing Party not to disclose such information to others, and
(iii) other than under an obligation of confidentiality.
Each receiving Party may disclose any EPO Technology to the extent such disclosure is necessary to the receiving Party to comply with laws or regulations, or to make, use or sell under any license under such EPO Technology from the disclosing Party or to sublicense others to do so, provided that the Party intending to make any such disclosure shall give the other Parties reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the other parties in writing of the manner in which that was done.
it will use its best efforts to obtain (a) an agreement to disclose and assign to the Company, or its nominee or nominees, without expense to the Company, all inventions made by such employee or agent during the course of his employment or association with the Development Program, and (b) execution, acknowledgment and delivery by such employee or agent of all papers, including applications for patents, that may be necessary to obtain patents for said inventions in any and all countries and to vest title thereto in the Company (and an agreement by such employee or agent to do all acts possible to assist the Company in establishing and enforcing its aforementioned rights to such inventions).
ARTICLE IV
ARTICLE V
ARTICLE VI
within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.
ARTICLE VII
amounts of EPO for its respective use in carrying out the goals and purposes of the Development Program.
(a) The Company may, by letter, telex or other means, deliver to Amgen delivery specifications providing specific information regarding EPO which the Company is interested in obtaining. Each delivery specification shall specify: (1) quantity; (2) requested delivery schedule; (3) packaging and marking requirements; (4) method of shipment; (5) place of delivery and acceptance; and (6) any other information necessary to prepare the proposal.
(b) Amgen shall, and after delivery of each such delivery specification by the Company, furnish the Company with a written proposal providing specific information regarding items which the Company is interested in obtaining. Such proposal shall include: (i) unit and total price or fee for use for items; (ii) delivery schedule; (iii) duration of the proposal; (iv) terms and conditions regarding dissemination and use of the items; and (v) any other information, requested by the Company and deemed essential to the proposal by Amgen. Orders placed pursuant to a proposal are termed "Proposal Orders." Issuance of a Proposal Order by Amgen and receipt by Amgen of written notification of acceptance of the Proposal Order by the Company shall create a binding agreement for furnishing the items specified therein.
(c) On Proposal orders, the charges paid by the Company for items shall be those charges set forth in the proposal under which such order is being placed. Amgen shall exercise reasonable efforts to provide the Company with thirty (30) days advance notice of changes in prices and use fees for items.
(d) Charges quoted pursuant to this Article VII will be in United States dollars and invoices shall be payable in United States currency within thirty (30) days of delivery.
ARTICLE VIII
or tradenames of such Party, or of any of their respective Subsidiaries or affiliated companies.
"Kirin" Kirin Brewery Company, Limited
26-1, Jingumae 6-Chome
Shibuya-Ko, Tokyo 150
Japan
Telex No. 242-5401 Kirin B J
Attn: General Manager of R&D Department
With a copy to: Musick, Peeler & Garrett
One Wilshire Boulevard
Suite 2000
Los Angeles, CA 90017
U.S.A.
Telex No. 701357 (MPG LAW UD)
Attn: Joel S. Marcus, Esq.
-21-
|
"Amgen" Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 499-9315 (AMGEN)
Attn: Corporate Secretary
With a copy to: Cooley, Godward, Castro,
Huddleson & Tatum
One Maritime Plaza, 20th Floor
San Francisco, CA 94111 U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
"Corporation" Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320 U.S.A.
Telex No. 499-9315 (AMGEN)
Attn: Corporate Secretary
With a copy to: Musick, Peeler & Garrett
One Wilshire Boulevard
Suite 2000
Los Angeles, CA 90017
U.S.A.
Telex No. 701357 (MPG LAW UD)
Attn: Joel S. Marcus, Esq.
|
Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 8.08.
be excused from such of its obligations hereunder as it is unable to perform on account of the Force Majeure throughout the duration there-of plus a period of thirty (30) days.
AMGEN
By
President
KIRIN BREWERY COMPANY, LTD.
By
KIRIN-AMGEN, INC.
By
1. A reliable RIA will be established to be used for, but not limited to, preclinical and clinical evaluation of EPO levels in patient's serum. Estimated cost is $200,000. Period 1984.
2. A sufficient quantity of EPO will be purified from urine. This EPO will be used as a standard for RIA, for iodination for the RIA and as reference material for comparison with EPO produced by recombinant DNA techniques. Estimated cost is $200,000. Period 1984.
3. Recombinant EPO will be prepared from mammalian cells, E.coli and yeast. The biological properties of these three preparations will be compared with urinary EPO to determine which system will be used to develop EPO as a therapeutic. Fermentation and purification costs for materials for evaluation will be paid for by the Corporation. Estimated cost is $300,000. Period 1984.
4. Properties of recombinant EPO will be compared with natural material to determine what criteria should be used for specifications of the recombinant therapeutic material. Part of this work will be paid for by the Corporation. Estimated cost is $100,000. Period 1984.
SCHEDULE "A"
5. Research to be carried out to determine feasibility of using antibody affinity columns for EPO purification. Amgen will supply antibody, Kirin will supply urinary EPO and serum, if necessary. Joint venture will pay for labor. Estimated cost is $100,000. Period 1984.
6. Process development for fermentation and purification to commercial levels will be carried out for recombinant EPO produced by E.coli. Estimated cost is $1,000,000. The estimated cost will be modified if yeast or mammalian cells are used as the production system. Period 1984-1985.
7. Studies to be carried out to determine the formulation of the final product. This will include studies on product stability, method of administration, etc. Estimated cost is $600,000. Period 1984-1985.
8. Pre-clinical tests including planning, production of samples, toxicological test and pharmacological tests. Estimated cost is $2,000,000. Period 1984-1986.
9. Clinical trials including planning, filing IND, production of samples, clinical trials, organization of clinical doctors and submission of New Drug Application. Estimated cost is $11,500,000. Period 1984-1987.
10. Phase IV study will be carried out. Cost of this study will be paid for from proceeds of commerical sales. No cost to joint venture.
ARTICLES OF INCORPORATION
OF
KIRIN-AMGEN, INC.
I.
The name of this corporation is KIRIN-AMGEN, INC.
II.
The purpose of this corporation is to engage in any lawful act or
activity for which a corporation may be organized under the General Corporation
Law of California other than the banking business, the trust company business or
the practice of a profession permitted to be incorporated by the California
Corporations Code.
III.
The name and address in the State of California of this corporation's initial agent for service of process is:
Joel S. Marcus, Esq.
Musick, Peeler & Garrett
One Wilshire Boulevard
Suite 2000
Los Angeles, California 90017
IV.
The corporation is authorized to issue two classes of shares: no par value Class A Common Stock and no par value Class B Common Stock designated "Class A Common Stock" and "Class B Common Stock," respectively. The total number of shares of Class A Common Stock which this corporation is authorized to issue is twenty-four million (24,000,000) shares. The total number of shares of Class B Common Stock which this corporation is authorized to issue is twelve million (12,000,000) shares.
V.
The rights, preferences, privileges and restrictions of Class A Common Stock and Class B Common Stock shall be equal and identical in all respects except that:
EXHIBIT "D"
(a) In the event of any voluntary or involuntary liquidation, dissolution or winding up of this corporation, the holder of the issued and outstanding shares of Class B Common Stock shall be entitled to receive from the assets of the corporation, cash equal to one dollar (US $1.00) per share, plus three-quarters (3/4) of the aggregate interest earned by the corporation on such amount from the date of purchase of such shares to the date of liquidation.
(b) The shares of Class B Common Stock shall be converted into shares of Class A Common Stock on a share-forshare basis when the corporation produces biologically active EPO at such levels as are agreed upon by the holders of all of the shares of Class A Common Stock and Class B Common Stock.
VI.
(a) Any of the following actions shall require the prior approval of the holders of all of the shares of Class A Common Stock and Class B Common Stock, notwithstanding that applicable law would otherwise permit such action without such approval:
(i) The entry by the corporation into any business outside the areas of development, manufacture, production and worldwide commercial sale of EPO and EPO pharmaceuticals for human therapeutic use;
(ii) Any lending or borrowing of money by the corporation;
(iii) The acquisition, mortgage, pledge, sale, assignment, transfer, or other disposition of any property of the corporation having a fair market value in excess of one hundred thousand dollars ($100,000) by the corporation (other than in connection with the sale of products and services in the ordinary course of its business) or of any interest (regardless of value) in the legal or beneficial ownership of any other corporation or enterprise;
(iv) The adoption of a business plan, annual capital, operating and development plans, and budgets, including any material modification thereof;
(v) Any capital expenditure in excess of one hundred thousand dollars ($100,000).
(b) All actions of the Board of Directors shall require the affirmative vote of a majority of the authorized
number of Directors, notwithstanding that applicable law would otherwise permit such action without such approval.
Dated: May 11, 1984
/s/ Joel S. Marcus
Incorporator
I hereby declare that I am the person who executed the
foregoing Articles of Incorporation, which execution is my act and deed.
|
/s/ Joel S. Marcus |
BYLAWS
OF
KIRIN-AMGEN, INC.
EXHIBIT "E"
BYLAWS OF KIRIN-AMGEN, INC.
Table of Contents
Page
----
ARTICLE I
OFFICES
Section 1. Principal Office........................................................................... 1
Section 2. Other Offices.............................................................................. 1
ARTICLE II
CORPORATE SEAL
Section 3. Corporate Seal............................................................................. 2
ARTICLE III
SHAREHOLDERS' MEETINGS AND VOTING RIGHTS
Section 4. Place of Meetings.......................................................................... 2
Section 5. Annual Meetings............................................................................ 2
Section 6. Postponement of Annual Meeting............................................................. 3
Section 7. Special Meetings........................................................................... 3
Section 8. Notice of Meetings......................................................................... 4
Section 9. Manner of Giving Notice.................................................................... 7
Section 10. Quorum and Transaction of Business......................................................... 8
Section 11. Adjournment and Notice of
Adjourned Meetings....................................................................... 9
Section 12. Waiver of Notice, Consent to
Meeting or Approval of Minutes........................................................... 10
Section 13. Action by Written Consent
Without a Meeting........................................................................ 11
Section 14. Voting..................................................................................... 13
Section 15. Persons Entitled to Vote or Consent........................................................ 14
Section 16. Proxies.................................................................................... 16
Section 17. Inspectors of Election..................................................................... 16
17
ARTICLE IV
BOARD OF DIRECTORS
Section 18. Powers .................................................................................... 18
Section 19. Number of Directors........................................................................ 19
Section 20. Election of Directors, Term,
Qualifications........................................................................... 19
Section 21. Resignation................................................................................ 20
Section 22. Removal.................................................................................... 20
Section 23. Vacancies.................................................................................. 21
|
Page
----
Section 24. Regular Meetings.................................................................................. 22
Section 25. Participation by Telephone........................................................................ 23
Section 26. Special Meetings.................................................................................. 23
Section 27. Notice of Meetings................................................................................ 23
Section 28. Place of Meetings................................................................................. 24
Section 29. Action by Written Consent
Without a Meeting.............................................................................. 24
Section 30. Quorum and Transaction of Business................................................................ 25
Section 31. Adjournment....................................................................................... 25
Section 32. Organization...................................................................................... 26
Section 33. Compensation...................................................................................... 26
Section 34. Committees........................................................................................ 26
ARTICLE V
OFFICERS
Section 35. Officers.......................................................................................... 27
Section 36. Appointment....................................................................................... 27
Section 37. Inability to Act.................................................................................. 27
Section 38. Resignations...................................................................................... 28
Section 39. Removal........................................................................................... 28
Section 40. Vacancies......................................................................................... 29
Section 41. Chairman of the Board............................................................................. 29
Section 42. President......................................................................................... 29
Section 43. Vice Presidents................................................................................... 30
Section 44. Secretary......................................................................................... 31
Section 45. Chief Financial Officer........................................................................... 32
Section 46. Compensation...................................................................................... 34
ARTICLE VI
CONTRACTS, BANK ACCOUNTS,
CHECKS AND DRAFTS
Section 47. Execution of Contracts and Other
Instruments.................................................................................... 35
Section 48. Bank Accounts..................................................................................... 35
Section 49. Checks, Drafts, Etc............................................................................... 36
ARTICLE VII
CERTIFICATES FOR SHARES AND THEIR TRANSFER
Section 50. Certificate for Shares............................................................................ 37
Section 51. Transfer on the Books............................................................................. 37
Section 52. Lost, Destroyed and Stolen Certificates........................................................... 38
Section 53. Issuance, Transfer and
Registration of Shares......................................................................... 39
|
Page
----
ARTICLE VIII
INSPECTION OF CORPORATE RECORDS
Section 54. Inspection by Directors.......................................................................... 40
Section 55. Inspection by Shareholders....................................................................... 40
Section 56. Written Form..................................................................................... 42
ARTICLE IX
MISCELLANEOUS
Section 57. Fiscal Year...................................................................................... 43
Section 58. Annual Report.................................................................................... 43
Section 59. Record Date...................................................................................... 43
Section 60. Construction and Definition...................................................................... 45
ARTICLE X
INDEMNIFICATION
Section 61. Indemnification of Directors, Officers,
Employees and Other Agents.................................................................... 45
ARTICLE XI
AMENDMENTS
Section 62. Amendments....................................................................................... 51
|
BYLAWS
OF
(A California Corporation)
ARTICLE I
ARTICLE II
ARTICLE III
o'clock a.m. California time, on the fourth Tuesday of March in each year if such date is not a legal holiday observed by the corporation at its principal executive office, and if it is such a legal holiday, then on the next succeeding full business day at the same time. At such annual meeting directors shall be elected and any other business may be transacted which may properly come before the meeting.
(a) Special meetings of the shareholders, for any purpose or purposes, may be called by the Board of Directors, the Chairman of the Board of Directors, the President, or the holders of shares entitled to cast not less than fifty percent (50%) of the votes at the meeting, or may be called as otherwise provided for in the Articles of Incorporation.
(b) Upon written request to the Chairman of the Board of Directors, the President, any vice president or the Secretary of the corporation by any person or persons (other than the Board
of Directors) entitled to call a special meeting of the shareholders, such officer forthwith shall cause notice to be given to the shareholders entitled to vote, that a meeting will be held at a time requested by the person or persons calling the meeting, such time to be not less than thirty-five (35) nor more than sixty (60) days after receipt of such request. If such notice is not given within twenty (20) days after receipt of such request, the person or persons calling the meeting may give notice thereof in the manner provided by law or in these bylaws. Nothing contained in this Section 7 shall be construed as limiting, fixing or affecting the time or date when a meeting of shareholders called by action of the Board of Directors may be held.
Notice of any meeting of shareholders shall state the date, place and hour of the meeting and,
(a) in the case of a special meeting, the general nature of the business to be transacted, and no other business may be transacted at such meeting;
(b) in the case of an annual meeting, the general nature of matters which the Board of Directors, at the time the notice is given, intends to present for action by the shareholders;
(c) in the case of any meeting at which directors are to be elected, the names of the nominees intended at the time of the notice to be presented by management for election; and
(d) in the case of any meeting, if action is to be taken on any of the following proposals, the general nature of such proposal:
(1) a proposal to approve a transaction within the provisions of California Corporations Code, Section 310 (relating to certain transactions in which a director has an interest);
(2) a proposal to approve a transaction within the provisions of California Corporations Code, Section 902
(relating to amending the Articles of Incorporation of the corporation);
(3) a proposal to approve a transaction within the provisions of California Corporations Code, Sections 181 and 1201 (relating to reorganization);
(4) a proposal to approve a transaction within the provisions of California Corporations Code, Section 1900 (winding up and dissolution);
(5) a proposal to approve a plan of distribution within the provisions of California Corporations Code, Section 2007 (relating to certain plans providing for distribution not in accordance with the liquidation rights of preferred shares, if any).
At a special meeting, notice of which has been given in accordance with this Section, action may not be taken with respect to business, the general nature of which has not been stated in such notice. At an annual meeting, action may be taken with respect to business stated in the notice of such meeting, given in accordance with this Section, and, subject to subsection 8(d) above,with respect to any other business as may properly come before the meeting.
If any notice addressed to a shareholder at the address of that shareholder appearing on the books of the corporation is returned to the corporation by the United States Postal Service marked to indicate that the United States Postal Service is unable to deliver the notice to the shareholder at that address, all future notices shall be deemed to have been duly given without further mailing if these shall be available to the shareholder on written demand by the shareholder at the principal
executive office of the corporation for a period of one year from the date of the giving of the notice.
(a) At any meeting of the shareholders, a majority of the shares entitled to vote, represented in person or by proxy, shall constitute a quorum. If a quorum is present, the affirmative vote of the majority of shares represented at the meeting and entitled to vote on any matter shall be the act of the shareholders, unless the vote of a greater number or voting by classes is required by law or by the Articles of Incorporation, and except as provided in subsection (b) below.
(b) The shareholders present at a duly called or held meeting of the shareholders at which a quorum is present may continue to do business until adjournment, notwithstanding the withdrawal of enough shareholders to leave less than a quorum, provided that any action taken (other than adjournment) is approved by at least a majority of the shares required to constitute a quorum.
(c) In the absence of a quorum, no business other than adjournment may be transacted, except as described in subsection (b) above.
In the event any meeting is adjourned, it shall not be necessary to give notice of the time and place of such adjourned meeting pursuant to Sections 8 and 9 of these bylaws; provided that if any of the following three events occur, such notice must be given:
(1) announcement of the adjourned, meeting's time and place is not made at the original meeting which it continues or
(2) such meeting is adjourned for more than forty-five (45) days from the date set for the original meeting or
(3) a new record date is fixed for the adjourned meeting.
At the adjourned meeting, the corporation may transact any business which might have been transacted at the original meeting.
(a) Subject to subsection (b) of this Section, the transactions of any meeting of shareholders, however called and noticed, and wherever held, shall be as valid as though made at a meeting duly held after regular call and notice, if a quorum is present either in person or by proxy, and if, either before or after the meeting, each of the persons entitled to vote but not present in person or by proxy signs a written waiver of notice or a consent to holding of the meeting or an approval of the minutes thereof.
(b) A waiver of notice, consent to the holding of a meeting or approval of the minutes thereof need not specify the business to be transacted or transacted at nor the purpose of the meeting; provided that in the case of proposals described in subsection (d) of Section 8 of these bylaws, the general nature of such proposals must be described in any such waiver of notice and such proposals can only be approved by waiver of notice, not by consent to holding of the meeting or approval of the minutes.
(c) All waivers, consents and approvals shall be filed with the corporate records or made a part of the minutes of the meeting.
(d) A person's attendance at a meeting shall constitute waiver of notice of and presence at such meeting, except when such person objects at the beginning of the meeting to transaction of any business because the meeting is not lawfully called or convened and except that attendance at a meeting is not a waiver of any right to object to the consideration of matters which are required by law or these bylaws to be in such notice (including those matters described in subsection (d) of Section 8 of these bylaws), but are not so included if such person expressly objects to consideration of such matter or matters at any time during the meeting.
Directors may not be elected by written consent except by unanimous written consent of all shares entitled to vote for the election of directors; provided that any vacancy on the Board of Directors (other than a vacancy created by removal) which has
not been filled by the board of directors may be filled by the written consent of a majority of outstanding shares entitled to vote for the election of directors.
Any written consent may be revoked pursuant to California Corporations Code Section 603 (c) prior to the time that written consents of the number of shares required to authorize the proposed action have been filed with the Secretary. Such revocation must be in writing and will be effective upon its receipt by the Secretary.
If the consents of all shareholders entitled to vote have not
been solicited in writing, and if the unanimous written consent of all such
shareholders shall not have been received, the Secretary shall give prompt
notice of any corporate action approved by the shareholders without a meeting to
those shareholders entitled to vote on such matters who have not consented
thereto in writing. This notice shall be given in the manner specified in
Section 8 of these bylaws. In the case of approval of (i) a transaction within
the provisions of California Corporations Code, Section 310 (relating to certain
transactions in which a director has an interest), (ii) a transaction within the
provisions of California Corporations Code, Section 317 (relating to
indemnification of agents of the corporation), (iii) a transaction within the
provisions of California Corporations Code,
Sections 181 and 1201 (relating to reorganization), and (iv) a plan of distribution within the provisions of California Corporations Code, Section 2007 (relating to certain plans providing for distribution not in accordance with the liquidation rights of preferred shares, if any), the notice shall be given at least ten (10) days before the consummation of any action authorized by that approval.
Every person entitled to vote at an election for directors may cumulate the votes to which such person is entitled, i.e., such person may cast a total number of votes equal to the number of directors to be elected multiplied by the number of votes to which such person's shares are entitled,and may cast said total number of votes for one or more candidates in such propertions as such person thinks fit; provided, however, no shareholder shall be entitled to so cumulate such shareholder's votes unless the candidates for which such shareholder is voting have been placed in nomination prior to the voting and a shareholder has given notice at the meeting, prior to the vote, of an intention to cumulate votes. In any election of directors, the
candidates receiving the highest number of votes, up to the number of directors to be elected, are elected.
Except as may be otherwise provided in the Articles of Incorporation or by law, and subject to the foregoing provisions regarding the cumulation of votes, each shareholder shall be entitled to one vote for each share held.
Any shareholder may vote part of such shareholder's shares in favor of a proposal and refrain from voting the remaining shares or vote them against the proposal, other than elections to office, but, if the shareholder fails to specify the number of shares such shareholder is voting affirmatively, it will be conclusively presumed that the shareholder's approving vote is with respect to all shares such shareholder is entitled to vote.
No shareholder approval, other than unanimous approval of those entitled to vote, will be valid as to proposals described in subsection 8(d) of these bylaws unless the general nature of such business was stated in the notice of meeting or in any written waiver of notice.
these bylaws to determine which shareholders are entitled to notice of and to vote at a meeting or consent to corporate actions, as provided in Sections 13 and 14 of these bylaws. Only persons in whose name shares otherwise entitled to vote stand on the stock records of the corporation on such date shall be entitled to vote or consent.
If no record date is fixed:
(1) The record date for determining shareholders entitled to notice of or to vote at a meeting of shareholders shall be at the close of business on the business day next preceding the day notice is given or, if notice is waived, at the close of business on the business day next preceding the day on which the meeting is held;
(2) The record date for determining shareholders entitled to give consent to corporate action in writing without a meeting, when no prior action by the Board of Directors has been taken, shall be the day on which the first written consent is given;
(3) The record date for determining shareholders for any other purpose shall be at the close of business on the day on which the Board of Directors adopts the resolution relating
thereto, or the sixtieth (60th) day prior to the date of such other action, whichever is later.
A determination of shareholders of record entitled to notice of or to vote at a meeting of shareholders shall apply to any adjournment of the meeting unless the Board of Directors fixes a new record date for the adjourned meeting; provided, however, that the Board of Directors shall fix a new record date if the meeting is adjourned for more than forty-five (45) days from the date set for the original meeting.
Shares of the corporation held by its subsidiary or subsidiaries (as defined in California Corporations Code, Section 189(b)) are not entitled to vote in any matter.
These inspectors shall:
(a) Determine the number of shares outstanding and the voting power of each, the shares represented at the meeting, the existence of a quorum, and the authenticity, validity, and effect of proxies;
(b) Receive votes, ballots, or consents;
(c) Hear and determine all challenges and questions in any way arising in connection with the right to vote;
(d) Count and tabulate all votes or consents;
(e) Determine when the polls shall close;
(f) Determine the result; and
(g) Do any other acts that may be proper to conduct the election or vote within fairness to all shareholders.
ARTICLE IV
shall be exercised under the ultimate direction of the Board of Directors.
So long as the authorized number of directors shall be six
(6), the Board of Directors shall be composed at all times of persons qualified
as follows:
(a) Three (3) directors must be nominees of Kirin Brewery Co., Ltd., a Japanese corporation.
(b) Three (3) directors must be nominees of Amgen, a California corporation.
Except as otherwise provided by law or by the Articles of Incorporation, the entire Board of Directors or any individual
director may be removed from office without cause by the affirmative vote of a majority of the outstanding shares entitled to vote on such removal; provided, however, that unless the entire Board is removed, no individual director may be removed when the votes cast against such director's removal, or not consenting in writing to such removal, would be sufficient to elect that director if voted cumulatively at an election at which the same total number of votes cast were cast (or, if such action is taken by written consent, all shares entitled to vote were voted) and the entire number of directors authorized at the time of such director's most recent election were then being elected.
is present (which shares voting affirmatively also constitute at least a majority of the required quorum) or by the written consent of shareholders pursuant to Section 13 hereinabove. Except as otherwise provided by the Articles of Incorporation, the shareholders may elect a director at any time to fill any vacancy not filled by the directors. Any such election by written consent, other than to fill a vacancy created by removal, requires the consent of a majority of the outstanding shares entitled to vote. Any such election by written consent to fill a vacancy created by removal requires the consent of all of the outstanding shares entitled to vote.
If, after the filling of any vacancy by the directors, the directors then in office who have been elected by the shareholders constitute less than a majority of the directors then in office, any holder or holders of an aggregate of five percent (5%) or more of the shares outstanding at that time and having the right to vote for such directors may call a special meeting of shareholders to be held to elect the entire Board of Directors. The term of office of any director shall terminate upon such election of a successor.
the annual meeting, the Board of Directors shall hold a regular meeting for the purposes of organization, the appointment of officers and the transaction of other business. other regular meetings of the Board of Directors shall be held at such times, places and dates as fixed in these bylaws or by the Board of Directors; provided, however, that if the date for such a meeting falls on a legal holiday, then the meeting shall be held at the same time on the next succeeding full business day. Regular meetings of the Board of Directors held pursuant to this Section 24 may be held without notice.
regular meetings held pursuant to Section 24 above shall be delivered personally, orally or in writing, or by telephone or telegraph to each director, at least forty-eight (48) hours before the meeting, or sent in writing to each director by first-class mail, charges prepaid, at least four (4) days before the meeting. Such notice may be given by the Secretary of the corporation or by the person or persons who called a meeting. Such notice need not specify the purpose of the meeting. Notice of any meeting of the Board of Directors need not be given to any director who signs a waiver of notice of such meeting, or a consent to holding the meeting or an approval of the minutes thereof, either before or after the meeting, or who attends the meeting without protesting prior thereto or at its commencement such director's lack of notice. All such waivers, consents and approvals shall be filed with the corporate records or made a part of the minutes of the meeting.
Directors may be taken without a meeting, if all members of the Board of Directors individually or collectively consent in writing to such action. Such written consent or consents shall be filed with the minutes of the proceedings of the Board of Directors. Such action by written consent shall have the same force and effect as a unanimous vote of such directors.
of the directors present. If the meeting is adjourned for more than twenty-four
(24) hours, notice of such adjournment to another time or place shall be given
prior to the time of the adjourned meeting to the directors who were not present
at the time of the adjournment.
ARTICLE V
person authorized by these bylaws to act in such officer's place, the Board of Directors may from time to time delegate the powers or duties of such officer to any other officer, or any director or other person whom it may select, for such period of time as the Board of Directors deems necessary.
any other officer upon whom such power of removal may be conferred by the Board of Directors.
name of the corporation, any instrument authorized by the Board of Directors, except when the signing and execution thereof shall have been expressly delegated by the Board of Directors or by these bylaws to some other officer or agent of the corporation. The President shall have all the general powers and duties of management usually vested in the president of a corporation, and shall have such other powers and duties as may be prescribed from time to time by the Board of Directors or these bylaws. The President shall have discretion to prescribe the duties of other officers and employees of the corporation in a manner not inconsistent with the provisions of these bylaws and the directions of the Board of Directors.
be prescribed for them from time to time by the Board of Directors or pursuant to Sections 35 and 36 of these bylaws or otherwise pursuant to these bylaws.
(a) Keep, or cause to be kept, minutes of all meetings of the corporation's shareholders, Board of Directors, and committees of the Board of Directors, if any. Such minutes shall be kept in written form.
(b) Keep, or cause to be kept, at the principal executive office of the corporation, or at the office of its transfer agent or registrar, if any, a record of the corporation's shareholders, showing the names and addresses of all shareholders, and the number and classes of shares held by each. Such records shall be kept in written form or any other form capable of being converted into written form.
(c) Keep, or cause to be kept, at the principal executive office of the corporation, or if the principal executive office is not in California, at its principal business office in California, an original or copy of these bylaws, as amended.
(d) Give, or cause to be given, notice of all meetings of shareholders, directors and committees of the Board of Directors, as required by law or by these bylaws.
(e) Keep the seal of the corporation, if any, in safe custody.
(f) Exercise such powers and perform such duties as are usually vested in the office of secretary of a corporation, and exercise such other powers and perform such other duties as may be prescribed from time to time by the Board of Directors or these bylaws.
If any assistant secretaries are appointed, the assistant secretary, or one of the assistant secretaries in the order of their rank as fixed by the Board of Directors or, if they are not so ranked, the assistant secretary designated by the Board of Directors, in the absence or disability of the Secretary or in the event of such officer's refusal to act or if a vacancy exists in the office of Secretary, shall perform the duties and exercise the powers of the Secretary and discharge such duties as may be assigned from time to time pursuant to these bylaws or by the Board of Directors.
(a) Be responsible for all functions and duties of the treasurer of the corporation.
(b) Keep and maintain, or cause to be kept and maintained, adequate and correct books and records of account for the corporation.
(c) Receive or be responsible for receipt of all monies due and payable to the corporation from any source whatsoever; have charge and custody of, and be responsible for, all monies and other valuables of the corporation and be responsible for deposit of all such monies in the name and to the credit of the corporation with such depositaries as may be designated by the Board of Directors or a duly appointed and authorized committee of the Board of Directors.
(d) Disburse or be responsible for the disbursement of the funds of the corporation as may be ordered by the Board of Directors or a duly appointed and authorized committee of the Board of Directors.
(e) Render to the chief executive officer and the Board of Directors a statement of the financial condition of the corporation if called upon to do so.
(f) Exercise such powers and perform such duties as are usually vested in the office of chief financial officer of a corporation, and exercise such other powers and perform such other duties as may be prescribed by the Board of Directors or these bylaws.
If any assistant financial officer is appointed, the assistant financial officer, or one of the assistant financial officers, if there are more than one, in the order of their rank as fixed by the Board of Directors or, if they are not so ranked, the assistant financial officer designated by the Board of in the absence or disability of the Chief Directors, shall, or in the event of such officer's refusal to Financial Officer act, perform the duties and exercise the powers of the Chief Financial Officer, and shall have such powers and discharge such duties as may be assigned from time to time pursuant to these bylaws or by the Board of
ARTICLE VI
Contracts, Bank Accounts,
and authorized committee or by any officer or officers, agent or agents, of the corporation to whom such power may be delegated from time to time by the Board of Directors. The Board of Directors or its duly appointed and authorized committee may make such rules and regulations with respect to said bank accounts, not inconsistent with the provisions of these bylaws, as are deemed advisable.
ARTICLE VII
In the event that the corporation shall issue any shares as only partly paid, the certificate issued to represent such partly paid shares shall have stated thereon the total consideration to be paid for such shares and the amount paid thereon.
certificate for shares of the corporation duly endorsed, with reasonable assurance that the endorsement is genuine and effective, or accompanied by proper evidence of succession, assignment or authority to transfer and upon compliance with applicable federal and state securities laws and if the corporation has no statutory duty to inquire into adverse claims or has discharged any such duty and if any applicable law relating to the collection of taxes has been complied with, it shall be the duty of the corporation, by its Secretary or transfer agent, to cancel the old certificate, to issue a new certificate to the person entitled thereto and to record the transaction on the books of the corporation.
or stolen certificate, or such owner's legal representative, to give the corporation a bond or other adequate security sufficient to indemnify the corporation and its transfer agent and/or registrar, if any, against any claim that may be made against it or them on account of such allegedly lost, destroyed or stolen certificate or the replacement thereof. Said bond or other stolen security shall be in such amount, on such terms and conditions and, in the case of a bond, with such surety or sureties as may be acceptable to the Board of Directors or to its duly appointed and authorized committee or any officer or officers authorized by the Board of Directors to determine the sufficiency thereof. The requirement of a bond or other security may be waived in particular cases at the discretion of the Board of Directors or its duly appointed and authorized committee or any officer or officers authorized by the Board of Directors so to do.
ARTICLE VIII
(i) A shareholder or shareholders holding at least five percent in the aggregate of the outstanding voting shares of the corporation shall have an absolute right to do either or both of the following:
(A) Inspect and copy the record of shareholders' names and addresses and shareholdings during usual business hours upon five business days' prior written demand upon the corporation; or
(B) Obtain from the transfer agent, if any, for the corporation, upon five business days' prior written demand and upon the tender of its usual charges for such a list (the amount of which charges shall be stated to the shareholder by the transfer agent upon request), a list of the shareholders' names and addresses who are entitled to vote for the election of directors and their shareholdings, as of the most recent record date for which it has been compiled or as of a date specified by the shareholder subsequent to the date of demand.
(ii) The record of shareholders shall also be open to inspection and copying by any shareholder or holder of a voting trust certificate at any time during usual business hours upon written demand on the corporation, for a purpose reasonably related to such holder's interest as a shareholder or holder of a voting trust certificate.
(iii) The accounting books and records and minutes of proceedings of the shareholders and the Board of Directors and of any committees of the Board of Directors of the corporation and of each of its subsidiaries shall be open to inspection, copying and making extracts upon written demand on the corporation of any shareholder or holder of a voting trust certificate at any reasonable time during usual business hours, for a purpose
reasonably related to such holder's interests as a shareholder or as a holder of such voting trust certificate.
(iv) Any inspection, copying, and making of extracts under this subsection (a) may be done in person or by agent or attorney.
ARTICLE IX
entitled to receive payment of any dividend or other distribution or allotment of any rights or entitled to exercise any rights in respect of any change, conversion or exchange of shares or entitled to exercise any rights in respect of any other lawful action. The record date so fixed shall not be more than sixty (60) days nor less than ten (10) days prior to the date of the meeting nor more than sixty (60) days prior to any other action or event for the purpose of which it is fixed. If no record date is fixed, the provisions of Section 15 of these bylaws shall apply with respect to notice of meetings, votes, and consents and the record date for determining shareholders for any other purposes shall be at the close of business on the day on which the Board of Directors adopts the resolutions relating thereto, or the sixtieth (60th) day prior to the date of such other action or event, whichever is later.
Only shareholders of record at the close of business on the record date shall be entitled to notice and to vote or to receive the dividend, distribution or allotment of rights or to exercise the rights, as the case may be, notwithstanding any transfer of any shares on the books of the corporation after the record date, except as otherwise provided in the Articles of Incorporation, by agreement or by law.
Without limiting the foregoing, "shall" is mandatory and "may" is permissive.
ARTICLE X
trative, or investigative; and "expenses" includes, without limitation, attorneys' fees and any expenses of establishing a right to indemnification under subsection (d) or subsection e(iii) of this Section.
(i) In respect of any claim, issue or matter as to which such person shall have been adjudged to be liable to the corporation in the performance of such person's duty to the corporation, unless and only to the extent that the court in which such proceeding is or was pending shall determine upon application that, in view of all the circumstances of the case, such person is fairly and reasonably entitled to indemnity for the expenses which the court shall determine;
(ii) Of amounts paid in settling or otherwise disposing of a threatened or pending action, with or without court approval; or
(iii) Of expenses incurred in defending a threatened or pending action which is settled or otherwise disposed of without court approval.
(i) A majority vote of a quorum consisting of directors who are not parties to such proceeding;
(ii) Approval or ratification by the affirmative vote of a majority of the shares represented and voting at a duly held meeting at which quorum is present (which shares voting affirmatively also constitute at least a majority of the required quorum) or by the written consent of the shareholders, with the shares owned by the person to be indemnified not being entitled to vote thereon; or
(iii) The court in which such proceeding is or was pending, upon application made by the corporation or the agent or the attorney or other person rendering services in connection with the defense, whether or not such application by the agent, attorney, or other person is opposed by the corporation.
(i) That is would be inconsistent with a provision of the Articles of Incorporation, bylaws, a resolution of the shareholders, or an agreement in effect at the time of the accrual of the alleged cause of action asserted in the proceeding in which the expenses were incurred or other amounts were paid, which prohibits or otherwise limits indemnification; or
(ii) That is would be inconsistent with any condition expressly imposed by a court in approving a settlement.
ARTICLE XI
[LETTERHEAD OF MUSICK, PEELER & GARRETT]
June 13, 1984
Kirin Brewery Co., Ltd. Kirin-Amgen, Inc.
26-1 Jingumae 1900 Oak Terrace Lane
6 Chome Thousand Oaks, CA 91320
Shibuya-ku U.S.A.
Tokyo 150, JAPAN
Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Re: Kirin-Amgen, Inc.
|
Gentlemen:
The California State Bar had adopted a set of Rules of Professional Conduct by which its members are governed. One such rule is Rule 5-102 (B) which reads as follows:
"(B) A member of the State Bar shall not represent conflicting interests, except with the written consent of all parties concerned."
Our office has been asked by each of you to act as legal counsel to Kirin-Amgen, Inc., a California corporation ("Corporation").
This is quite an array of responsibility, and with it goes the potential of a conflict of interest. Accordingly, we hereby declare to each of you that the following are conditions of our continued engagement by all of you:
(1) If any one or more of you shall ever be of the view that our continued representation of the several interests which have been referred to above is not agreeable to you for any reason, or
(2) If we shall reach that same view,
EXHIBIT "F"
MUSICK, PEELER & GARRETT
A LAW PARTNERSHIP INCLUDING PROFESSIONAL CORPORATIONS
Kirin Brewery Co., Ltd.
Amgen
Kirin-Amgen, Inc.
June 13, 1984
Page Two
(2) If we shall reach that same view, then the entity desiring to have representation of Corporation terminated should notify all others concerned. Upon such notice, we pledge to do everything reasonably necessary and appropriate to effect a termination of the representation as soon as practicable and in such a manner as befits the circumstances existing at that time.
In order that we might be in compliance with the above-cited Rule, we ask each of you to be good enough to sign a copy of this letter and return the same to us. The extra copy is for your files.
Kindest personal regards.
Very truly yours,
/s/ Joel S. Marcus, P.C.
of MUSICK, PEELER & GARRETT
JSM/jr
Enclosure
|
Each of the undersigned hereby acknowledges receipt of the foregoing letter, and with full knowledge of the contents thereof, hereby waives any conflict of interest that may exist by reason of the undertaking of Musick, Peeler & Garrett to provide a legal representation as described therein.
KIRIN BREWERY CO., LTD., a KIRIN-AMGEN, INC., a
Japanese corporation California corporation
By: /s/ Noboru Miyadai By: /s/ Tatsuhiko Kaneka
General Manager R & D Dept. Its Vice President - Kirin
Date: June 13, 1984 Date: June 13, 1984
AMGEN, a California corporation
By: /s/ Gordon M. Binder
Its Vice President
Date: June 13, 1984
|
A MEMBER OF ARTHUR YOUNG INTERNATIONAL
ARTHUR YOUNG
515 South Flower Street
Los Angeles, California 90071
June 13, 1984
KIRIN-AMGEN, Inc.
1892 Oak Terrace Lane
Newbury Park, California 91320
Attention: Mr. Gordon M. Binder
We are pleased to accept appointment as certified public accountants for KIRIN-AMGEN, Inc. to examine and report on your annual financial statements. In addition, our services will include the preparation of your federal and state income tax returns. We will also be prepared to be helpful to you on any problems within our competence that might arise during the year, and hope that you will call on us at any time you think we can be of assistance.
Gary Johnson and Joe Johns will be responsible for coordinating and managing all of the services we perform for you. Marty Melone will be the colleague partner who will consult with Messrs. Johnson and Johns on significant aspects of the engagement and substitute for them when they are unavailable.
It will be the responsibility of Mr. Johnson and Mr. Johns to make sure that your management receives good service. They will, as- desirable, call upon other individuals with specialized knowledge and skills, either in this office or elsewhere in the firm. An audit manager and a tax manager will be assigned to your work, and we expect that they will soon establish direct working relationships with personnel in your Company.
Our examination of your annual financial statements will be made in accordance with generally accepted auditing standards and accordingly will include such tests as we consider necessary in the circumstances. Unless unusual conditions not now foreseen make it impracticable for us to do so, we will submit a report on our examination of these financial statements which will express an opinion as to the fairness of their presentation in conformity with generally accepted accounting principles.
EXHIBIT "G"
Mr. Gordon M. Binder
June 13, 1984
Under generally accepted auditing standards the independent auditor has the responsibility, within the inherent limitations of the auditing process, to plan the examination to search for errors or irregularities (as defined in authoritative professional literature) that would have a material effect on the financial statements. Our search for material errors or irregularities ordinarily is accomplished by performing those auditing procedures that in our judgment are appropriate in the circumstances to form an opinion on the financial statements as a whole. Our examination, which is based on the concept of selective testing of the data being examined, is subject to the inherent risk that material errors or irregularities, if they exist, will not be detected.
In conducting our examination, we will be aware of the possibility that illegal acts (as defined in authoritative professional literature) may have occurred that may have a material effect on the financial statements. Examinations conducted in accordance with generally accepted auditing standards are of limited effectiveness in discovering possible illegal acts and cannot be expected to provide assurance that illegal acts will be detected, although procedures that are performed primarily for the purpose of forming an opinion on the financial statements as a whole may also bring possible illegal acts to the auditor's attention.
During the course of our examination, we may observe opportunities for economies in or improved controls over your operations. It is our practice to bring such opportunities to the attention of an executive at the appropriate level of management, either orally or in writing. Should you desire any further information concerning our responsibilities and functions as an independent auditor in making the examination, we shall be pleased to furnish information to you upon request.
Our charges are based on hours worked by the various grades of personnel, at our standard rates applicable to each. We will bill you monthly on the basis of such charges plus out-of-pocket expenses. We will submit annually, for your approval, budgets outlining our estimated fees and expenses.
Mr. Gordon M. Binder
June 13, 1984
If this letter meets with your approval, please sign one copy and return it to us.
We very much appreciate the opportunity to act as your independent auditors and trust that our association will be a long and pleasant one.
Yours very truly,
/s/ Arthur Young & Company KIRIN-AMGEN, Inc. By: /s/ Robert D. Weist Date: June 13, 1984 |
THIS KIRIN BREWERY CO., LTD./KIRIN-AMGEN, INC. SERVICES AGREEMENT ("Agreement") is made as of this day of, 1984, by and between KIRIN BREWERY CO., LTD., a Japanese corporation, ("Kirin"), and KIRIN-AMGEN, INC., a California corporation ("Company").
R E C I T A L S
WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);
WHEREAS, Kirin is willing to provide or cause to be provided certain services to the Company as described below and in accordance with the terms set forth below;
NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:
EXHIBIT "H"
ARTICLE I
1.02 EPO: As defined in the Shareholders' Agreement (the "Shareholders' Agreement") among Kirin, Amgen, a corporation organized and existing under the laws of California ("Amgen"), and the Company, of even date herewith.
1.03 Field of Activity: As defined in the Shareholders' Agreement.
1.04 Management Support Services: Those services more fully described in Article II hereof, including without limitation the marketing support and commercial development services to be supplied by the personnel referred to in Article II.
ARTICLE II
services in connection with the Field of Activity as the Company requests:
(a) general management support in connection with the day-to-day operation of the Company's business, including operating and sales services; and
(b) commercial development and marketing research services concerning the Field-of Activity.
ARTICLE III
equivalents thereof, and other miscellaneous administrative staff groups, or the equivalents thereof, to advise and assist the Company with respect to matters falling within the areas of expertise of these various departments as the Company requests.
ARTICLE IV
The Company will be charged for each hour of service supplied hereunder an amount equal to the product of two and one-half (2 1/2,' and the annual base salary of the person supplying a particular service to the Company, divided by two thousand (2000). Base salary for the purposes of this section
shall mean the base salary paid to such person by Kirin or a Subsidiary for the twelve (12) month period terminating at the end of the fiscal quarterimmediately preceding (or for persons who were not employed by Kirin or a Subsidiary for such period an annualized equivalent computation thereof) the time the services were rendered and shall not include bonuses or an amount for fringe or other benefits.
ARTICLE V
between the Company and employees or consultants of Kirin, its subsidiaries or associated companies; (d) an assumption by Kirin of any responsibility for the work performed by outside suppliers employed by the Company at the suggestion or recommendation of Kirin; or (e) the delegation of any function or authorityof the Company to Kirin; it being understood that Kirin will make recommendations and offer advice pursuant to this Agreement but that all decisions with respect thereto and otherwise shall be and remain dependent upon appropriate action of the Board of Directors or the authorized officers of the Company.
ARTICLE VI
ARTICLE VII
class mail, or by telex confirmed by registered-first-class mail, and addressed as follows:
If to Kirin: Senior Vice President
KIRIN BREWERY CO., LTD.
26-1, Jingumae 6 Chome
Shibuya-Ku, Tokyo 150
JAPAN
Telex No.: 242-5401 KIRIN J
If to the Company: President
KIRIN-AMGEN, INC.
c/o 1900 Oak Terrace Lane
Thousand Oaks, CA 91320 USA
Telex No.:
With a copy to: Joel S. Marcus, P.C.
Musick, Peeler & Garrett
One Wilshire Boulevard
Los Angeles, CA 90017
|
Either party may give written notice for a change of address in accordance with the provisions of this Article VII and, there after, any notice or request to be given hereunder shall be forwarded to the new address so provided. All notices given hereunder shall be deemed to have been received by the party addressed (a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, or (c) ten (10) business days after the date of posting of notice sent by
ARTICLE VIII
ARTICLE IX
ARTICLE X
by a writing duly signed by the authorized representatives of the parties hereto. Any condition or provision of or in any document or communication whatsoever, other than a writing amending or modifying this Agreement- in accordance with the second sentence of this Section 10.01, shall be deemed inapplicable to the obligations between the parties hereto.
ARTICLE XI
IN WITNESS WHEREOF, Kirin and the Company have caused this Agreement to be executed by their respective duly authorized
representatives in the manner legally binding upon them as of the date first above written.
KIRIN BREWERY CO., LTD.
By
Its
KIRIN-AMGEN, INC.
BY
Its
THIS AMGEN/KIRIN-AMGEN, INC. SERVICES AGREEMENT ("Agreement") is made as of this day of , 1984, by and between AMGEN, a California corporation ("Amgen") and KIRIN AMGEN, INC., a California corporation ("Company").
R E C I T A L S
WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);
WHEREAS, Amgen is willing to provide or cause to be provided certain services to -the Company as described below and in accordance with the terms set forth below;
EXHIBIT "I"
NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:
ARTICLE I
1.02 EPO: As defined in the Shareholders' Agreement (the "Shareholders' Agreement") among Amgen, Kirin Brewery Co., Ltd., a corporation organized and existing under the laws of Japan ("Kirin"), and the Company, of even date herewith.
1.04 Management Support Services: Those services more fully described in Article II hereof, including without limitation the marketing support and commercial development services to be supplied by the personnel referred to in Article II.
ARTICLE II
(a) general management support in connection with the day-to-day operation of the Company's business, including operating and sales services; and
(b) commercial development and marketing research services concerning the Field of Activity.
ARTICLE III
ARTICLE IV
The Company will be charged for each hour of service supplied hereunder an amount equal to the product of two and one-half (2 1/2) and the annual base salary of the person supplying a particular service to the Company, divided by two thousand (2000). Base salary for the purposes of this section shall mean the base salary paid to such person by Amgen or a Subsidiary for the twelve (12) month period termination at the end of the fiscal quarter immediately preceding (or for persons who were not employed by Amgen or a Subsidiary for such period an annualized equivalent computation thereof) the time the services were rendered and shall not include bonuses or an amount for fringe or other benefits.
ARTICLE V
ARTICLE VI
ARTICLE VII
If to Amgen: Chief Financial Officer
Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320 USA
Telex No.:
With a copy to: Alan C. Mendelson, Esq.
Cooley, Godward, Castro,
Huddleson & Tatum
5 Palo Alto Square
Suite 400
Palo Alto, CA 94306
If to the Company: Chief Financial Officer
Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320 USA
Telex No.:
With a copy to: Joel S. Marcus, P.C.
Musick, Peeler & Garrett
One Wilshire Boulevard
Los Angeles, CA 90017
|
Either party may give written notice for a change of address in accordance with the provisions of this Article VII and, there after, any notice or request to be given hereunder shall be forwarded to the new address so provided. All notices given hereunder shall be deemed to have been received by the party
addressed-(a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, or (c) ten (10) business days after the date of posting of notice sent by registered or certified mail.
ARTICLE VIII
ARTICLE IX
ARTICLE X
ARTICLE XI
IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their respective duly authorized representatives in the manner legally binding upon them as of the date first above written.
AMGEN
By
Its
KIRIN-ANGEN, INC.
By
Its
THIS KIRIN BREWERY CO., LTD./KIRIN-AMGEN, INC. LICENSE AGREEMENT ("Agreement") is made this day of , 1984, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin").
R E C I T A L S
WHEREAS, Amgen, a corporation organized and existing under the laws of the State of California ("Amgen"), has assigned to the Company, perpetually and irrevocably, certain proprietary technology relating to and useful in the production and worldwide commercial sale of erythropoietin;
WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).
EXHIBIT "J"
WHEREAS, Kirin, Amgen and the Company have entered into a Development and Supply Agreement of even date herewith (the "Development Agreement"), pursuant to which Kirin and Amgen will conduct development work for the Company with regard to certain elements of the Transferred Technology (as hereinafter defined), and the Company will own the entire right, title and interest in such technology, patent rights and organisms (including the right to grant the license to Kirin hereunder);
WHEREAS, Kirin desires to obtain from the Company the EPO Technology and to acquire a license to such technology, patent rights and organisms in order to develop, manufacture, market and sell EPO (as hereinafter defined) in the Field of Activity (as hereinafter defined) in its Territory (as hereinafter defined) employing such technology; and in view of the Shareholders' Agreement and the parties further development activities pursuant to the Development Agreement, the Company is willing to grant such a license to Kirin; and
WHEREAS, the Company has granted a similar license to Amgen, of-even date herewith (the "Amgen License"), with respect to the exploitation of the EPO Technology in the United States of America, its territories and possessions, on substantially the same terms and conditions contained herein and for the same purposes described herein.
NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:
ARTICLE I
1.01 EPO: "EPO" shall have the meaning set forth in the Shareholders' Agreement.
1.10 Sales Value: "Sales Value" means the gross amount billed by Kirin and its Subsidiaries, as the case may be, to customers with respect to the sale or use of EPO Products less: (1) trade and/or quantity discounts, to the extent permitted by law; (2) returns and allowances; and (3) retroactive price reductions.
ARTICLE II
ARTICLE III
(a) The Company shall, in accordance with the Shareholders' Agreement and the Development Agreement during the Term of Support, reasonably disclose and deliver to Kirin all EPO Technology in sufficient detail to permit Kirin to employ such data for the purposes provided herein.
(b) Kirin shall, during the Term of Support, have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the EPO Technology.
(a) Any secret or confidential EPO Technology which is disclosed to Kirin pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:
(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and
(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Kirin within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.
(b) Except to the extent expressly authorized by Agreement, the Shareholders' Agreement, the Development Agreement or by other prior written consent of the Company for the term of this Agreement and thereafter, Kirin shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential EPO Technology disclosed or provided to Kirin by the Company. For the purposes of this Agreement, EPO Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:
(i) was known to Kirin at the time of its disclosure and not otherwise subject to an obligation of Kirin to keep such information confidential;
(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;
(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Kirin in breach of this Agreement; or
(iv) became known to Kirin after its disclosure (A) from a source other than the Company (including from independent development by Kirin), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Kirin may disclose any EPO Technology to the extent such disclosure or delivery is necessary for Kirin to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Kirin shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.
(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.
(a) The Company shall during the Term of Support provide to Kirin such EPO Organisms as Kirin requests and as are required for Kirin's business within the Field of Activity, solely for use by Kirin during the period of and under the terms of the right to use such EPO Organisms granted by the Company to Kirin in Sections 2.01 and 2.02, above.
(b) The license granted herein to Kirin with respect to the EPO Organisms shall be limited solely to the use by Kirin of such EPO Organisms in the Field of Activity. Except as expressly authorized by this Agreement or by other prior written consent of the Company, for the term of this Agreement and thereafter, Kirin shall not deliver, transmit or provide to any person other than to a sublicensee under a license granted in accord in Section 2.02, and shall not use, any of the EPO Organisms owned by the Company, or authorize, cause or aid anyone else to do so. Except for Sections 2.01 and 2.02, above, nothing in this Agreement shall be deemed to give Kirin any right or license to use, manufacture, replicate or reproduce any of the EPO Organisms owned by the Company, or to authorize, aid, or cause others so to do.
ARTICLE IV
it under this Agreement. Prompt adjustment shall be made by the proper partyto compensate for any errors or omissions disclosed by such examination or audit. Neither such right to examine and audit nor the right to receive such adjustment shall be affected by any statement to the contrary, appearing on checks or otherwise, unless such statement appears in a letter, signed by the party having such right and delivered to the other party, expressly waiving such rights.
(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual period after the first sale of EPO by Kirin, Kirin shall. furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Kirin showing,all EPO sold during such semiannual period, the Sales Value of .such EPO and the amount of royalty payable thereon (or if no EPO has been so sold, showing this fact).
(b) Within such sixty (60) days Kirin shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.
(c) Kirin shall furnish whatever additional information the Company may reasonably prescribe from time to time to enable the Company to ascertain which EPO sold by Kirin or any of its Subsidiaries are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.
ARTICLE V
ARTICLE VI
and maintain any appropriate suit or action involving infringement in the Field of Activity of any patent of the EPO Technology covering only the making, use or sale or products or the use of processes in the Field of Activity. If Kirin finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Kirin shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Kirin lack standing to bring any such action then Kirin may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Kirin.
proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the EPO Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Kirin in such suit or action, Kirin shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option be represented by counsel of its choice unless the Company and Kirin otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Kirin. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Kirin shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement in the Field of Activity. If Kirin finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Kirin shall pay to the Company the reasonable expenses of the Company (excluding its attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgement or
settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Kirin.
be adjudged bankruptcy, (c) go or be placed in a process of complete liquidation other than for an amalgamation or reconstruction, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.
Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
Attn: Corporate Secretary
With a copy to: Joel S. Marcus, P.C.
Musick, Peeler & Garrett
One Wilshire Boulevard
Los Angeles, CA 90017
|
Senior Vice President
KIRIN BREWERY CO., LTD.
26-1, Jingumae 6 Chome
Shiguya-Ku, Tokyo 150
Japan
Telex No.: 242-5401 KIRINBJ
given (a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, and (c) ten (10) business days after the date of posting notice, sent by registered or certified mail.
required hereunder as may be prevented by or whose purpose is frustrated by
Force Majeure. The Party so affected shall give notice to the other Party in
writing promptly and thereupon shall be excused from such of its obligations
hereunder as it is unable to perform on account of the Force Majeure throughout
the duration thereof plus a period of thirty (30) days. Notwithstanding the
foregoing, should an event of Force Majeure remain in effect for a period of six
(6) months, then in such event, the Company and Kirin hereby agree to promptly
renegotiate the terms of this Agreement, and if no such agreement can be reached
within sixty (60) days of such six (6) month period, the party not so effected
by the Force Majeure shall have the option to terminate this Agreement and if
such party so elects then this Agreement shall automatically terminate and be of
no further force or effect.
connection with any product made, used or sold by Kirin or the use by Kirin of the EPO Technology furnished pursuant to any provision hereunder, or otherwise arising out of or related to the performance of this Agreement.
IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
KIRIN-AMGEN, INC.
By
Its
KIRIN BREWERY CO., LTD.
By
Its
THIS AMGEN/KIRIN-AMGEN, INC. LICENSE AGREEMENT is made this day of , 1984, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN, a California corporation ("Amgen").
R E C I T A L S
WHEREAS, Amgen has assigned to the Company, perpetually and irrevocably, certain proprietary technology relating to and useful in the production and worldwide commercial sale of erythropoietin;
WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).
EXHIBIT "K"
WHEREAS, Amgen, Kirin and the Company have entered into a Development and Supply Agreement of even date herewith (the "Development Agreement"), pursuant to which Amgen and Kirin will conduct development work for the Company with regard to certain elements of the Transferred Technology (as hereinafter defined) and the Company will own the entire right, title and interest in such technology, patent rights and organisms (including the right to grant the license to Amgen hereunder);
WHEREAS, Amgen desires to obtain from the Company the EPO Technology and to acquire a license to such technology, patent rights and organisms in order to develop, manufacture, market and sell EPO (as hereinafter defined) in the Field of Activity (as hereinafter defined) in its Territory (as hereinafter defined) employing such technology; and in view of the Shareholders' Agreement and the parties' further development activities pursuant to the Development Agreement, the Company is willing to grant such a license to Amgen; and
WHEREAS, the Company has granted a similar license to Kirin, of even date herewith (the "Kirin License"), with respect to the exploitation of the EPO Technology in the country of Japan on substantially the same terms and conditions contained herein and for the same purposes described herein.
NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:
ARTICLE I
1.01 EPO. "EPO" shall have the meaning set forth in the Shareholders' Agreement.
1.10 Sales Value. "Sales Value" means the gross amount billed by Amgen and its Subsidiaries, as the case may be, to customers with respect to the sale or use of EPO Products less: (1) trade and/or quantity discounts to the extent permitted by law; (2) returns and allowances; and (3) retroactive price reductions.
ARTICLE II
manufacture and marketing of EPO in the Territory. Said license shall be exclusive except as provided in Section 2.03 hereof.
Amgen. Amgen shall include, in all its sublicenses granted hereunder to any Subsidiary of Amgen, provisions for such termination and assignment.
ARTICLE III
(a) The Company shall, in accordance with the Shareholders' Agreement and the Development Agreement during the Term of Support, reasonably disclose and deliver to Amgen all EPO Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.
(b) Amgen shall, during the Term of Support, have the right to attend and participate in the Company's technical
meetings, conduct plant visits at reasonable intervals and receive information concerning the EPO Technology.
(a) Any secret or confidential EPO Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:
(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and
(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Amgen within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.
(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, the Development Agreement or by other prior written consent of the Company for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential EPO Technology disclosed or provided to Amgen by the Company. For the purposes of this Agreement, EPO Technology shall be
deemed not secret or confidential to the extent, and only to the extent, that it:
(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;
(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;
(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission or Amgen in breach of this Agreement; or
(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Amgen may disclose any EPO Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its
best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.
(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.
(a) The Company shall during the Term of Support provide to Amgen such EPO Organisms as Amgen requests and as are reasonably required for Amgen's business within the Field of Activity, solely for use by Amgen during the period of and under the terms of the right to use such EPO Organisms granted by the Company to Amgen in Sections 2.01 and 2.02, above.
(b) The license granted herein to Amgen with respect to the EPO Organisms shall be limited solely to the use by Amgen of such EPO Organisms in the Field of Activity. Except as expressly authorized by this Agreement or by other prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall not deliver, transmit or provide to any person other than to a sublicensee under a license granted in accord in Section 2.02, and shall not use, any of the Licensed Organisms owned by the Company, or authorize, cause or aid anyone else to do so. Except for Sections 2.01 and 2.02, above, nothing in this Agreement shall be deemed to give Amgen any right or license to use, manufacture, replicate or reproduce any of the
Licensed Organisms owned by the Company, or to authorize, aid, or cause others
so to do (although the Company may grant such rights to Amgen pursuant to
Section 1.04 of the Amgen Assignment).
ARTICLE IV
examination and audit, during normal business hours, not more frequently than annually, of all such records and such other records and accounts as may under recognized accounting practices contain information bearing upon the amount of royalty payable to it under this Agreement. Prompt adjustment shall be made by the proper party to compensate for any errors or omissions disclosed by such examination or audit. Neither such right to examine and audit nor the right to receive such adjustment shall be affected by any statement to the contrary, appearing on checks or other-wise, unless such statement appears in a letter, signed by the party having such right and delivered to the other party, expressly waiving such right.
(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual after the first sale of EPO by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all EPO sold during such semiannual period, the Sales Value of-such EPO and the amount of royalty payable thereon (or if no EPO has been so sold, showing that fact).
(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.
(c) Amgen shall furnish whatever additional information the Company may reasonably prescribe from time to time to enable the Company to ascertain which EPO sold by Amgen or any of its Subsidiaries are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.
ARTICLE V
PATENT APPLICATIONS AND COPYRIGHT REGISTRATIONS
ARTICLE VI
PATENT, COPYRIGHT AND TRADE SECRET ENFORCEMENT
and maintain any appropriate suit or action involving infringement in the Field of Activity of any patent of the EPO Technology covering only the making, use or sale of products or the use of processes in the Field of Activity. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Amgen lack standing to bring any such action then Amgen may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Amgen.
proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the EPO Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Amgen in such suit or action, Amgen shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option be represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement in the Field of Activity. If Amgen finds it necessary to join the Company in such suit- or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding it attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement,
after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.
ARTICLE VII
be adjudged bankruptcy, (c) go or be placed in a process of complete liquidation other than for an amalgamation or reconstruction, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice t the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.
ARTICLE VIII
ARTICLE IX
ARTICLE X
Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
Attn: Corporate Secretary
With a copy to: Joel S. Marcus, P.C.
Musick, Peeler & Garrett
One Wilshire Boulevard
Los Angeles, CA 90017
|
10.02 Amgen Notice. All notices to Amgen under this Agreement shall be in writing and sent to:
Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
Attn: Secretary
With a copy to: Alan C. Mendelson
Cooley, Godward, Castro,
Huddleson & Tatum
5 Palo Alto Square
Suite 400
Palo Alto, CA 94306
|
10.03 Changes. The addresses given above may be changed by notice as specified above.
ARTICLE XI
duration thereof plus a period of thirty (30) days. Notwithstanding the
foregoing, should an event of Force Majeure remain in effect for a period of six
(6) months, then in such event, the Company and Amgen hereby agree to promptly
renegotiate the terms of this Agreement, and if no such agreement can be reached
within sixty (60) days of such six (6) month period, the party not so effected
by the Force Majeure shall have the option to terminate this Agreement and if
such party so elects then this Agreement shall automatically terminate and be of
no further force or effect.
such event, such invalid provision or provisions shall be validly reformed to as nearly approximate the intent of the Parties as possible and if unreformable, shall be severed and deleted from this Agreement.
IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
KIRIN-AMGEN, INC.
By
Its
AMGEN
By
Its
THIS AMENDMENT NO. 1 ("Amendment No. 1") TO THAT CERTAIN KIRIN-AMGEN INC./AMGEN EPO LICENSE AGREEMENT ("License Agreement"), is made and entered into this 20th day of October, 1989, by and between AMGEN, INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("corporation").
R E C I T A L S
A. Amgen and Corporation have previously executed that certain License Agreement regarding EPO.
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 1.
NOW, THEREFORE, it is agreed as follows:
1. Article I, Section 1.06 at page 3 of the License Agreement is hereby deleted and the following substituted in lieu thereof:
allowances actually granted upon claims or returns regardless of the party requesting the return, (iii) freight charges paid for delivery, and (iv) taxes or other government charges levied on or measured by the billed amount whether absorbed by the billing or the billed party."
2. Except to the extent as provided herein, the provisions of the License Agreement are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 1 to be executed as of the first day written above.
AMGEN, INC., a Delaware corporation,
By: /s/ Gordon M. Binder
Gordon Binder
its Chief Executive Officer
|
"Amgen"
KIRIN-AMGEN, INC.
a California corporation,
By: /s/ Yasushi Yamamoto
Yasushi Yamamoto, Chairman
"Corporation"
|
THIS AMENDMENT NO. 4 ("Amendment No. 4") TO THAT CERTAIN SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN, INC., DATED MAY 11, 1984, as previously amended ("Shareholders' Agreement"), is made and entered into this 16/th/ day of October, 1986, and is made effective as of the 1st day of July, 1986, by and among KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), AMGEN, a California corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
R E C I T A L S
A. The parties have acknowledged that the commercial production system for G-CSF (PPO) has been established by Amgen.
B. Pursuant to Amendment No. 3 to the Shareholders' Agreement, the parties previously agreed, inter alia, to transfer to Corporation all right, title and interest in and to the G-CSF (PPO) Technology as of the effective date of this Agreement.
C. The parties have previously agreed that upon establishment of the commercial production system, Amgen shall receive two-thirds (2/3) of the unexpended proposed second year R & D funding.
NOW, THEREFORE, it is agreed as follows:
1.01 Amgen shall assign all of its right, title and interest in and to its G-CSF (PPO) Transferred Technology to Corporation effective as of the date hereof pursuant to that certain Assignment and License Agreement attached hereto as Exhibit "A".
1.02 Amgen shall license its Core Technology in the Field of Activity relating to G-CSF (PPO) to Corporation effective as of the date hereof pursuant to that certain Assignment and License Agreement attached hereto as Exhibit "A".
1.03 Concurrently with the execution of this Amendment No. 4, that certain U.S. Patent Application Ser. No. 768959, filed August 23, 1985, entitled Production of Pluripotent Granulocyte Colony-Stimulating Factor, recorded in the Patent
and Trademark Office on Reel 4475, Frame 913, shall be assigned by Amgen to Corporation pursuant to that certain Assignment attached hereto as Exhibit "B".
Kirin shall assign all of its right, title and interest in and to its G-CSF (PPO) Technology to Corporation effective as of the date hereof pursuant to that certain Assignment Agreement attached hereto as Exhibit "C."
Amgen hereby sublicenses Corporation effective as of the date hereof under any and all rights conferred upon Amgen pursuant to that certain Agreement by and between Amgen and Sloan-Kettering.
A One Million Dollar (U.S. $1,000,000) lump sum payment shall be made to each Kirin and Amgen concurrently with the execution of this Agreement and the Exhibits attached hereto.
During the period February 1, 1987 - March 31, 1987, Kirin and Amgen shall each contribute to the capital of Corporation One Million Dollars (U.S. $1,000,000) in exchange for One Million (1,000,000) additional shares each of Corporation's no par value voting common stock in a tax-free transaction. The Articles of Incorporation of Corporation shall be amended to authorize this additional stock issuance.
Amgen shall (i) supply Corporation (and Kirin) with adequate pre-clinical G- CSF (PPO) materials, (ii) continue its G-CSF (PPO) Technology transfer to Corporation (and Kirin), and (iii) promptly make available to Corporation (and Kirin) its standard operating procedures ("SOP"), strain and standard samples, all relating to the G-CSF (PPO) Technology. Further, Amgen shall use its best efforts to assist Kirin in verifying the SOPS.
All notices, requests, demands and other communications required or permitted to be given under this Agreement shall be
in writing and shall be mailed to the Party to whom notice is to be given, by
telex or facsimile, and confirmed by first class mail, registered or certified,
return receipt requested, postage prepaid, and properly addressed as follows (in
which case such notice shall be deemed to have been duly given on the third
(3rd) day following the date of such sending):
"Kirin" Kirin Brewery Co., Ltd.
26-1, Jingumae 6-Chome
Shibuya-Ku, Tokyo 150
Japan
Telex No. 242-5401 KIRINBJ
Attn: General Manager of
Pharmaceuticals Department
With a copy to: Pettit & Martin
355 S. Grand Avenue, 33d Floor
Los Angeles, California 90071
U.S.A.
Telex No. 181025 PEMLAW LSA
Attn: Joel S. Marcus; Esq.
"Amgen" Amgen
1900 Oak Terrace Lane
Thousand Oaks, California 91320
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Cooley, Godward, Castro,
Huddlesbn & Tatum
One Maritime Plaza, 20th Floor
San Francisco, California 94111
U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
"Corporation" Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Pettit & Martin
355 S. Grand Avenue, 33d Floor
Los Angeles, California 90071
U.S.A.
Telex No. 181025 PEMLAW LSA
Attn: Joel S. Marcus, Esq.
|
Any party, by giving notice to the others in the manner provided above, may change such party's address for purposes of this Paragraph 6.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 4 to be executed as of the first day written above by their duly authorized representatives in a manner legally binding upon them.
KIRIN BREWERY CO., LTD., a
Japanese corporation
BY /s/ Yasushi Yamamoto Yasushi Yamamoto, Managing Director |
"Kirin"
AMGEN, a California corporation
By /s/ George B. Rathmann
George B. Rathmann,
President
"Amgen"
|
KIRIN-AMGEN, Inc., a
California corporation
By /s/ Y. Yamamoto
Yasushi Yamamoto its Chairman
"Corporation"
|
WHEREAS Amgen, a California corporation, having a place of business at 1900 Oak Terrace Lane, Thousand Oaks, Calfornia 91320 is, by virtue of an Assignment dated September 13, 1985 and recorded in the United States Patent and Trademark Office on November 6, 1985 at Reel 4475, Frame 913, the owner of the entire right, title and interest in and to the invention and improvements of Lawrence M. Souza disclosed in application Serial No. 768,959 executed by Lawrence M. Souza on September 13, 1985 and filed August 23, 1985 for Letters Patent of the United States and in said application and any and all other applications, both United States and foreign, which Lawrence M. Souza may file, either solely or jointly with others, on said invention or improvements, and in any and all Letters Patent of the United States and foreign countries which may be obtained of any of said applications, and in any reissue or extension thereof.
WHEREAS Amgen is, by virtue of an Assignment dated March 10, 1986 and recorded in the United States Patent and Trademark Office on June 16, 1986 at Reel 4560, Frame 409, the owner of the entire right, title and interest in and to the invention and improvements of Lawrence M. Souza disclosed in application Serial No. 835,548 executed by Lawrence M. Souza on March 10, 1986 and filed March 3, 1986 for Letters Patent of the United States and in said application and any and all other applications, both United States and foreign, which Lawrence M. Souza may file, either solely or jointly with others, on said invention or improvements, and in any and all Letters Patent of the United States and foreign countries which may be obtained on any of said applications, and in any reissue or extension thereof.
WHEREAS, Lawrence M. Souza in the aforesaid Assignments did thereby agree, upon the request and at the expense of Amgen, its successors and assigns, to execute any and all divisional, continuation, continuation-in-part applications for said inventions or improvements, and any necessary oath or affidavit relating thereto, and any application for reissue or extension of any Letters Patent that may be granted upon said applications, and any and all applications and other documents for Letters Patent in foreign countries on said inventions or improvements that Amgen, its successors or assigns, may deem necessary or expedient, and Lawrence M. Souza did further thereby agree upon the request of Amgen, its successors or assigns, in the event of any application or Letters Patent assigned thereunder becoming involved in Interference, to cooperate to the best of his ability with Amgen, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, and Lawrence M. Souza did also thereby agree to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein in Amgen, its successors or assigns, whereby said Letters Patent will be held and enjoyed by Amgen, its successors or assigns, to the full end of the term for which said Letters patent may be granted as fully and entirely as the same would have been held and enjoyed by Lawrence M. Souza if his assignment and sale had not been made.
WHEREAS, Amgen warrants itself to be the owner of the interest herein assigned and to have the right to make this assignment and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.
WHEREAS, Kirin-Amgen, Inc., a California corporation, having a place of business at 1900 Oak Terrace Lane, Thousand Oaks, California 91320 is desirous of acquiring from Amgen of the entire right, title and interest in and to the aforesaid patent applications and the inventions and improvements therein described and claimed.
NOW, THEREFORE, in consideration of the sum of One Dollar ($1.00) and other good and valuable consideration, the receipt and sufficiency whereof are hereby acknowledged by Amgen, Amgen hereby assigns, sells, transfers and conveys to Kirin-Amgen, Inc., its successors and assigns, its entire right, title and interest in and to the aforesaid applications, inventions and improvements and any Letters Patent of the United States or foreign countries, or reissues or extensions thereof.
Specifically assigned, sold, transferred and conveyed hereunder by Amgen to Kirin-Amgen, Inc., its successors and assigns, is the right, heretofore owned in its entirety by Amgen, to initiate and maintain, without joinder of any other party, any infringement suits based on any Letters Patent of the United States or foreign countries, or reissues or extensions thereof, and the right, heretofore owned in its entirety by Amgen, to enforce against Lawrence M. Souza all agreements and obligations undertaken by him in the aforesaid Assignments to the extent that such agreements and obligations pertain to applications, inventions, improvements, Letters Patent of the United States and foreign countries, or reissues or extensions thereof, and Interferences involving same, whereby all rights under said Letters Patent will be held and enjoyed by Kirin- Amgen, Inc., its successors and assigns, to the full end of the term for which said Letters patent may be granted
as fully and entirely as the same would have been held and enjoyed by Amgen if this assignment had not been made.
Amgen
By /s/ Gordon M. Binder
--------------------------
Sr. Vice President
Dated: August 11, 1986
|
STATE OF CALIFORNIA)
) SS
COUNTY of VENTURA )
.
|
[SEAL] OFFICIAL SEAL
BARBARA L TIPTON
NOTARY PUBLIC - CALIFORNIA
LOS ANGELES COUNTY
|
Sole Inventor
ASSIGNMENT
March 3, 1986
Filed
"PRODUCTION OF PLURIPOTENT GRANULOCYTE
Title: COLONY-STIMULATING FACTOR
The undersigned hereby authorizes and requests the attorneys of record in said application to insert in this assignment the date and serial number of said application when officially known.
The undersigned warrants himself to be the owner of the interest herein assigned and to have the right to make this assignment; and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.
For said consideration the undersigned hereby agrees, upon the request and at the expense of said assignee, its successors and assigns, to execute any and all divisional, continuation, continuation-in-part and substitute applications for said invention or improvements, and any necessary oath or affidavit relating thereto, and any application for the reissue or extension of any Letters Patent that may be granted upon said application, and any and all applications and other documents for Letters Patent in foreign countries on said invention or improvements, that said assignee, its successors or assigns, may deem necessary or expedient, and for the said consideration the undersigned further agrees upon the request of said assignee, its successors or assigns, in the event of any application or Letters Patent assigned herein becoming involved in Interference, to co-operate to the best of the ability of the undersigned with said assignee, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, the undersigned hereby agreeing to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein hereby conveyed in the said assignee, its successors and assigns, whereby said Letters Patent will be held and enjoyed by the said assignee, its successors and assigns, to the full end of the term for which said Letters Patent may be granted as fully and entirely as the same would have been held and enjoyed by the undersigned if this assignment and sale had not been made.
WITNESS my hand and seal, this 10 day of March Nineteen Hundred and 86.
State of California
/s/ Lawrence M. Souza
------------------
County of Ventura
LAWRENCE M. SOUZA
|
On this 10/th/ day of March, 1986 1986 - before me, a Notary Public in
and
for the County and State aforesaid, appeared Lawrence M. Souza
-----------------
/s/ Lawrence M. Souza
JUN 16 186
|
to me personally known to be the same person whose name is subscribed to the foregoing instrument, and acknowledged that he executed said instrument as his free and voluntary act and for the uses and purposes therein expressed. WITNESS my hand and seal the day and year last above given.
My commission Expires 12/17/86
Notary Public
Barbara L. Tipton
|
ASSIGNMENT
Serial. No 768,959
Filed August 23, 1985
Title "Production of Pluripotent Granulocyte Colony-Stimulating
Factor"
|
The undersigned warrants himself to be the owner of the interest herein assigned and to have the right to make this assignment; and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.
its successors and assigns, __________________________________________ to execute any and all divisional, continuation, continuation-in-part and substitute applications for said invention or improvements, and any necessary oath or affidavit relating thereto, and any application for the reissue or extension of any Letters Patent that may be granted upon said application, and any and all applications and other documents for Letters Patent in foreign countries on said invention or improvements, that said assignee, its successors or assigns, may deem necessary or expedient, and for the said consideration the undersigned further agrees upon the request of said assignee, its successors or assigns, in the event of any application or Letters Patent assigned herein becoming involved in Interference, to co-operate to the best of the ability of the undersigned with said assignee, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, the undersigned hereby agreeing to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein hereby conveyed in the said assignee, its successors and assigns, whereby said Letters Patent will be held and enjoyed by the said assignee, its successors and assigns, to the full end of the term for which said Letters Patent may be granted as fully and entirely as the same would have been held and enjoyed by the undersigned if this assignment and sale had not been made.
WITNESS my hand and seal, this 13 day of September Nineteen
----------------- ----------
Hundred and Eighty-Five.
State of California RECORDED
-----------
County of Ventura
Lawrence M. Souza
|
On this 13/th/ day of September, 1985, before me, a Notary Public in and
for the County and State aforesaid, appeared Lawrence M. Souza
to me personally known to be the same person whose name is subscribed to the foregoing instrument, and acknowledged that he executed said instrument as his free and voluntary act and for the uses and purposes therein expressed. WITNESS my hand and seal the day and year last above given.
BY AND BETWEEN
KIRIN BREWERY CO., LTD.,
a Japanese corporation,
and
KIRIN-AMGEN, INC.,
a California corporation
Dated: July 1, 1986
EXHIBIT "C"
TABLE OF CONTENTS (cont'd.)
PAGE
----
RECITALS................................................................ 1
I. TRANSFER OF TECHNOLOGY....................................... 1
1.01 Assignment of G-CSF Transferred Technology........... 1
1.02 Limitations.......................................... 1
II. DEFINITIONS.................................................. 1
2.01 Incorporation by Reference........................... 1
2.02 G-CSF (PPO) Technology............................... 2
III. DISCLAIMER OF INDEMNIFICATION................................ 2
3.01 Disclaimer of Warranties............................. 2
IV. TERM AND TERMINATION......................................... 2
4.01 Term................................................. 2
V. CONSISTENCY WITH SHARHOLDERS' AGREEMENT...................... 2
5.01 Shareholders' Agreement................................ 2
VI. CONSENTS AND APPROVALS....................................... 2
6.01 Best Efforts......................................... 2
VII. NOTICE....................................................... 3
7.01 Notices.............................................. 3
VIII. MISCELLANEOUS................................................ 3
8.01 Entire Agreement..................................... 3
8.02 Headings............................................. 4
8.03 Execution in Counterparts.............................. 4
8.04 Force Majeure........................................ 4
8.05 Applicable Law....................................... 4
8.06 Assignment on Written Consent........................ 4
8.07 Severability......................................... 4
8.08 No Waiver............................................ 4
8.09 Trademarks and Tradenames............................ 4
8.10 Indemnity............................................ 5
8.11 Other Agreements..................................... 5
8.12 Attorney's Fees and Costs............................ 5
8.13 Remedies............................................. 5
8.14 Binding Effect....................................... 5
|
8.15 Exhibits....................................... 5
8.16 Number and Gender.............................. 6
8.17 Representations................................ 6
8.18 Agreement to-Perform Necessary Acts............ 6
SIGNATURE PAGE................................................ 6
|
SCHEDULE "A"-TRANSFERRED TECHNOLOGY
ASSIGNMENT AGREEMENT
THIS ASSIGNMENT AGREEMENT ("Agreement") is made and entered into this 16th day of October, 1986, and is made effective as of the lst day of July, 1986, by and between KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), in favor and for the benefit of and with KIRIN-AMGEN, INC., a California corporation ("Company"), pursuant to terms and conditions of that certain Amendment No. 4 to the Shareholders' Agreement, dated May 11, 1984 (collectively "Shareholders' Agreement"), by and among Kirin, Company and Amgen, a California corporation ("Amgen").
R E C I T A L S
WHEREAS, Kirin, Amgen and Company have heretofore executed Amendment No. 4 to the Shareholders' Agreement regarding the simultaneous transfer of Kirin's G-CSF (PPO) Transferred Technology (as defined in Section 2.02 hereof) and Amgen's G-CSF (PPO) Transferred Technology to Company, together with a license of Amgen's Core Technology in the Field of Activity with respect to G-CSF to Company, and
WHEREAS, the parties desire to formalize Kirin's transfer as described in the immediately preceding Recital,
NOW, THEREFORE, it is agreed as follows:
1.02 Limitations. No right or license is granted to
the Company hereunder except as expressly specified in
Section 1.01 hereof.
obtained from any governmental authority with respect to the provisions hereof.
"Kirin" Kirin Brewery Co., Ltd.
26-1, Jingumae 6-chome
Shibuy-ku, Tokyo 150
Japan
Telex No. 242-5401 KIRINB J
Attn: General Manager of
Pharmaceuticals Department
"Company" Kirin-Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 499440 (AMGEN)
Attn: Corporate Secretary
With a copy to: PETTIT & MARTIN
355 South Grand Avenue
Thirty-Third Floor
Los Angeles, California 90071
U.S.A.
Telex No. 181025 Pemlaw LSA
Attn: Joel S. Marcus, Esq.
|
Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 7.01.
hereof and may not be modified except by a writing signed by authorized representatives of the parties hereto.
IN WITNESS WHEREOF, Kirin and the Company have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
KIRIN BREWERY CO., LTD.,
a Japanese corporation
By: /s/ Yasushi Yamamoto,
Yasushi Yamamoto,
Managing Director
|
KIRIN-AMGEN, INC., a California corporation
By: /s/ George B. Rathmann
George B. Rathmann, President
|
U.S. Patent Application Ser. No. 768959, Filed August 23, 1985, entitled Production of Pluripotent Granolocyte Colony-Stimulating Factor, recorded in the Patent and Trademark Office on Reel 4476, Frame 913.
SCHEDULE A
Pursuant to the Minutes of Corporation dated July 1, 1986, the parties have made certain business agreements regarding non-dialysis indications for EPO and wish to formalize said agreements.
NOW, THEREFORE, it is agreed as follows:
Corporation shall not reimburse either Kirin or Amgen for non-dialysis expenses relating to the EPO project.
Neither Kirin nor Amgen shall have the obligation to pay to Corporation any royalties with respect to sales of EPO for non-dialysis indications.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 5 to be executed as of the first day written above
by their duly authorized representatives in a manner legally binding upon them.
KIRIN BREWERY CO., LTD., a
Japanese corporation
By /s/ Yashushi Yamamoto
Yashushi Yamamoto
Managing Director
"Kirin"
|
AMGEN, a California corporation
By /s/ George B. Rathmann
George B. Rathmann,
President
"Amgen"
|
KIRIN-AMGEN, Inc., a
California corporation
By /s/ Yasushi Yamamoto
Yashushi Yamamoto its Chairman
"Corporation"
|
BY AND BETWEEN
AMGEN,
a California corporation,
and
KIRIN-AMGEN, INC.,
a California corporation
Dated July 1, 1986
TABLE OF CONTENTS
PAGE
----
RECITALS....................................................... 1
I. TRANSFER AND LICENSE OF TECHNOLOGY...................... 1
1.01 Assignment of Transferred G-CSF Technology......... 1
1.02 License of Core Technology......................... 1
1.03 Right to Sublicense the Core Technology............ 2
1.04 Limitations........................................ 2
II. DEFINITIONS............................................. 2
2.01 Incorporation by Reference......................... 2
2.02 G-CSF (PPO) Technology............................. 2
III. DISCLOSURE OF CORE TECHNOLOGY........................... 3
3.01 Limitation on Usage................................ 3
3.02 Survival........................................... 3
IV. PATENT, COPYRIGHT AND TRADE SECRET ENFORCEMENT.......... 3
4.01 Enforcement........................................ 3
4.02 Notice of Infringements............................ 4
V. PATENT APPLICATIONS AND COPYRIGHT REGISTRATIONS......... 4
5.01 Applications....................................... 4
VI. DISCLAIMER OF INDEMNIFICATION........................... 4
6.01 Disclaimer of Warranties........................... 4
VII. TERM AND TERMINATION.................................... 4
7.01 Term............................................... 4
7.02 Default............................................ 4
7.03 Continuing Obligations............................. 5
|
TABLE OF CONTENTS (Cont'd)
PAGE
----
VIII. CONSISTENCY WITH SHARHOLDERS' AGREEMENT
8.01 Shareholders' ............................................... 5
IX. CONSENTS AND APPROVALS ............................................. 5
9.01 Best Efforts................................................. 6
X. NOTICE
10.01 Notices ..................................................... 6
XI. MISCELLANEOUS ...................................................... 7
11.01 Entire Agreement............................................ 7
11.02 Headings.................................................... 7
11.03 Execution in Counterparts................................... 7
11.04 Force Majeure............................................... 7
11.05 Applicable Law.............................................. 7
11.06 Assignment on Written Consent............................... 7
11.07 Severability................................................ 7
11.08 No Waiver................................................... 7
11.09 Trademarks and Tradenames................................... 8
11.10 Indemnity................................................... 8
11.11 Other Agreements............................................ 8
11.12 Attorney's Fees and Costs................................... 8
11.13 Remedies.................................................... 8
11.14 Binding Effect.............................................. 9
11.15 Exhibits.................................................... 9
11.16 Number and Gender........................................... 9
11.17 Representations............................................. 9
11.18 Agreement to Perform Necessary Act.......................... 9
SCHEDULE "A"
TRANSFERRED TECHNOLOGY.............................................. 10
|
ASSIGNMENT AND LICENSE AGREEMENT
THIS ASSIGNMENT AND LICENSE AGREEMENT ("Agreement") is made and entered into this 16th day of October, 1986, and is made effective as of the 1st day of July, 1986, by and between AMGEN, a California corporation ("Amgen"), in favor and for the benefit of and with KIRIN-AMGEN, INC., a California corporation ("Company"), pursuant to terms and conditions of that Amendment No. 4 to the Shareholders' Agreement, dated May 11, 1984 (collectively "Shareholders' Agreement"), by and among Amgen, Company and Kirin Brewery Co., Ltd., a Japanese corporation ("Kirin").
R E C I T A L S
WHEREAS, Kirin, Amgen and Company have heretofore executed Amendment No. 4 to the Shareholders' Agreement regarding the simultaneous transfer of Kirin's G- CSF (PPO) Transferred Technology (as defined in Section 2.02 hereof) and Amgen's G-CSF (PPO) Transferred Technology to Company, together with a license of Amgen's Core Technology in the Field of Activity with respect to G-CSF to Company, and
WHEREAS, the parties desire to formalize Amgen's transfer and license as described in the immediately preceding Recital,
NOW, THEREFORE, it is agreed as follows:
creditors or otherwise acknowledge insolvency, or be adjudged bankrupt, (c) go or be placed in a process of complete liquidation other than in connection with a continuation of the business of the Company in some other legal form, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment; then, and in any such event, the non-breaching party, at its option, may terminate its obligations to and the rights of the Defaulting Party under the license to the Core Technology granted under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.
"Amgen" Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Cooley, Godward, Castro,
Huddleson & Tatum
One Maritime Plaza, 20th Floor
San Francisco, CA 94111
U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
"Company" Kirin-Amgen, Inc.
1900 Oak Terrace-Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: PETTIT & MARTIN
355 South Grand Avenue
Thirty-Third Floor
Los Angeles, California 90071
U.S.A.
Telex No. 181025 Pemlaw LSA
Attn: Joel S. Marcus, Esq.
|
Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 10.01.
other or further exercise thereof or the exercise of any other right, power or remedy hereunder or the remedies provided by law.
IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
AMGEN, a California corporation
By: /s/ George B. Rathmann
George B. Rathmann Its President
|
KIRIN-AMGEN, INC., a California corporation
By: /s/ Y. Yamamoto
Yasushi Yamamoto Its Chairman
|
U.S. Patent Application Ser. No. 768959, Filed August 23, 1985, entitled Production of Pluripotent Granolocyte Colony-Stimulating Factor, recorded in the Patent and Trademark Office on Reel 4475 Frame 913.
SCHEDULE A
G-CSF EUROPEAN LICENSE AGREEMENT
by and between
KIRIN-AMGEN, INC.,
a California corporation
and
AMGEN,
a California corporation
Dated: December 30, 1986
Page
----
RECITALS................................................................ 1
I. DEFINITIONS........................................................ 2
1.01 Incorporation by Reference.................................. 2
1.02 Territory................................................... 2
1.03 Party....................................................... 2
1.04 G-CSF Products.............................................. 2
1.05 Subsidiary.................................................. 2
1.06 Net Sales................................................... 3
1.07 Sales value................................................. 3
II. GRANT OF LICENSE................................................... 3
2.01 Grant of License............................................ 3
2.02 Rights to Sublicense........................................ 3
2.03 License Fee................................................. 5
III. DISCLOSURE......................................................... 6
3.01 Disclosure.................................................. 6
3.02 Confidentiality............................................. 6
IV. ROYALTY............................................................ 8
4.01 Royalty..................................................... 8
4.02 Sales to Subsidiaries....................................... 8
4.03 Payment of Royalties to Sloan Kettering Cancer Center....... 8
4.04 Records..................................................... 9
4.05 Terms of Accounting......................................... 9
4.06 Late Payments............................................... 10
4.07 Payments.................................................... 11
4.08 Taxes....................................................... 11
V. CLINICAL TRIAL EXPENSE REIMBURSEMENT, TERMINATION OF COMPANY
FUNDING AND NO FURTHER DATA TRANSFER............................... 11
5.01 Reimbursement of European Clinical Trial Expenses........... 11
5.02 Termination of Company Funding.............................. 11
VI. PATENT APPLICATIONS................................................ 12
6.01 Patent Applications......................................... 12
|
Page
----
VII. PATENT AND TRADE SECRET ENFORCEMENT............................. 12
7.01 Enforcement................................................ 12
7.02 Infringements.............................................. 13
7.03 Maintenance of Action...................................... 13
VIII. TERM AND TERMINATION............................................ 15
8.01 Term....................................................... 15
8.02 Effective Date............................................. 15
8.03 Default.................................................... 15
8.04 Survival................................................... 16
IX. INFRINGEMENTS................................................... 16
9.01 Infringements.............................................. 16
X. CONSENTS AND APPROVALS.......................................... 17
10.01 Best Efforts.............................................. 17
XI. NOTICE.......................................................... 17
11.01 Notices................................................... 17
XII. MISCELLANEOUS................................................... 18
12.01 Entire Agreement.......................................... 18
12.02 Headings.................................................. 19
12.03 Execution in Counterparts................................. 19
12.04 Force Majeure............................................. 19
12.05 Applicable Law............................................ 19
12.06 Assignment on Written Consent............................. 20
12.07 Severability.............................................. 20
12.08 No Waiver................................................. 20
12.09 Trademarks and Tradenames................................. 20
12.10 Indemnity................................................. 21
12.11 Other Agreements.......................................... 21
12.12 Remedies.................................................. 21
12.13 Attorneys' Fees and Costs................................. 22
12.14 Number and Gender......................................... 22
12.15 Agreement to Perform Necessary Acts....................... 22
12.16 Representations........................................... 23
SIGNATURE PAGE.......................................................... 23
EXHIBIT "A" - TERRITORY OF EUROPE
|
THIS AMGEN/KIRIN-AMGEN, INC. G-CSF EUROPEAN LICENSE AGREEMENT ("Agreement") is made and entered into and is made effective as of this 30th day of December, 1986, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN, a California corporation, in the process of reincorporating in Delaware ("Amgen").
R E C I T A L S
WHEREAS, effective July 1, 1986, KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), and Amgen assigned all of their right, title and interest in and to the G-CSF Technology (as defined herein) to Company,
WHEREAS, Kirin and Amgen have each been granted a license by Company for the development, manufacture and sale of G-CSF Products (as defined herein), in Japan with respect to Kirin, and in the United States with respect to Amgen, and
WHEREAS, Company now desires to grant to Amgen an exclusive license to further develop, manufacture, and sell G-CSF Products for the territory of Europe (as defined herein),
NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:
ARTICLE I
expression system which will enable the achievement of a high level of expression and purification to produce sufficient materials for commercial development and marketing) for the manufacture of G-CSF Products (as defined herein).
ARTICLE II
(a) Amgen shall have no right to grant sublicenses for the marketing of G-CSF Products in the United Kingdom, France or Germany.
(b) The Company grants to Amgen the right to grant sublicenses for the manufacturing and marketing of G-CSF
Products only to an Amgen subsidiary in Italy, Belgium, The Netherlands, Luxembourg and Spain; provided, however, that Amgen shall have the right to grant sublicenses to a third party in any of the countries set forth in the preceding part of this sentence if local governmental laws, regulations, rules or policies militate that Amgen contract with a local third party in such country in order to effectively market G-CSF Products in such countries.
(C) The Company grants to Amgen the right to grant sublicenses for the marketing of G-CSF products in countries other than those listed in Subparagraphs (a) and (b) of this Paragraph 2.02 within the limit and the scope of the right and license granted by the Company to Amgen in Paragraph 2.01 hereof.
No sublicenses shall be granted under subparagraphs (b) and (c) hereof without the prior written consent (which consent is not to be unreasonably withheld) of the Company. Any sublicensees of Amgen shall undertake in writing to be bound by the provisions of Section 3.02 hereof to the same extent Amgen is bound. Amgen shall notify the Company of the identity of each sublicensee to whom a sublicense is granted and provide the Company a true copy of such sublicense. In the event that the license granted to Amgen hereunder is terminated at any time in accordance with Article VIII, and the Company shall not be in default under Section 8.03, the Company shall have the option to terminate or to have Amgen assign to
the Company, retroactive to the date of such termination, any sublicenses granted hereunder by Amgen to any Subsidiary of Amgen. Amgen shall include, in all its sublicenses granted hereunder to any Subsidiary of Amgen, provisions for such termination and assignment.
(a) $1,000,000 (U.S.) - Execution of this Agreement;
(b) $500,000 (U.S.) - Publication of the Company's PCT Patent Application 86/01708, but in no event later than March 31, 1987;
(c) $1,500,000 (U.S.) - Filing Registration in any country in the Territory;
(d) $1,500,000 (U.S.) - Approval of Registration in any major country in the Territory; and
(e) $1,500,000 (U.S.) - Commencement of Marketing in any country in the Territory.
ARTICLE III
(a) The Company shall, in accordance with the Shareholders' Agreement, reasonably disclose and deliver to Amgen all G-CSF Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.
(b) Amgen shall have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the G-CSF Technology. Amgen shall be provided with reasonable notice of the time and place of such meetings.
(a) Any secret or confidential G-CSF Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:
(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and
(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Amgen within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.
(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, or by another prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential G-CSF Technology disclosed or provided to Amgen by the Company. For the purposes of this Agreement, G-CSF Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:
(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;
(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;
(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Amgen in breach of this Agreement; or
(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality.
Amgen may disclose any G-CSF Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the G-CSF Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.
(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.
ARTICLE IV
and Sloan-Kettering Cancer Center ("S-K") dated February 12, 1986, certain royalties are to be paid to S-K with respect to sales of G-CSF Products. The parties hereto agree that Company and Amgen shall equally bear and assume responsibility for the payments of any and all royalties due S-K for sales of G- CSF Products in Europe pursuant to the S-K/Amgen Agreement.
(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st,
commencing with the semiannual period within which is made the first sale of G- CSF Products by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all G-CSF Products sold during such semiannual period, the Sales Value of such G-CSF Products and the amount of royalty payable thereon (or if no G-CSF Products have been so sold, showing that fact).
(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.
(c) Amgen shall furnish whatever additional information the Company may reasonable prescribe from time to time to enable the Company to ascertain which G-CSF Products sold by Amgen or any of its Subsidiaries or sublicensees permitted under this Agreement are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.
ARTICLE V
CLINICAL TRIAL EXPENSE REIMBURSEMENT,
TERMINATION OF COMPANY FUNDING AND NO
cessation of such Company funding, Amgen shall no longer have any obligation to
transfer any data to Company regarding that country with respect to G-CSF
Technology. Notwithstanding the foregoing, Company shall have the continuing
obligation with respect to the filing of patent applications as set forth in
Section 6.01 hereof.
ARTICLE VI
ARTICLE VII
property right relating to the G-CSF Technology that Amgen shall have obtained pursuant to this Agreement.
proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the G-CSF Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Amgen in such suit or action, Amgen shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option, be represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement, after payment to the Company of such reasonable
costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.
ARTICLE VIII
continuation of the business of the Company in some other legal form, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.
ARTICLE IX
patent rights or proprietary rights of others by reason of the exploitation by Amgen of G-CSF Technology or any component thereof, then the Company shall indemnify and hold Amgen harmless from such claim to the full extent of any damage recovery with respect to such claim and legal costs incurred in Amgen's defense.
ARTICLE X
ARTICLE XI
"Amgen" Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 499-9315 (AMGEN)
Attn: Corporate Secretary
With a copy to: Cooley, Godward, Castro,
Huddleson & Tatum
One Maritime Plaza, 20th Floor
San Francisco, CA 94111
U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
"Company" Kirin-Amgen, Inc
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Pettit & Martin
355 South Grand Avenue
Thirty-Third Floor
Los Angeles, CA 90071
Telex No. 181025 PEMLAW LSA
Attn: Joel S. Marcus, Esq.
|
Any party by giving notice to the others in the manner provided above may change such party's address for purposes of this Section 11.01.
ARTICLE XII
by authorized representatives of the parties hereto. To the extent that there may be conflicts or inconsistencies between the provisions of this Agreement and those contained in the Shareholders' Agreement, the provisions of the Shareholders' Agreement shall prevail and govern interpretation.
or hereafter existing at law or in equity or by statute or otherwise and the exercise or beginning of the exercise by any party of any one or more of such rights, powers or remedies shall not preclude the simultaneous or later exercise by any party of any or all such other rights, powers or remedies.
IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
KIRIN-AMGEN, INC., a
California corporation
By /s/ George B. Rathmann
Its President
---------
"Company"
|
AMGEN, a California corporation, in the process of reincorporating in Delaware
By /s/ Robert D. Weist
Its Sr. Vice President
------------------
"Amgen"
|
[MAP OF THE LICENSED TERRITORY]
EXHIBIT 10.12
AMGEN RETIREMENT
AND SAVINGS PLAN
(As Amended and Restated Effective October 23, 2000)
(As Amended and Restated Effective October 23, 2000)
The Plan was adopted effective as of April 1, 1985. The Plan was last amended and restated as of April 1, 1996, to reflect previously adopted amendments and to make other changes. Certain provisions may be effective at other times, as specified. The Plan is intended to qualify under Sections 401(a) and 401(k) and related sections of the Code, and under Section 407(d)(3)(A) of ERISA. The Plan is subject to amendment or termination at any time, including (without limitation) amendments required to meet regulations and rules issued by the Secretary of the Treasury or his or her delegate or the Secretary of Labor. Certain capitalized terms used in the text of the Plan are defined in Article 2 in alphabetical order.
2.6 "Annual Additions" which is a term used in specifying certain limitations
----------------
on Plan contributions, is defined in Section 16.5.
2.7 "Annual Deferral Limit" which is a term used in specifying certain
---------------------
limitations on Plan contributions, is defined in Section 13.9.
2.8 "Beneficiary" means the person or persons entitled to receive a
-----------
Participants Plan Benefit after the Participant's death, as provided in
Section 8.12.
2.9 "Board" means the Board of Directors of the Company, as constituted from
-----
time to time.
2.10 "Break in Service" means any Plan Year during which the Participant
----------------
completes less than 501 Hours of Service. Solely for the purpose of
determining whether a Break in Service has occurred, an Employee who is
absent from work by virtue of (a) the Employee's pregnancy, (b) the birth
of the Employee's child, (c) the placement of a child with the employee by
adoption, (d) the change for any such child for a period of up to one year
immediately following such birth or placement, (e) Disability, (f) service
in the armed forces of the United States during a period (including a
post-discharge period) that entitles the Employee to reemployment rights
guaranteed by law or (g) a leave of absence taken under the terms of the
federal Family Medical Leave Act or applicable state family and medical
leave act, shall be credited with up to 501 additional Hours of Service.
Such additional Hours of Service in such period of absence shall be based
on his or her regular work schedule immediately prior to such period;
provided, however, that such additional Hours of Service shall be credited
during the Plan Year in which the absence from work begins only if they
would prevent a Break in Service from occurring for that year. In all
other cases, the additional Hours of Service shall be credited during the
immediately following Plan Year.
2.11 "Code" means the Internal Revenue Code of 1986, as amended from time to
----
time.
2.12 "Company" means Amgen Inc., a Delaware corporation.
-------
2.13 "Company Contributions" means Matching Contributions, Nonelective
---------------------
Contributions, Qualified Nonelective Contributions and Qualified Matching
Contributions.
2.14 "Company Stock" means shares of common stock issued by the Company.
-------------
2.15 "Company Stock Fund" means an Investment Fund primarily invested in
------------------
Company Stock.
|
amount with respect to which Plan contributions are made and means an
Eligible Employee's wages, salaries, fees for professional services, and
other amounts received (without regard to whether or not an amount is paid
in cash) for personal services actually rendered in the course of
employment with any member of the Affiliated Group to the extent that the
amounts are includable in gross income (including, but not limited to,
commissions paid to salespersons, compensation for services on the basis
of a percentage of profits, commissions on reimbursements or other expense
allowances under a nonaccountable plan (as described in Treasury
Regulation Section 1.62-2(c)), but excluding any "goods and services
---------
allowance" provided to certain expatriate staff members. "Compensation"
shall be computed without regard to any election to reduce or defer salary
under this Plan or any cafeteria plan under Section 125 of the Code.
"Compensation" shall not include: (a) any Company Contributions to this
Plan or any other employee benefit plan for or on account of the Employee,
except as otherwise provided in the preceding sentence; (b) the items
described in Treasury Regulation Section 1.415-2(d)(3), which, among other
items, would exclude from compensation amounts realized from the exercise
of a nonqualified stock option (or when restricted stock (or property)
held by an Employee either becomes freely transferable or is no longer
subject to a substantial risk of forfeiture under Section 83 of the Code)
and amounts realized from the sale, exchange or other disposition of stock
acquired under a qualified stock option; or (c) amounts in excess of the
Compensation Limitation.
2.17 "Compensation Limitation" means the limitation in effect under Section
-----------------------
401(a)(17) of the Code for the Plan Year.
2.18 "Disability" means that the Participant is determined, under Title II or
----------
XVI of the Social Security Act, to have been disabled at the time of his
or her termination of employment. In order for a Participant's Accounts to
become fully vested on account of Disability pursuant to Sections 7.2 and
7.3 of the Plan, the Participant must submit evidence of the Social
Security Administration's determination of disability to the Company prior
to the distribution (or deemed distribution) of the Participant's
Accounts.
2.19 "Eligible Employee" means an Employee described in Section 3.3.
-----------------
2.20 "Employee" means an individual who (a) on the Payroll of a member of the
--------
Affiliated Group or (b) is a "leased employee" (within the meaning of
Section 414(n) of the Code) with respect to a member of the Affiliated
Group. "Employee" shall not include a nonresident alien who receives no
earned income (within the meaning of Section 911(b) of the Code) from a
member of the Affiliated Group that constitutes income from sources within
the United States (within the meaning of Section 861(a)(3) of the Code).
3
|
2.21 "Employee Contributions" means Participant Elected Contributions and
----------------------
Rollover Contributions.
2.22 "ERISA" means the Employee Retirement Income Security Act of 1974 (P.L.
-----
93-406), as amended.
2.23 "Excess Aggregate Contributions" which is a term used in specifying
------------------------------
certain limitations on Plan contributions, is defined in Section 14.7.
2.24 "Excess Contributions" which is a term used in specifying certain
--------------------
limitations on Plan contributions, is defined in Section 13.9.
2.25 "Excess Deferrals" which is a term used in specifying certain limitations
----------------
on Plan contributions, is defined in Section 13.9.
2.26 "Exchange Act" means the Securities Exchange Act of 1934, as amended, and
------------
regulations promulgated thereunder.
2.27 "Five-Year Break in Service" means five or more consecutive one-year
--------------------------
Breaks in Service.
2.28 "Forfeiture" is defined in Section 7.4.
----------
2.29 "Fund" or "Investment Fund" means a separate fund in which contributions
---- ---------------
to the Plan are invested in accordance with Article 6.
2.30 "Hardship Withdrawal" is a partial distribution of a Participant's
-------------------
Account made while he or she is an Employee and in the limited
circumstances described in Section 11.2.
2.31 "Highly Compensated Employee" is defined in Article 12.
---------------------------
2.32 "Hour of Service" means:
---------------
(a) Each hour for which an Employee is directly or indirectly paid, or
entitled to payment, by a member of the Affiliated Group for the
performance of services;
(b) Each hour for which an Employee is directly or indirectly paid, or
entitled to payment, by a member of the Affiliated Group on account of
a period of time during which no services are performed (without
regard to whether the employment relationship between the Employee and
the member of the Affiliated Group has terminated) due to vacation,
holiday, illness, incapacity, disability, layoff, jury duty, military
duty or leave of absence with pay; and
4
|
(c) Each hour for which an Employee is directly or indirectly paid, or
entitled to payment of an amount as back pay (without regard to
mitigation of damages) either awarded or agreed to by a member of the
Affiliated Group.
The foregoing notwithstanding:
(1) No more than 501 Hours of Service shall be credited to an Employee
under Subsection (b) or (c) above on account of any single
continuous period of time during which no services are performed.
(2) An hour for which an Employee is directly or indirectly paid or
entitled to payment by a member of the Affiliated Group on account
of a period during which no services are performed shall not
constitute an Hour of Service hereunder if such payment is made or
due under a plan maintained solely for the purpose of complying
with applicable workers' compensation, unemployment compensation
or disability insurance laws.
(3) Hours of Service shall not be credited for payments that solely
reimburse an Employee for medical or medically related expenses.
(4) The same Hour of Service shall not be credited to an Employee both
under Subsection (a) or (b) and under Subsection (c).
(5) The computation period to which Hours of Service determined under
Subsection (b) or (c) are to be credited shall be determined under
applicable federal law and regulations, including, without
limitation, Department of Labor Regulation Section 2530.200b-2(b),
(c) and (d).
The Company shall determine the number of Hours of Service, if any, to
be credited to an Employee under the foregoing rules in a uniform and
nondiscriminatory manner and in accordance with applicable federal laws
and regulations, including, without limitation, Department of Labor
Regulation Section 2530.200b-3.
|
2.35 "Participating Company" means the Company, and any other member of the
---------------------
Affiliated Group that the Company has designated in writing as a
Participating Company, as set forth on Appendix A.
2.36 "Payroll" means the system used by an entity to pay those individuals it
-------
regards as its employees for their services and to withhold federal income
and employment taxes from the compensation it pays to such employees.
"Payroll" does not include any system the entity uses to pay individuals
whom it does not regard as its employees and for whom it does not actually
withhold federal income and employment taxes (including, but not limited
to, individuals it regards as independent contractors, consultants or
employees of temporary employment agencies).
2.37 "Plan" means the Amgen Retirement and Savings Plan, as amended from time
----
to time.
2.38 "Plan Benefit" means the Participant's Accounts under the Plan, to the
------------
extent vested.
2.39 "Plan Year" means the calendar year.
---------
2.40 "QDRO" means a qualified domestic relations order (as defined in Section
----
414(p) of the Code).
2.41 "Qualified Joint and Survivor Annuity" means an annuity for the life of
------------------------------------
the Participant with a survivor annuity for the life of his or her spouse
that is not less than fifty percent (50%) nor more than one hundred
percent (100%) of the amount of the annuity payable during the joint lives
of the Participant and his or her spouse. The value of the Qualified Joint
and Survivor Annuity shall be not less than the value of the Participant's
nonforfeitable interest in his or her Account.
2.42 "Rollover Contribution" means an amount contributed to the Plan by an
---------------------
Eligible Employee pursuant to Section 4.5.
2.43 "Salary Deferral Agreement" means the agreement between the Participating
-------------------------
Company and an Employee to reduce the Employee's Compensation as provided
for in Article 4.
2.44 "Section 414(s) Compensation" which is a term used in specifying certain
---------------------------
limitations on Plan contributions, is defined in Section 13.9.
2.45 "Section 415 Compensation" which is a term used in specifying certain
------------------------
limitations on Plan contributions, is defined in Section 16.5.
6
|
2.46 "Section 415 Employer Group" which is a term used in specifying certain
--------------------------
limitations on Plan contributions, is defined in Section 16.5.
2.47 "Single Life Annuity" means an annuity under which payments are made to a
-------------------
person for his or her life and cease upon his or her death.
2.48 "Top-Paid Group" which is used in the definition of the term "Highly
--------------
Compensated Employee", is defined in Section 12.4(a).
2.49 "Total Compensation" which is used in the definition of the term "Highly
------------------
Compensated Employee", is defined in Section 12.4(b).
2.50 "Trust Agreement" means the trust agreement entered into pursuant to the
---------------
Plan by the Company and the Trustee, as amended from time to time.
2.51 "Trustee" means the trustee or trustees appointed by the Company pursuant
-------
to the Plan to hold the assets of the Plan in trust, and any successor
trustee(s) so appointed.
2.52 "Trust Fund" means the trust fund consisting of the assets of the Plan and
----------
maintained by the Trustee pursuant to the Plan and the Trust Agreement.
2.53 "Valuation Date" means the date on which the assets of the Plan are
--------------
valued, determined in accordance with the Trust Agreement.
2.54 "Year of Service" means:
---------------
(a) For purposes of vesting, each Plan Year or portion thereof during
which an Employee is credited with at least 1,000 Hours of Service.
(b) For purposes of determining eligibility, the first "computation
period" in which the Employee completes at least 1,000 Hours of
Service. An Employee's initial computation period is the 12-
consecutive-month period following the Employee's employment
commencement date. If the Employee does not complete at least 1,000
Hours of Service during the first computation period, subsequent
computation periods are each Plan Year, beginning with the Plan Year
in which the first anniversary of the Employee's employment
commencement date falls.
|
(a) Regular Full-Time Employee. Unless excluded under (c) below, an individual classified by a Participating Company as a "regular full- time employee" is an Eligible Employee.
(b) Regular Part-Time Employee. Unless excluded under (c) below, an individual classified by a Participating Company as a "regular part- time employee" shall become an Eligible Employee upon completion of a Year of Service.
(c) Excluded Individuals. An individual shall not be an Eligible Employee for any period in which he or she is:
(1) Included in a unit of employees covered by a collective- bargaining agreement that does not provide that such individual shall be eligible to participate in the Plan;
(2) Not on the Payroll of a Participating Company, even though such person may be deemed, for any reason, to be an employee;
(3) Subject to an oral or written agreement that provides that such individual shall not be eligible to participate in the Plan;
(4) Employed by a non-U.S. subsidiary of the Company;
(5) Classified by a Participating Company as a "leased employee" (within the meaning of Section 414(n) of the Code) with respect to such Participating Company or would be so classified but for the period-of-service requirement of Code Section 414(n)(2)(B); or
(6) A temporary employee, independent contractor, consultant, or any other person or entity for whom a Participating Company does not withhold federal income and employment taxes from such person's or entity's compensation.
If, during any period, a Participating Company has not regarded an individual as an Employee and, for that reason, has not withheld employment taxes with respect to that individual, then that individual shall not be an Eligible Employee for that period, even in the event that the individual is determined, retroactively, to have been an Employee during all or any portion of that period.
(a) Neither receives nor is entitled to receive any Compensation, including (without limitation) any leave of absence without pay; or
(b) Does not qualify as an Eligible Employee but remains a Participant.
In accordance with Section 10.8 and 11.4, participation is also suspended for 12 months if a Participant defaults on a Plan loan or takes a Hardship Withdrawal. A Participant shall not make Participant Elected Contributions or receive any allocation of Company Contributions with respect to a period of suspended participation, but a suspended Participant's Accounts shall remain invested as a part of the Trust Fund and shall continue to share in the gains, income, losses and expenses of the Trust Fund.
contribution. Subject to the limitations set forth in Section 4.4 and Articles 13-16, the amount of the Participant Elected Contributions shall be equal to any whole percentage of his or her Compensation, as the Participant shall elect, except that this whole percentage shall not exceed 15 percent of his or her Compensation. Participant Elected Contributions shall be made through payroll deductions from the Participant's Compensation. If a Participant elects to make Participant Elected Contributions, the contributions shall be deemed to be employer contributions to the Plan for federal income tax purposes and, to the extent permitted, for purposes of other federal, state and local taxes. A Participant's election to make Participant Elected Contributions shall constitute an election to have the Participant's taxable salary or wages from the Participating Company reduced by the amount of the Participant Elected Contributions.
(a) The contribution is made entirely in the form of U.S. dollars; and
(b) The Eligible Employee demonstrates to the Company's satisfaction that
the contribution is a qualifying rollover contribution under Section
402(c)(4), 403(a)(4) or 408(d)(3) of the Code.
If an Eligible Employee who is not a Participant makes a Rollover Contribution, then he or she shall be considered a Participant solely with respect to his or her Rollover Contribution Account until he or she becomes a Participant for all purposes pursuant to Article 3.
A Rollover Contribution shall be paid to the Company in a lump sum in cash and shall be credited to the Participant's Rollover Account. The Participant may direct the investment of his or her Rollover Account by filing the specified investment election form in accordance with such rules as may be established by the Company.
Matching Contributions formula may limit the amount of Participant Elected
Contributions that are taken into account for purposes of allocating
Matching Contributions or may limit allocations of Matching Contributions
to a specified group of Participants; provided, however, that the Matching
Contribution formula(s) shall not discriminate in favor of Highly
Compensated Employees. A Matching Contribution shall be paid to the Trustee
as soon as reasonably practicable after the pay period to which it relates
and shall be allocated to the Accounts of Participants as provided in
Section 6.5.
Nonelective Contributions may include a core contribution equal to a specified percentage of Compensation to be made by the Company for each payroll period during the Plan Year.
Employees. Qualified Matching Contributions shall be paid to the Trustee as soon as reasonably practicable following the date as of which they are allocated.
disallowance of the deduction. If a Company Contribution or Participant Elected Contribution is made to the Plan by reason of a mistake of fact, the amount contributed by reason of such mistake (reduced by any losses incurred with respect to such amount) shall be returned to the Participating Companies within one year after the date such contribution was made.
Participant who is entitled to a Matching Contribution pursuant to Section
5.1. Matching Contributions shall be allocated as of the last day of the
period for which the Participant received Compensation with respect to
which the Matching Contribution is made.
election is made by a Participant (or successor in interest) who is an officer, director, or greater than 10% stockholder of the Company (within the meaning of Section 16 of the Exchange Act and the rules promulgated thereunder) within six months following the date of the most recent election made under any employee benefit plan sponsored by the Company or an Affiliate if (a) both elections involved either an intra-plan transfer involving a fund invested in the Company's equity securities or a cash distribution from the employee benefit plan to the Participant (or successor in interest) funded by a volitional disposition of the Company's equity securities, (b) the prior election involved an acquisition of the Company's equity securities if the current election involves a disposition of the Company's equity securities, or vice versa, and (c) both elections are made at the volition of the Participant (or successor in interest) not in connection with the Participant's death, disability, retirement, termination of employment, or an election which is required to be made available under a provision of the Code. Such a volitional election (considering without regard as to whether or not any similar elections have occurred within six months of such an election) shall be described as a "Discretionary Transaction." On and after July 1, 1996, transfers into the Company Stock Fund shall be limited so that, after any such transfer, no more than 50% of the value of the Participant's aggregate Account is invested in the Company Stock Fund. For purposes of carrying out Investment Fund transfers, the value of the Accounts shall be determined as of the Valuation Date immediately preceding the Participant's transfer election.
(a) If a Participant's employment with a member of the Affiliated Group is terminated after December 31, 1989 and before his or her Normal Retirement Age for any reason other than Disability or death, in addition to the amounts credited to the Accounts identified in Section 7.1, the Participant shall be entitled to an amount equal to the "vested percentage" of his Matching Contributions Account. Such vested percentage shall be determined in accordance with the following schedule.
Years of Service Vested
---------------- Percentage
----------
Less than 1 0%
1 but less than 2 25%
2 but less than 3 50%
3 but less than 4 75%
4 or more 100%
|
(b) In all events, a Participant's Matching Contributions Account shall be fully vested upon termination of his or her employment with the Company on or after attainment of his or her Normal Retirement Age or by reason of Disability or death.
Account or Matching Contributions Account, as applicable, as of the close of the Plan Year in which the rehire occurs, but only if the Participant returns to the service of a Participating Company before incurring a Five- Year Break in Service. To the extent that Forfeitures for the Plan Year in which the Participant is rehired are insufficient to reinstate the rehired Participant's Forfeiture, then the appropriate Participating Company shall make a special contribution in the amount required to reinstate the Forfeiture.
If a Participant who was not fully vested at the time of his or her termination of employment receives a distribution out of his or her vested Account balance and subsequently returns to a Participating Company's service before incurring a Five-Year Break in Service, a separate account for the Participant's remaining interest in the Plan as of the time of the distribution shall be maintained. At any time, the Participant's vested interest in such account shall be an amount "X" determined in accordance with the following formula:
= P(AB + D) - D
For purposes of such formula, "P" is the vested percentage at the relevant time; "AB" is the account balance at the relevant time and "D" is the amount of the prior distribution.
In the event a Participant's service with a Participating Company terminates and no payment of the Participant's nonforfeitable interest is made, the forfeitable amount of the Participant's interest shall be forfeited after the Participant has incurred a Five-Year Break in Service, as of a Valuation Date determined in a uniform and consistent manner by the Company. In the event the Participant returns to the service of a Participating Company before incurring a Five-Year Break in Service, the Participant's Account shall exist as though no forfeiture had taken place.
(a) Years of Service completed prior to any Break in Service shall not be counted in determining a Participant's nonforfeitable interest under the Plan if, at the time of the earlier termination of employment, the Participant did not have any nonforfeitable interest under the Plan to an accrued benefit derived from Nonelective Contributions or Matching Contributions and the number of the Participant's consecutive one-year Breaks in Service equals or exceeds the greater of five (5) or the aggregate number of his or her Years of Service prior to such Break in Service.
(b) In the case of a Participant who incurs a Five-Year Break in Service, Years of Service completed by such Participant after the Five-Year Break in Service shall not be counted to increase the Participant's nonforfeitable
interest in his or her Account as determined prior to the Five-Year Break in Service.
(a) After the Participant's death, Disability or termination of employment for any other reason;
(b) On or after termination of the Plan, provided that (i) neither the Participating Company nor any Affiliate of the Participating Company maintains a successor defined contribution plan (other than an employee stock ownership plan) and (ii) the Participant's distribution is made in the form of a lump sum;
(c) On or after the disposition, to an entity that is not an Affiliate of the Participating Company, of substantially all of the assets used by the Participating Company in a trade or business, but only with respect to a Participant who continues employment with the entity acquiring such assets, and provided that (i) the Participant's distribution is made in the form of a lump sum and (ii) the Participating Company continues to maintain the Plan following such disposition;
(d) On or after the disposition, to an entity that is not an Affiliate of the Participating Company, of the interest of the Participating Company or an Affiliate of the Participating Company in a subsidiary, but only with respect to a Participant who continues employment with such subsidiary, and provided that (i) the Participant's distribution is made in the form of a lump sum and (ii) the Participating Company continues to maintain the Plan following such disposition; or
(e) As required by applicable law or in connection with a QDRO, as provided in Article 9, or an in-service withdrawal, as provided in Article 11.
(a) Except as provided in Sections 8.5, 8.8 and 8.10, and unless a
Participant elects otherwise, the distribution of a Participant's Plan
Benefit under Section 8.6 shall occur or commence not later than sixty
(60) days after the close of the Plan Year in which occurs the later
of (i) the Participant's attainment of Normal Retirement Age or (ii)
the Participant's termination of employment. If distribution of a
Participant's Plan Benefit has not yet occurred, on or about nine (9)
months before the Participant's Normal Retirement Date, the Company
shall furnish the Participant with a written explanation of the terms,
conditions and forms of distributions available from the Plan
including, where applicable, a general description of the Lifetime
Annuity (as defined in Section 8.7), and with a description of the
procedures for electing a form of distribution.
(b) A Participant may elect to receive or commence receipt of his or her
Plan Benefit at any reasonable time after termination of employment.
If the Participant elects to receive his or her Plan Benefit,
distribution shall in any event commence not later than one (1) year
after the end of the Plan Year (i) in which he or she terminates
employment after attaining Normal Retirement Age or due to Disability,
or (ii) which is the fifth Plan Year following the Plan Year in which
he or she otherwise terminates employment (except by reason of his or
her death). An election under this Subsection must be made in writing,
must be made not more than ninety (90) days before the date the
distribution is to occur or commence and must not be made before the
Participant receives a written notice describing the material features
and explaining the relative values of the optional forms of benefit
available under the Plan, in a manner that would satisfy the notice
requirements of Section 417(a)(3) of the Code. Not less than thirty
(30) days and not more than ninety (90) days before the Participant's
distribution is to occur or commence, the Company shall provide the
Participant with such a written notice, which also shall inform
the Participant of his or her right (if applicable) to defer receipt of his distribution until Normal Retirement Age.
(a) A Participant's Plan Benefit shall be distributed in any of the following forms that he or she elects; provided, however, that only a Participant who has an Hour of Service prior to April 1, 1996 may elect a Lifetime Annuity described in Paragraph (5):
(1) A single sum cash distribution;
(2) A single sum distribution in full shares of Company Stock (with the value of any fractional share paid in cash);
(3) A single sum distribution paid in a combination of cash and full shares of Company Stock;
(4) Cash installments paid at least annually over a period certain not exceeding the life expectancy of the Participant or the joint life expectancy of the Participant and his or her designated Beneficiary. All life expectancies shall be determined not later than the date when payments commence and shall not be redetermined thereafter. The amount of each installment payment shall be determined by dividing the remaining years in the period certain by the value of the Participant's Account; or
(5) Subject to the provisions of Section 8.7, a nontransferable annuity contract that provides for annuity payments at least annually over the lifetime of the Participant or the joint lifetimes of the Participant and his or her designated Beneficiary, and that may provide for a "period certain" feature (a "Lifetime Annuity").
(b) If, by the time for the distribution of a Participant's Plan Benefit in accordance with the foregoing provisions of this Article 8, the Participant has not made any election as to the form of the distribution, payment of his or her Plan Benefit shall be made in the form of a single sum cash distribution.
(c) To the extent that a distribution is to be made in a number of shares of Company Stock that exceeds the number of shares in the Participant's Account under the Company Stock fund, amounts in one or more other Investment Funds comprising the Participant's Account shall be applied to purchase the required additional shares of Company Stock at their fair market value at the time of purchase.
(d) The Company shall establish procedures to notify a Participant (or successor in interest) if any election regarding the form or timing of distribution of benefits from the Plan involving the Company Stock Fund constitutes a Discretionary Transaction (as defined in Section 6.9) which may trigger short-swing trading profits liability for the Participant (or successor in interest) under Section 16(b) of the Exchange Act. In such an event, the person making the election shall be provided with a reasonable opportunity to modify, delay, or revoke such an election.
(1) In the case of a Participant who is legally married on his or her Annuity Starting Date, the normal form of Lifetime Annuity that applies shall be a Qualified Joint and Survivor Annuity.
(2) In the case of a Participant who is not married on his or her Annuity Starting Date, the normal form of Lifetime Annuity that applies shall be a Single Life Annuity.
(1) Not more than ninety (90) days before the Annuity Starting Date, a married Participant who elects to receive a Lifetime Annuity may elect to waive the Qualified Joint and Survivor Annuity form of benefit and to receive payment instead in one of the other forms
specified in Section 8.6(a)(l)-(4) or as a Single Life Annuity. If the Participant elects the form of benefit in Section 8.6(a)(4), he or she also may designate a Beneficiary other than his or her spouse to receive any benefits payable following his or her death. A Participant may revoke any election previously made under this Subsection and may make a new election hereunder any number of times before his or her Annuity Starting Date. A Participant's election or revocation under this Subsection shall be in writing.
(2) An election by a Participant who elects to receive a Lifetime
Annuity to waive the Qualified Joint and Survivor Annuity shall
not be valid unless the Participant has received the notice and
explanation described in Subsection (c) below and the spouse of
the Participant consents in writing to such election in a manner
that satisfies the spousal consent requirements set forth in
Section 8.13, provided that the Participant's election also must
designate a specific alternative form of benefit (as well as a
Beneficiary) that may not be changed without further spousal
consent (unless expressly permitted by the spouse's consent or a
prior consent). Spousal consent is not required in order for a
Participant to reinstate an election to receive a Qualified Joint
and Survivor Annuity, but is required for any subsequent
revocation of the election.
(1) An explanation of the terms and conditions of the normal form of Lifetime Annuity, including the circumstances under which it will be provided if no election is made to waive such form of benefit;
(2) A statement of the Participant's right to make an election to waive the normal form of Lifetime Annuity and an explanation of the effect of such an election;
(3) A statement of the Participant's right to revoke an election to waive the normal form of Lifetime Annuity and an explanation of the effect of such a revocation;
(4) A statement of the right, if any, of the Participant's spouse to consent to the Participant's election to waive the normal form of
Lifetime Annuity and to the Participant's designation of an alternative form of benefit or Beneficiary;
(5) A general explanation of the relative financial impact of an election to waive the normal form of Lifetime Annuity;
(6) A general description of the material features (including eligibility conditions) and an explanation of the relative values of the alternative forms of benefit available under the Plan; and
(7) A statement regarding the availability of the additional information described below in this Subsection (c).
Within thirty (30) days after receipt of a timely written request from the Participant for additional information, the Company shall provide the Participant with a written explanation, in nontechnical language, of the terms and conditions of the alternative forms of benefit available under the Plan and the financial effect (in terms of dollars per monthly payment) upon the Participant's monthly benefit in case of an election to waive the normal form of Lifetime Annuity and receive an alternative form of benefit.
death benefit at any reasonable time after the Participant's death. Such an election must be made in writing not more than ninety (90) days before the date the distribution is to occur or commence. For this purpose, if the Participant's vested Plan Benefit at the time a distribution commences under an installment option pursuant to Section 8.6(a)(4) or a lifetime annuity pursuant to Section 8.7 exceeds $5,000, the value of his or her vested Plan Benefit at all times thereafter will be deemed to exceed $5,000.
(a) Notwithstanding any Beneficiary designation that may be to the contrary, if a Participant who has elected to receive a Lifetime Annuity (and who has not subsequently waived such Lifetime Annuity in accordance with Section 8.7(b)) dies before the Annuity Starting Date with respect to such Lifetime Annuity, and if he or she is married at the time of his or her death, the vested balance in his or her Account shall be applied toward the purchase of a Single Life Annuity for the Participant's surviving spouse.
(b) Except as provided in Subsection (a) above, if a Participant dies before the Annuity Starting Date (i.e., with respect to any form of distribution specified in Section 8.6(a)(l)-(4)), the vested balance in his or her Account shall be distributed to his or her Beneficiary in such form as such Beneficiary may elect from among the alternatives specified in Section 8.6(a)(l)-(3). In the absence of an election by the Beneficiary, payment shall be made in the form designated by the Participant, or, if none, in a single sum cash distribution.
(c) If a Participant dies after the Annuity Starting Date with respect to the form of distribution in effect under Section 8.6, the remaining amounts that had not yet been distributed under such form of distribution, if any, shall be paid to the Participant's Beneficiary in accordance with the applicable terms of such distribution method. In the case of a distribution in the form of an annuity contract (including a Lifetime Annuity) under Section 8.6(a)(4) or (5), the amount and timing of death or survivor benefit payments, if any, shall be as determined under such annuity contract.
9.1 Immediate Distribution.
(a) Any distribution to an Alternate Payee of all or some portion of a Participant's Accounts pursuant to a qualified domestic relations order, shall be made as soon as reasonably practicable after the order is determined to be a QDRO, if:
(1) The QDRO specifies such time of distribution; or
(2) The Alternate Payee has consented in writing to such time of distribution.
(b) Notwithstanding the foregoing, in determining the award to an Alternate Payee under a QDRO, the award to the Alternate Payee shall be derived solely from a portion of the Participant's vested Accounts in the Plan as of the Valuation Date provided in the QDRO.
practicable after the Plan Administrator's receipt of completed distribution forms provided by the Plan Administrator for this purpose.
10.1 Amount of Loan. A Participant may obtain a cash loan from his or her
--------------
Accounts if he or she is an Employee who is not on a leave of absence at
the time of the loan and his or her Plan participation is not suspended
pursuant to Section 3.5. The minimum amount of any such loan shall be
$1,000 at the time the loan is elected. No loan shall be granted under the
Plan if such loan, when aggregated with the Participant's outstanding
loans under any other qualified plans maintained by any member of the
Affiliated Group, would exceed the lesser of:
(a) $50,000, less the amount by which such aggregate balance has been
reduced through repayments during the period of 12 months ending on
the day before the new loan is made; or
(b) One-half of the Participant's vested interest in his or her Accounts.
10.2 Terms of Loans. A loan to a Participant shall be made on such terms and
--------------
conditions as the Company may determine, provided that the loan shall:
(a) Be evidenced by a promissory note signed by the Participant and
secured by one-half of the value of his or her Accounts, to the extent
vested (regardless of the amount of the loan or the source of the loan
funds);
(b) Bear interest at a fixed rate commensurate with the interest rates
charged by major financial institutions for similar loans;
(c) Provide for level amortization over its term with payments at monthly
or more frequent intervals, as determined by the Company;
(d) Provide for loan payments (1) to be withheld whenever possible through
periodic payroll deductions from the Participant's compensation from
any member of the Affiliated Group or (2) to be paid by check or money
order whenever payroll withholding is not possible;
(e) Provide for repayment in full on or before the earlier of (1) the date
when the Participant severs from all employment with any member of the
Affiliated Group or (2) the date (A) five years after the loan is made
or (B) 20 years after the loan is made if the loan is used to acquire
a dwelling unit which within a reasonable time is to be used as the
Participant's principal residence;
29
|
(f) Provide that a Participant may not receive any distribution from any
of his or her Accounts under Article 8 or 11 until the loan
obligation is repaid, except to the extent that all or any part of
such distribution is used to repay the outstanding balance of the
loan; and
(g) Provide that a Participant's Accounts may not be applied to the
satisfaction of the Participant's loan obligations before the
Accounts become distributable under Article 8, unless the Company
determines that the loan obligations are in default because a
periodic payment is more than 60 days past due and takes such actions
as the Company deems necessary or appropriate to cause the Plan to
realize on its security for the loan. Such actions may include
(without limitation) an involuntary withdrawal from the Participant's
Accounts, whether or not the withdrawal would be permitted under
Article 11 on a voluntary basis; provided that an involuntary
withdrawal attributable to Company Contributions made with respect to
Plan Years that ended less than 24 months prior to the date of the
withdrawal (adjusted to reflect any earnings, appreciation or losses
attributable to Company Contributions) or attributable to Participant
Elected Contributions shall be permitted only to the extent that the
hardship requirements of Code Section 401(k)(2)(B)(I)(IV) and of
Sections 1.401(k)-l(d)(2)(ii) and 1.401(k)1(d)(2)(iii)(A) of the
Treasury Regulations are met. The Company may take such other action
as it deems necessary to recover the balance of a loan secured by the
Participant's Accounts. If an involuntary withdrawal occurs (or would
have occurred if permitted under this Section, the Participant shall
not be permitted to obtain a loan under the Plan thereafter.
10.3 Company Consent. The Company, in its sole discretion, may withhold its
---------------
consent to any loan under this Article or may consent only to the
borrowing of a part of the amount requested by the Participant. The
Company shall act upon requests for loans in a uniform and
nondiscriminatory manner, consistent with the requirements of Section
401(a), Section 401(k) and related provisions of the Code.
10.4 Source of Loans. If a Participant requests and is granted a loan, a Loan
---------------
Account shall be established for the Participant. The Loan Account shall
be held by the Trustee as part of the Loan Fund. The amount of the loan
shall be transferred to the Participant's Loan Account from the
Participant's other Accounts and shall be disbursed from the Loan Account.
Transfers from the Company Stock Fund shall be made in accordance with the
requirements for exemption under Section 16(b) of the Exchange Act if such
a transfer would cause the Participant to incur short-swing trading
profits liability under Section 16(b) of the Exchange Act. The promissory
note executed by the Participant shall be held by the Trustee (or by the
30
|
Company as agent of the Trustee) and the promissory note shall be treated
as an investment of the Participant's Loan Account.
10.5 Disbursement of Loans. A Participant may request a loan by completing
---------------------
the loan request procedures prescribed by the Company. A loan shall be
disbursed as soon as reasonably practicable after the date on which the
Company (or its agent) receives the loan request (subject to the Company's
consent).
10.6 Loan Fees. A Participant who obtains a loan under this Article shall be
---------
required to pay such fees as the Company may impose in order to defray the
cost of administering loans from the Plan.
10.7 Valuation Date. For purposes of this Article, the value of a
--------------
Participant's Accounts shall be determined as of a Valuation Date within a
reasonable period, not generally to exceed 30 days, on or after the date
on which the Company (or its agent) receives the prescribed loan request.
10.8 Loan Payments and Defaults. Principal and interest payments on a
--------------------------
Participant's loan shall be credited initially to the Participant's Loan
Account and shall be transferred as soon as reasonably practicable
thereafter to the Participant's other Accounts in the ratio specified by
the Participant under Section 6.2 for the investment of future
contributions. Any loss caused by nonpayment or other default on a
Participant's loan obligations shall be satisfied solely by that
Participant's Accounts. If a Participant defaults on a Plan loan, both his
or her participation and ability to obtain a Plan loan shall be suspended
for 12 months. The consequences of suspension from participation in the
Plan are described in Section 3.5.
|
11.1 Age 59 1/2 and Disability Withdrawals: Withdrawals from Rollover Account
------------------------------------------------------------------------
(a) A Participant who is an Employee may withdraw up to the full amount of
his or her Rollover Account.
(b) A Participant who is an Employee and who has attained age 59 1/2 may
withdraw up to the full amount of his or her vested Accounts.
(c) A Participant who is an Employee and who is Disabled may withdraw up
to the full amount of his or her vested Accounts.
11.2 Hardship Withdrawals. A Participant who is an Employee may take a
--------------------
Hardship Withdrawal of all or any portion of his or her previously
unwithdrawn Employee Contributions and earnings thereon accrued prior to
January 1, 1988. A Hardship
31
|
Withdrawal may be made only if the Company determines that it is required
on account of one or more of the following Hardships:
(a) The construction or purchase (excluding mortgage payments) of a
principal residence of the Participant;
(b) The payment of tuition and related educational fees for up to 12
months of post-secondary education for the Participant or his or her
spouse, children or dependents;
(c) The payment of medical expenses described in Section 213(d) of the
Code incurred by the Participant or the Participant's spouse or
dependents, or to obtain medical care giving rise to such expenses;
(d) The payment of expenses incurred by the Participant for the funeral of
a family member;
(e) The prevention of the eviction of the Participant from his or her
principal residence or foreclosure on a mortgage on the Participant's
principal residence; or
(f) A financial need that has been identified as a deemed immediate and
heavy financial need in a ruling, notice or other document of general
applicability issued under the authority of the Commissioner of
Internal Revenue.
For purposes of this Section, the term "dependent" shall be defined as set
forth in Section 152 of the Code.
11.3 Amount of a Hardship Withdrawal. The maximum amount of a Hardship
-------------------------------
Withdrawal is the amount necessary to satisfy the immediate and heavy
financial need caused by the Hardship, including amounts necessary to pay
taxes or penalties that the Company determines may be reasonably
anticipated to result from the Hardship Withdrawal. The determination of
the amount of a permitted Hardship Withdrawal is made by the Company only
after the Participant has obtained all withdrawals and distributions,
other than hardship withdrawals, and all nontaxable loans under all plans
maintained by the Affiliated Group.
11.4 Consequences of a Hardship Withdrawal. The following consequences shall
-------------------------------------
follow a Participant's Hardship Withdrawal:
(a) Plan participation and all employee before- and after-tax
contributions to the Plan and other qualified and nonqualified
deferred compensation plans sponsored by members of the Affiliated
Group shall be suspended for a
32
|
period of 12 months. The consequences of suspension from the Plan are
described in Section 3.5.
(b) For the calendar year following the Hardship Withdrawal, the maximum
amount of Participant Elected Contributions and all other before-tax
employee contributions to qualified retirement plans sponsored by
members of the Affiliated Group shall be limited to the Annual
Deferral Limit, as defined in Section 13.9(b), minus the amount of the
Participant's Participant Elected Contributions and all other before
tax employee contributions to qualified retirement plans sponsored by
members of the Affiliated Group for the calendar year of the Hardship
Withdrawal.
11.5 Valuation Date. For purposes of this Article, the value of a
--------------
Participant's Accounts shall be determined as of the Valuation Date
preceding the date on which the withdrawal is to be paid.
11.6 Source of Withdrawals. Withdrawals shall be paid from the affected
---------------------
Accounts. If more than one Account is available to pay the withdrawal
because the Participant elected to invest in more than one Investment
Fund, the withdrawal shall be made from the subaccount(s) designated by
the Participant, subject to such ordering and timing restrictions as the
Company may adopt.
11.7 Payment of Withdrawals. A Participant may request a withdrawal by
----------------------
following the procedures prescribed by the Company. A withdrawal shall be
paid as soon as reasonably practicable after the date on which the Company
receives the prescribed withdrawal request. Withdrawals shall be paid only
in cash.
11.8 Limitations on Withdrawals. A Participant shall not be permitted to make
--------------------------
more than one withdrawal under this Article in any period of six
consecutive months; provided, however, that withdrawals made at the same
time shall be considered a single withdrawal. The timing of withdrawals
from the Company Stock Fund shall be limited when necessary to avoid
liability from the short-swing trading profits provisions of Section 16(b)
of the Exchange Act.
|
12.1 Determining the Highly Compensated Employee Group. An individual is
-------------------------------------------------
deemed to be a Highly Compensated Employee for any Plan Year if the
individual is an active Employee who, during the look-back year, received
Total Compensation of more than $80,000 (or such larger amount as may be
adopted by the Commissioner of Internal Revenue to reflect a cost-of-
living adjustment) and was a member of the Top-Paid Group; or was a five-
percent owner at any time during the Plan Year or the look-back year. The
look-back year shall be the 12-month period immediately preceding the Plan
Year. The determination of who is a
33
|
Highly Compensated Employee, including the determinations of the number
and identity of Employees in the Top Paid Group and the Total Compensation
that is considered, will be made in accordance with Section 414(q) of the
Code and the regulations thereunder.
12.2 "Highly Compensated Former Employee" means a former Employee who
----------------------------------
separated from service (or is deemed to have separated) prior to the
determination year, performs no service for any member of the Affiliated
Group during the determination year, and was a Highly Compensated Employee
as an active Employee for either the separation year or any determination
year ending on or after the Employee's 55th birthday. The determination of
who is a Highly Compensated Former Employee will be made in accordance
with Section 414(q) of the Code and regulations thereunder.
12.3 "Nonhighly Compensated Employee" for any Plan Year means any active
------------------------------
Employee who is not a Highly Compensated Employee.
12.4 Special Definitions Used in Article 12. The following definitions shall
--------------------------------------
apply for purposes of this Article 12:
(a) "Top-Paid Group" for any Plan Year means the top 20 percent (in
--------------
terms of Total Compensation) of all Employees of the Affiliated Group,
where the number that is 20 percent of all Employees of the Affiliated
Group is determined by excluding:
(1) Any Employee covered by a collective bargaining agreement;
(2) Any Employee who is a nonresident alien with respect to the
United States and who receives no income with a source within the
United States from a member of the Affiliated Group;
(3) Any Employee who has not completed six months of service at the
end of the Plan Year;
(4) Any Employee who normally works less than 17 1/2 hours per week;
(5) Any Employee who normally works no more than six months during
any year; and
(6) Any Employee who has not attained the age of 21 at the end of the
Plan Year.
The Company may elect, in a consistent and uniform manner, to apply one or
more of the age- and service-based exclusions above by substituting a
younger
34
|
age or shorter period of service, or by not excluding individuals on the
basis of age or service.
(b) "Total Compensation" means "Compensation," as defined in Section 2.16,
------------------
but determined by including amounts deferred but not refunded under
Section 403(b) of the Code, under a cafeteria plan, as such term is
defined in Section 125(c) of the Code, under a simplified employee
pension, as such term is defined in Section 408(k) of the Code and
under a plan, including this Plan, qualified under Section 401(k) of
the Code.
|
13.1 Return of Excess Deferrals. The aggregate Participant Elected
--------------------------
Contributions of any Participant for any calendar year, together with his
or her elective deferrals under any other plan or arrangement to which
Section 402(g) of the Code applies and that is maintained by a member of
the Affiliated Group, shall not exceed the Annual Deferral Limit. In the
event that the aggregate Participant Elected Contributions of any
Participant for any calendar year, together with any other elective
deferrals (within the meaning of Section 402(g)(3) of the Code) under all
plans, contracts or arrangements of the Affiliated Group and any other
employers, exceed the Annual Deferral Limit, then the Participant may
designate all or a portion of such Excess Deferrals as attributable to
this Plan and may request a refund of such portion by notifying the
Company in writing on or before the March 1 next following the close of
such calendar year. If timely notice is received by the Company, then such
portion of the Excess Deferrals, and any income or loss allocable to such
portion, shall be refunded to the Participant not later than the April 15
next following the close of such calendar year.
If the Participant fails properly to request a distribution of all such
Excess Deferrals, and such Excess Deferrals are attributable solely to
plans, contracts or arrangements of the Affiliated Group, then the Company
shall be deemed to have notice of such Excess Deferrals and shall
designate one or more plans maintained by a member of the Affiliated Group
from which the refund of Excess Deferrals and allocable income or loss
shall be made no later than April 15 next following the close of such
calendar year.
Any Participant Elected Contributions distributed pursuant to this Section
13.1 shall not be included in the Participant Elected Contributions to
which a Matching Contribution under Section 5.1 or a Qualified Matching
Contribution under Section 5.4 of the Plan attaches.
35
|
13.2 Actual Deferral Percentage Limitation. The Plan shall satisfy the actual
-------------------------------------
deferral percentage test, as provided in Section 401(k)(3) of the Code and
the regulations issued thereunder. Subject to the special rules described
in Section 13.7, the Aggregate 401(k) Contributions of Highly Compensated
Employees shall not exceed the limits described below:
(a) An Actual Deferral Percentage shall be determined for each individual
who, at any time during the Plan Year, is a Participant (including a
suspended Participant) or is eligible to participate in the Plan,
which Actual Deferral Percentage shall be the ratio, computed to the
nearest one-hundredth of one percent, of the individual's Aggregate
401(k) Contributions for the Plan Year to the individual's Section
414(s) Compensation for the Plan Year;
(b) The Actual Deferral Percentages (including zero percentages) of Highly
Compensated Employees and Nonhighly Compensated Employees shall be
separately averaged to determine each group's Average Deferral
Percentage; and
(c) The Aggregate 401(k) Contributions of Highly Compensated Employees
shall constitute Excess Contributions and shall be reduced, pursuant
to Sections 13.3 and 13.4, to the extent that the Average Deferral
Percentage of Highly Compensated Employees exceeds the greater of (1)
125 percent of the Average Deferral Percentage of Nonhighly
Compensated Employees for the preceding Plan Year or (2) the lesser of
(A) 200 percent of the Average Deferral Percentage of Nonhighly
Compensated Employees for the preceding Plan Year or (B) the Average
Deferral Percentage of Nonhighly Compensated Employees for the
preceding Plan Year plus two percentage points.
13.3 Allocation of Excess Contributions to Highly Compensated Employees. Any
------------------------------------------------------------------
Excess Contributions for a Plan Year shall be allocated to Highly
Compensated Employees by use of a leveling process, whereby the amount of
Aggregate 401(k) Contributions of the Highly Compensated Employee with the
highest amount of Aggregate 401(k) Contributions is reduced to the extent
required to (a) eliminate all Excess Contributions or (b) cause such
Highly Compensated Employee's amount of Aggregate 401(k) Contributions to
equal the amount of Aggregate 401(k) Contributions of the Highly
Compensated Employee with the next highest amount of Aggregate 401(k)
Contributions. The leveling process shall be repeated until all Excess
Contributions for the Plan Year are allocated to Highly Compensated
Employees.
13.4 Distribution of Excess Contributions. Excess Contributions allocated to
------------------------------------
Highly Compensated Employees for the Plan Year pursuant to Section 13.3,
together with any income or loss allocable to such Excess Contributions,
shall be
36
|
distributed to such Highly Compensated Employees not later than two-and-
one-half months following the close of such Plan Year, if possible, and in
any event no later than 12 months following the close of such Plan Year.
Any Participant Elected Contributions distributed pursuant to this Section
13.4 shall not be included in the Participant Elected Contributions to
which a Matching Contribution under Section 5.1 or a Qualified Matching
Contribution under Section 5.4 of the Plan attaches.
13.5 Qualified Matching Contributions. The Company, in its sole discretion,
--------------------------------
may include all or a portion of the Qualified Matching Contributions for a
Plan Year in Aggregate 401(k) Contributions taken into account in applying
the Average Deferral Percentage limitation described in Section 13.2 for
the Plan Year; provided that such Qualified Matching Contributions for the
Plan Year are fully and immediately vested, may not be withdrawn while the
Participant is an Employee or may be withdrawn only in circumstances that
would permit a Hardship Withdrawal, and the additional requirements of
Treasury Regulation Section 1.401(k)-l(b)(5) are satisfied.
13.6 Corrective Qualified Nonelective Contributions. In order to satisfy (or
----------------------------------------------
partially satisfy) the Average Deferral Percentage limitation described in
Section 13.2, the Average Contribution Percentage limitation described in
Section 14.1 or the multiple-use limitation described in Section 15.1 (or
more than one of such limitations), the Company, in its sole discretion,
may cause one or more Participating Companies to make a Qualified
Nonelective Contribution to the Plan. Any such Qualified Nonelective
Contribution shall be allocated to the Accounts of those Participants who
are eligible to receive an allocation of Matching Contributions under
Section 5.1 of the Plan or Nonelective Contributions under Section 5.2, as
the Company designates, and who are Nonhighly Compensated Employees for
the Plan Year with respect to which the Qualified Nonelective Contribution
is made, beginning with the Participant with the lowest Section 414(s)
Compensation for the Plan Year and allocating the maximum amount
permissible under Article 16 before allocating any portion of the
Qualified Nonelective Contribution to the Participant with the next lowest
Section 414(s) Compensation. These allocations shall continue until the
Plan satisfies the Average Deferral Percentage limitation described in
Section 13.2, the Average Contribution Percentage limitation described in
Section 14.1 or the multiple-use limitation described in Section 15.1 (or
more than one of such limitations), or until the amount of the Qualified
Nonelective Contribution is exhausted.
The Company, in its sole discretion, may include all or a portion of the
Qualified Nonelective Contributions for a Plan Year in Aggregate 401(k)
Contributions taken into account in applying the Average Deferral
Percentage limitation
37
|
described in Section 13.2 for such Plan Year, provided that the
requirements of Treasury Regulation Section 1.401(k)l(b)(5) are satisfied.
Qualified Nonelective Contributions shall be paid to the Trustee as soon
as reasonably practicable following the close of the Plan Year, shall be
allocated to the Accounts of Nonhighly Compensated Employees as of the
last day of the Plan Year and shall be fully and immediately vested. In
all other respects, the contribution, allocation, investment and
distribution of Qualified Nonelective Contributions shall be governed by
the provisions of the Plan concerning Matching Contributions.
13.7 Special Rules. The following special rules shall apply for purposes of
-------------
this Article 13:
(a) The amount of Excess Deferrals to be distributed to a Participant for
a calendar year pursuant to Section 13.1 shall be reduced by the
amount of any Excess Contributions previously distributed to such
Participant for the Plan Year beginning within such calendar year;
(b) The amount of Excess Contributions to be distributed to a Participant
for a Plan Year pursuant to Section 13.4 shall be reduced by the
amount of any Excess Deferrals previously distributed to such
Participant for the calendar year ending within such Plan Year;
(c) For purposes of applying the limitation described in Section 13.2, the
Actual Deferral Percentage of any Highly Compensated Employee who is
eligible to make Participant Elected Contributions and to make
elective deferrals (within the meaning of Section 402(g)(3) of the
Code) under any other plans, contracts or arrangements of the
Affiliated Group shall be determined as if all such Participant
Elected Contributions and elective deferrals were made under a single
arrangement; provided, however, that plans, contracts and arrangements
shall not be treated as a single arrangement to the extent that
Treasury Regulation Section 1.401(k)-l(b)(3)(ii)(B) prohibits
aggregation;
(d) In the event that this Plan is aggregated with one or more other plans
in order to satisfy the requirements of Code Section 401(a)(4), 401(k)
or 410(b), then all such aggregated plans, including the Plan, shall
be treated as a single plan for all purposes under all such Code
sections (except for purposes of the average benefit percentage
provisions of Code Section 410(b)(2)(A)(ii));
(e) In the event that the mandatory disaggregation rules of Treasury
Regulation Section 1.401(k)-l(b)(3)(ii)(B) apply to the Plan, or to
the Plan and other plans with which it is aggregated as described in
Subsection (d)
38
|
above, then the limitation described in Section 13.2 shall be applied
as if each mandatorily disaggregated portion of the Plan (or
aggregated plans) were a single arrangement; and
(f) Income (and loss) allocable to Excess Contributions for the Plan Year
shall be determined pursuant to the provisions for allocating income
(and loss) to a Participant's Accounts under Section 6.10 of the Plan.
13.8 Prospective Limitations on Participant Elected Contributions. At any
------------------------------------------------------------
time, the Company (at its sole discretion) may reduce the maximum rate at
which any Participant may make Participant Elected Contributions to the
Plan, or the Company may require that any Participant discontinue all
Participant Elected Contributions, in order to ensure that the limitations
described in this Article 13 are met. Any reduction or discontinuance of
Participant Elected Contributions may be applied selectively to individual
Participants or to particular classes of Participants, as the Company may
determine. Upon such date as the Company may determine, this Section shall
automatically cease to apply until the Company again determines that a
reduction or discontinuance of Participant Elected Contributions is
required for any Participant.
13.9 Special Definitions Used in Article 13. The following definitions shall
--------------------------------------
apply for purposes of this Article 13, and some may also apply for one or
more of Articles 14, 15 and 16.
(a) "Aggregate 401(k) Contributions" means, for any Plan Year, the sum
------------------------------
of the following: (a) the Participant's Participant Elected
Contributions for the Plan Year; (b) the Qualified Matching
Contributions allocated to the Participant's Accounts as of a date
within the Plan Year, but only to the extent that such Qualified
Matching Contributions are aggregated with Participant Elected
Contributions pursuant to Section 13.5; and (c) the Qualified
Nonelective Contributions allocated to the Participant's Accounts as
of a date within the Plan Year, but only to the extent that such
Qualified Nonelective Contributions are aggregated with Participant
Elected Contributions pursuant to Section 13.6.
(b) "Annual Deferral Limit" means the dollar limit in effect for any
---------------------
calendar year under Section 402(g) of the Code.
(c) "Excess Contributions" means the amount by which the Aggregate 401(k)
--------------------
Contributions of Highly Compensated Employees is reduced pursuant to
Section 13.3.
(d) "Excess Deferrals" means the amount of a Participant's Participant
----------------
Elected Contributions and elective deferrals (within the meaning of
39
|
Section 402(g)(3) of the Code) that exceed the Annual Deferral Limit
set forth in Section 13.1 (as defined in Section 13.9).
(e) "Section 414(s) Compensation" means any one of the following
---------------------------
definitions of compensation received by an Employee from members of
the Affiliated Group:
(1) Compensation as defined in Treasury Regulation Section 1.415-2(d)
or any successor thereto;
(2) "Wages" as defined in Section 3401(a) of the Code for purposes of
income tax withholding at the source, but determined without
regard to any rules that limit the remuneration included in wages
based on the nature or location of the employment or the services
performed (such as the exception for agricultural labor in
Section 3401(a)(23) of the Code);
(3) "Wages" as defined in Section 3401(a) of the Code for purposes of
income tax withholding at the source, plus all other payments of
compensation reportable under Code Sections 6041(d) and
6051(a)(3) and the regulations thereunder, determined without
regard to any rules that limit such Wages or reportable
compensation based on the nature or location of the employment or
the services performed (such as the exception for agricultural
labor in Section 3401(a)(23) of the Code), and modified, at the
election of the Company, to exclude amounts paid or reimbursed
for the Employee's moving expenses, to the extent it is
reasonable to believe that these amounts are deductible by the
Employee under Section 217 of the Code;
(4) Any of the definitions of Section 414(s) Compensation set forth
in Subsections (1), (2) and (3) above, reduced by all of the
following items (even if includable in gross income):
reimbursements or other expense allowances, fringe benefits (cash
and noncash), moving expenses, deferred compensation and welfare
benefits;
(5) Any of the definitions of Section 414(s) Compensation set forth
in Subsections (1), (2), (3) and (4) above, modified to include
the following: (a) any elective contributions made by a member of
the Affiliated Group on behalf of the Employee that are not
includable in gross income under Section 125, 402(e)(3), 402(h)
or 403(b) of the Code; (b) compensation deferred under an
eligible deferred compensation plan within the meaning of Section
457(b) of the Code; and (c) employee contributions described in
40
|
Section 414(h)(2) of the Code that are picked up by the employing
unit and thus are treated as employer contributions; or
(6) Any reasonable definition of compensation that does not by design
favor Highly Compensated Employees and that satisfies the
nondiscrimination requirement set forth in Treasury Regulation
Section 1.414(s)-lT(d)(2) or the successor thereto.
Any definition of Section 414(s) Compensation shall be used
consistently to define the compensation of all Employees taken into
account in satisfying the requirements of an applicable provision of
Articles 13, 14, 15 and 16 for the relevant determination period. For
purposes of applying the limitations set forth in Articles 13, 14 and
15 for a Plan Year, Section 414(s) Compensation shall not exceed the
Compensation Limitation.
|
14.1 Average Contribution Percentage Limitation. The Plan shall satisfy the
------------------------------------------
actual contribution percentage test, as provided in Section 401(m)(2) of
the Code and Section 1.401(m)-l of the regulations issued thereunder.
Subject to the special rules described in Section 14.6, the Aggregate
401(m) Contributions of Highly Compensated Employees shall not exceed the
limits described below:
(a) An Actual Contribution Percentage shall be determined for each
individual who, at any time during the Plan Year, is a Participant
(including a suspended Participant) or is eligible to participate in
the Plan, which Actual Contribution Percentage shall be the ratio,
computed to the nearest one-hundredth of one percent, of the
individual's Aggregate 401(m) Contributions for the Plan Year to the
individual's Section 414(s) Compensation for the Plan Year;
(b) The Actual Contribution Percentages (including zero percentages) of
Highly Compensated Employees and Nonhighly Compensated Employees shall
be separately averaged to determine each group's Average Contribution
Percentage; and
(c) The Aggregate 401(m) Contributions of Highly Compensated Employees
shall constitute Excess Aggregate Contributions and shall be reduced,
pursuant to Sections 14.2 and 14.3, to the extent that the Average
Contribution Percentage of Highly Compensated Employees exceeds the
greater of (1) 125 percent of the Average Contribution Percentage of
Nonhighly Compensated Employees for the preceding Plan Year or (2) the
lesser of (A) 200 percent of the Average Contribution Percentage of
41
|
Nonhighly Compensated Employees for the preceding Plan Year or (B) the
Average Contribution Percentage of Nonhighly Compensated Employees for
the preceding Plan Year plus two percentage points.
14.2 Allocation of Excess Aggregate Contributions to Highly Compensated
------------------------------------------------------------------
Employees. Any Excess Aggregate Contributions for a Plan Year shall be
---------
allocated to Highly Compensated Employees by use of a leveling process,
whereby the Aggregate 401(m) Contributions of the Highly Compensated
Employee with the highest amount of Aggregate 401(m) Contributions is
reduced to the extent required to (a) eliminate all Excess Aggregate
Contributions or (b) cause the amount of such Highly Compensated
Employee's Aggregate 401(m) Contributions to equal the amount of Aggregate
401(m) Contributions of the Highly Compensated Employee with the next-
highest amount of Aggregate 401(m) Contributions. The leveling process
shall be repeated until all Excess Aggregate Contributions for the Plan
Year are allocated to Highly Compensated Employees.
14.3 Distribution of Excess Aggregate Contributions. Excess Aggregate
----------------------------------------------
Contributions allocated to Highly Compensated Employees for the Plan Year
pursuant to Section 14.2, together with any income or loss allocable to
such Excess Aggregate Contributions, shall be distributed to such Highly
Compensated Employees not later than two-and-one-half months following the
close of such Plan Year, if possible, and in any event no later than 12
months following the close of such Plan Year, but only to the extent the
Highly Compensated Employee has a nonforfeitable interest in the Excess
Aggregate contributions. Excess Aggregate Contributions (for Participants
who are Highly Compensated Employees), to the extent not vested, may be
forfeited and allocated, after all other Forfeitures under the Plan, to
other Participants (but in no event to any Highly Compensated Employee) in
the proportion that such Participant's Participant Elected Contributions,
if any, for that Plan Year bears to the total Participant Elected
Contributions of all such Participants for the Plan Year. Any such amounts
shall be included in the calculation of the Actual Contribution Percentage
and in the calculation of the limits set forth in Article 16.
14.4 Use of Participant Elected Contributions. The Company, in its sole
----------------------------------------
discretion, may include all or a portion of the Participant Elected
Contributions for a Plan Year in Aggregate 401(m) Contributions taken into
account in applying the Average Contribution Percentage limitation
described in Section 14.1 for the Plan Year, provided that all Participant
Elected Contributions satisfy the average deferral percentage test, as
described in Section 13.2, and that the additional requirements of
Treasury Regulation Section 1.401(m)-l(b)(5) are satisfied.
14.5 Corrective Qualified Nonelective Contributions. The Company, in its sole
----------------------------------------------
discretion, may include all or a portion of the Qualified Nonelective
Contributions
42
|
made pursuant to Section 13.6 for a Plan Year in Aggregate 401(m)
Contributions taken into account in applying the Average Contribution
Percentage limitation described in Section 14.1 for the Plan Year,
provided that the requirements of Treasury Regulation Section 1.401(m)-
l(b)(5) are satisfied.
14.6 Special Rules. The following special rules shall apply for purposes of
-------------
this Article 14:
(a) For purposes of applying the limitation described in Section 14.1, the
Actual Contribution Percentage of any Highly Compensated Employee who
is eligible to participate in the Plan and to make employee
contributions or receive an allocation of matching contributions
(within the meaning of Section 401(m)(4)(A) of the Code) under any
other plans, contracts or arrangements of the Affiliated Group shall
be determined as if Matching Contributions and Qualified Matching
Contributions allocated to the Highly Compensated Employee's Accounts
and all such employee contributions and matching contributions were
made under a single arrangement;
(b) In the event that this Plan is aggregated with one or more other plans
in order to satisfy the requirements of Code Section 401(a)(4), 401(m)
or 410(b), then all such aggregated plans, including the Plan, shall
be treated as a single plan for all purposes under all such Code
sections (except for purposes of the average benefit percentage
provisions of Code Section 410(b)(2)(A)(ii));
(c) In the event that the mandatory disaggregation rules of Treasury
Regulation Section 1.401(m)-l(b)(3)(ii) apply to the Plan, or to the
Plan and other plans with which it is aggregated as described in
Subsection (b) above, then the limitation described in Section 14.1
shall be applied as if each mandatorily disaggregated portion of the
Plan (or aggregated plans) were a single arrangement; and
(d) Income (and loss) allocable to Excess Aggregate Contributions for the
Plan Year shall be determined pursuant to the provisions for
allocating income (and loss) to a Participant's Accounts under Section
6.10.
14.7 Special Definitions Used in Article 14. The following definitions shall
--------------------------------------
apply for purposes of this Article 14:
(a) "Aggregate 401(m) Contributions" means, for any Plan Year, the sum of
------------------------------
the following: (a) the Matching Contributions and Qualified Matching
Contributions allocated to the Participant's Accounts as of a date
within the Plan Year; (b) the Participant's Participant Elected
Contributions for the Plan Year, but only to the extent that such
Participant Elected
43
|
Contributions are aggregated with Matching Contributions and Qualified
Matching Contributions pursuant to Section 14.4; and (c) the Qualified
Nonelective Contributions allocated to the Participant's Accounts as
of a date within the Plan Year, but only to the extent that such
Qualified Nonelective Contributions are aggregated with Matching
Contributions and Qualified Matching Contributions pursuant to Section
14.5.
(b) "Excess Aggregate Contributions" means the amount by which the
------------------------------
Aggregate 401(m) Contributions of Highly Compensated Employees are
reduced pursuant to Section 14.2.
|
15.1 Applicability of the Multiple-Use Limitation. The limitation described in
--------------------------------------------
this Article 15 shall apply only if, for a Plan Year, after the
limitations of Articles 13 and 14 are applied:
(a) The Average Deferral Percentage of Highly Compensated Employees (1)
exceeds 125 percent of the Average Deferral Percentage of Nonhighly
Compensated Employees, but (2) does not exceed the lesser of (A) 200
percent of the Average Deferral Percentage of Nonhighly Compensated
Employees or (B) the Average Deferral Percentage of Nonhighly
Compensated Employees plus two percentage points; and
(b) The Average Contribution Percentage of Highly Compensated Employees
(1) exceeds 125 percent of the Average Contribution Percentage of
Nonhighly Compensated Employees, but (2) does not exceed the lesser of
(A) 200 percent of the Average Contribution Percentage of Nonhighly
Compensated Employees or (B) the Average Contribution Percentage of
Nonhighly Compensated Employees plus two percentage points.
15.2 Multiple-Use Limitation. The sum of the Average Deferral Percentage and
-----------------------
Average Compensation Percentage of Highly Compensated Employees shall not
exceed the greater of (a) or (b) below.
(a) This limit equals the sum of:
(1) 1.25 times the greater of the Average Deferral Percentage or
Average Contribution Percentage of Nonhighly Compensated
Employees; and
(2) The lesser of (A) 200 percent of the lesser of the Average
Deferral Percentage or Average Contribution Percentage of
Nonhighly Compensated Employees, or (b) the lesser of the Average
Deferral
44
|
Percentage or Average Contribution Percentage of Nonhighly
Compensated Employees plus two percentage points.
(b) This limit equals the sum of:
(1) 1.25 times the lesser of the Average Deferral Percentage or
Average Contribution Percentage of Nonhighly Compensated
Employees; and
(2) The lesser of (A) 200 percent of the greater of the Average
Deferral Percentage or Average Contribution Percentage of
Nonhighly Compensated Employees, or (B) the greater of the
Average Deferral Percentage or Average Contribution Percentage of
Nonhighly Compensated Employees plus two percentage points.
15.3 Correction of Multiple-Use Limitation. To the extent necessary, the
-------------------------------------
limitation of Section 15.2 shall be satisfied by one or more of the
following methods: (a) the allocation of corrective Qualified Nonelective
Contributions in the manner set forth in Sections 13.6 or 14.5, or (b) the
distribution of Aggregate 401(m) Contributions (and income or loss
allocable thereto) to Highly Compensated Employees in the manner set forth
in Sections 14.2 and 14.3, followed by the distribution of Aggregate
401(k) Contributions (and income or loss allocable thereto) to Highly
Compensated Employees in the manner set forth in Sections 13.3 and 13.4.
|
16.1 Limitation on Contributions. The Annual Additions allocated or attributed
---------------------------
to a Participant for any Plan Year shall not exceed the lesser of the
following:
(a) $30,000; or
(b) 25% of the Participant's Section 415 Compensation for such year.
If a Participant's Annual Additions would exceed the foregoing limitation,
then such Annual Additions shall be reduced by reducing the components
thereof as necessary in the order in which they are listed in Section
16.5(a). Any amounts so reduced shall not be included in a Participant's
Aggregate 401(k) Contributions or Aggregate 401(m) Contributions. The
limitation in Section 16.1(b) shall not apply to any amount that otherwise
is an Annual Addition under Section 415(l)(1) or 419A(d)(2) of the Code.
45
|
16.2 Combined Limitation on Benefits and Contributions. The sum of a
-------------------------------------------------
Participant's defined-benefit plan fraction and his or her defined
contribution plan fraction shall not exceed 1.0 with respect to any Plan
Year. For purposes of this Section, the terms "defined-benefit plan
fraction" and "defined-contribution plan fraction" shall have the meaning
given to such terms by Section 415(e) of the Code and the regulations
thereunder. If a Participant would exceed the foregoing limitation, then
the Participant's benefits under any qualified defined-benefit plan that
may be maintained by the Section 415 Employer Group shall be reduced as
necessary to allow his or her Annual Additions to equal the maximum
permitted by Section 16.l.
16.3 Return of Employee Contributions. If the amount of any Participant's
--------------------------------
Participant Elected Contributions is determined to be an excess Annual
Addition under this Article, then the amount of such excess (adjusted to
reflect any earnings, appreciation or losses attributable to such excess)
shall be refunded by the Trustee in cash to the Participant.
16.4 Excess Company Contributions. If the amount of the Company Contributions
----------------------------
allocated to a Participant for any Plan Year must be reduced to meet the
limitation described in Section 16.1, then the amount of the reduction
shall be applied to reduce the total amount that the Participating
Companies otherwise would contribute for such year pursuant to Article 5
of the Plan. If the amount that the Participating Companies may contribute
is thereby reduced to zero and if there are Company Contributions that
still cannot be allocated to any Participant because of the limitation
described in Section 16.1, then the excess shall be transferred to a
suspense account. Any gains, income or losses attributable to the suspense
account shall be allocated to such account. All amounts credited to the
suspense account shall be applied to reduce the total amount that the
Participating Companies otherwise would contribute to the Plan for the
next Plan Year, and for succeeding Plan Years if necessary. Such amounts
shall be allocated among Participants pursuant to Article 5 of the Plan
until the suspense account is exhausted (subject to this Article). No
Participant Elected Contributions or Company Contributions shall be made
as long as any amount remains in the suspense account.
16.5 Special Definitions Used in this Article 16. The following definitions
-------------------------------------------
shall apply for purposes of this Article 16.
(a) "Annual Additions" means, for any Plan Year, the sum of the following:
----------------
(1) The amount of after-tax contributions that the Participant
contributes during such year to all qualified retirement plans,
other than this Plan, maintained by the Section 415 Employer
Group;
46
|
(2) The amount of elective contributions that the Participant
contributes during such year to all qualified retirement plans,
other than this Plan, maintained by the Section 415 Employer
Group;
(3) The amount of Participant Elected Contributions that the
Participant contributes during such year;
(4) The amount of employer contributions and forfeitures allocated to
the Participant under any qualified defined contribution plan
that may be maintained by the Section 415 Employer Group, other
than this Plan, as of any date within such year; and
(5) The amount of Company Contributions and Forfeitures allocated to
the Participant as of any date within such year.
(b) "Section 415 Compensation" means any one of the definitions of Section
------------------------
414(s) Compensation described in Paragraphs (1), (2), (3) or (4) of
Section 13.9(e) received by an Employee from members of the Section
415 Employer Group. Any definition of Section 415 Compensation shall
be used consistently to define the compensation of all Employees taken
into account in satisfying the requirements of an applicable provision
of the Plan for the relevant determination period.
(c) "Section 415 Employer Group" means the Affiliated Group, except that
--------------------------
"more than 50 percent" shall be substituted for "at least 80 percent"
wherever the phrase occurs in Section 1563(a) of the Code (as
incorporated by reference in Sections 414(b) and (c) of the Code).
|
17.1 Control and Management of Plan Assets. The Company is a named fiduciary
-------------------------------------
with respect to control over and management of the assets of the Plan, but
only to the extent of having the authority (a) to appoint one or more
trustees to hold assets of the Plan in trust and to enter into a trust
agreement with each trustee it appoints, (b) to appoint one or more
insurance companies that are qualified to do business in at least one
state to hold assets of the Plan and to enter into a contract with each
insurance company it appoints (or to direct the Trustee to enter into such
contract), (c) to appoint one or more Investment Managers for any assets
of the Plan and to enter into an investment management agreement with each
Investment Manager it appoints, and (d) to direct the investment of any
Plan assets not assigned to an Investment Manager.
47
|
17.2 Trustee Duties. The Trustee shall have the exclusive authority and
--------------
discretion to control and manage assets of the Plan it holds in trust,
except to the extent that (a) the Plan prescribes how such assets shall be
invested, (b) the Company directs how such assets shall be invested or (c)
the Company allocates the authority to manage such assets to one or more
Investment Managers. Each Investment Manager shall have the exclusive
authority to manage, including the authority to acquire and dispose of,
the assets of the Plan assigned to it by the Company, except to the extent
that the Plan prescribes or the Company directs how such assets shall be
invested. Each Trustee and Investment Manager shall be solely responsible
for diversifying, in accordance with Section 404(a)(1)(C) of ERISA, the
investment of the assets of the Plan assigned to it by the Company, except
to the extent that the Plan prescribes or the Company directs how such
assets shall be invested.
17.3 Independent Qualified Public Accountant. The Company shall engage an
---------------------------------------
independent qualified public accountant to conduct such examinations and
to express such opinions as may be required by Section 103(a)(3) of ERISA.
The Company in its discretion may remove and discharge the person so
engaged, in which event it shall appoint a successor independent qualified
public accountant to perform such examinations and express such opinions.
17.4 Administrative Expenses. All expenses of the Plan and the Trust Fund
-----------------------
shall be paid by the Participating Companies and by the Trust Fund. The
Company shall have complete and unfettered discretion to determine whether
an expense of the Plan shall be paid out of the Trust Fund or by the
Participating Companies, and the Company's discretion and authority to
direct the payment of expenses out of the Trust Fund shall not be limited
in any way by any prior decision or practice regarding the payment of Plan
expenses.
17.5 Benefit Payments. All benefits payable pursuant to the Plan shall be paid
----------------
by the Trustee out of the Trust Fund pursuant to the directions of the
Company and the terms of the Trust Agreement.
|
18.1 Plan Administration. The Company is the named fiduciary that has the
-------------------
discretionary authority to control and manage the operation and
administration of the Plan, and the Company is the "administrator" and
"plan sponsor" of the Plan (as such terms are used in ERISA). The Company
in its sole discretion shall make such rules, interpretations and
computations and shall take such other actions to administer the Plan as
it may deem appropriate. Such rules, interpretations, computations and
actions shall be conclusive and binding on all persons. In administering
the Plan, the Company (a) shall act in a nondiscriminatory manner to the
extent required by Section 401(a) and related
48
|
sections of the Code and (b) shall at all times discharge its duties in
accordance with the standards set forth in Section 404(a)(1) of ERISA.
18.2 Employment of Advisers. The Company may retain such attorneys,
----------------------
accountants, consultants or other persons to render advice or to perform
services with regard to its responsibilities under the Plan as it shall
determine to be necessary or desirable. The Company may designate by
written instrument (signed by both parties) one or more persons to carry
out, where appropriate, fiduciary responsibilities under the Plan. The
Company's duties and responsibilities under the Plan that have not been
delegated to other fiduciaries pursuant to the preceding sentence shall be
carried out by its directors, officers and employees, acting on behalf and
in the name of the Company in their capacities as directors, officers and
employees, and not as individual fiduciaries.
18.3 Service in Several Fiduciary Capacities. Nothing herein shall prohibit
---------------------------------------
any person or group of persons from serving in more than one fiduciary
capacity with respect to the Plan.
|
19.1 Applications for Benefits. Any application for benefits under the Plan
-------------------------
shall be submitted to the Company at its principal office. Such
application shall be in writing on the prescribed form and shall be signed
by the applicant.
19.2 Denial of Applications. In the event that any application for benefits is
----------------------
denied in whole or in part, the Company shall notify the applicant in
writing of the right to a review of the denial. Such written notice shall
set forth, in a manner calculated to be understood by the applicant,
specific reasons for the denial, specific references to the Plan
provisions on which the denial was based, a description of any information
or material necessary to perfect the application, an explanation of why
such material is necessary, and an explanation of the Plan's review
procedure. Such written notice shall be given to the applicant within 90
days after the Company receives the application, unless special
circumstances require an extension of time for processing the application.
In no event shall such an extension exceed a period of 90 days from the
end of the initial 90-day period. If such an extension is required,
written notice thereof shall be furnished to the applicant before the end
of the initial 90-day period. Such notice shall indicate the special
circumstances requiring an extension of time and the date by which the
Company expects to render a decision. If written notice is not given to
the applicant within the period prescribed by this Section 19.2, the
application shall be deemed to have been denied for purposes of Section
19.4 upon the expiration of such period.
49
|
19.3 Review Panel. The Company from time to time shall appoint a Review Panel.
------------
The Review Panel shall consist of three or more individuals who may (but
need not) be employees of the Company and shall be the named fiduciary
with the authority to act on any employee benefit appeal.
19.4 Requests for Review. Any person whose application for benefits is denied
-------------------
in whole or in part (or such person's duly authorized representative) may
appeal the denial by submitting to the Review Panel a request for a review
of such application within 90 days after receiving written notice of the
denial. The Review Panel shall give the applicant or such representative
an opportunity to review pertinent documents (except legally privileged
materials) in preparing such request for review and to submit issues and
comments in writing. The request for review shall be in writing and shall
be addressed to the Company's principal office. The request for review
shall set forth all of the grounds on which it is based, all facts in
support of the request, and any other matters which the applicant deems
pertinent. The Review Panel may require the applicant to submit such
additional facts, documents or other material as it may deem necessary or
appropriate in making its review.
19.5 Decisions on Review. The Review Panel shall act upon each request for
-------------------
review within 60 days after receipt thereof, unless special circumstances
require an extension of time for processing, but in no event shall the
decision on review be rendered more than 120 days after the Review Panel
receives the request for review. If such an extension is required, written
notice thereof shall be furnished to the applicant before the end of the
initial 90-day period. The Review Panel shall give prompt, written notice
of its decision to the applicant and to the Company. In the event that the
Review Panel confirms the denial of the application for benefits in whole
or in part, such notice shall set forth, in a manner calculated to be
understood by the applicant, the specific reasons for such denial and
specific references to the Plan provisions on which the decision is based.
To the extent that the Review Panel overrules the denial of the
application for benefits, such benefits shall be paid to the applicant.
19.6 Rules and Procedures. The Review Panel shall adopt such rules and
--------------------
procedures, consistent with ERISA and the Plan, as it deems necessary or
appropriate in carrying out its responsibilities under this Article 19.
19.7 Exhaustion of Administrative Remedies. No legal or equitable action for
-------------------------------------
benefits under the Plan shall be brought unless and until the claimant (a)
has submitted a written application for benefits in accordance with
Section 19.1, (b) has been notified that the application is denied, (c)
has filed a written request for a review of the application in accordance
with Section 19.4, and (d) has been notified in writing that the Review
Panel has affirmed the denial of the application; provided, however, that
an action may be brought after the Company or the Review Panel
50
|
has failed to act on the claim within the time prescribed in Section 19.2
and Section 19.5, respectively.
|
20.1 Right To Amend or Terminate. The Company expects to continue the Plan
---------------------------
indefinitely. However, future conditions cannot be foreseen, and the
Company reserves the right at any time and for any reason, by action of
its board of directors or by a person or persons acting pursuant to a
valid delegation of authority, (a) to amend the Plan, (b) to reduce or
discontinue Employee Contributions, Company Contributions or all
Contributions or (c) to terminate the Plan and the Trust Fund.
20.2 Protection of Participants. No amendment of the Plan shall reduce the
--------------------------
benefit of any Participant that accrued under the Plan prior to the date
when such amendment is adopted, except to the extent that a reduction in
accrued benefits may be permitted by the Code and ERISA. No Plan amendment
or other action by the Company shall divert any part of the Plan's assets
to purposes other than the exclusive purpose of providing benefits to the
Participants and Beneficiaries who have an interest in the Plan and of
defraying the reasonable expenses of administering the Plan.
20.3 Effect of Termination. Upon termination of the Plan, no assets of the
---------------------
Plan shall revert to any Participating Company or be used for, or diverted
to, purposes other than the exclusive purpose of providing benefits to
Participants and Beneficiaries and of defraying the reasonable expenses of
termination. If the Plan is terminated or partially terminated, or if all
contributions to the Plan are completely discontinued, then each
Participant who then is an Employee and who is directly affected by such
event shall have a 100 percent vested interest in each of his or her
Accounts, without regard to the number of Years of Service he or she has
completed.
20.4 Allocation of Trust Fund Upon Termination. Upon termination of the Plan,
-----------------------------------------
the Trust Fund shall continue in existence until the Accounts of each
Participant have been distributed to such Participant (or to his or her
Beneficiary) pursuant to Article 8; provided, however, that the assets of
the Plan shall be allocated in accordance with any applicable requirements
under Section 403(d)(1) of ERISA.
20.5 Partial Termination. Upon a partial termination of the Plan, Sections
-------------------
20.3 and 20.4 shall apply with respect to such Participants and
Beneficiaries as are affected by such partial termination.
|
21.1 Plan Mergers. The Plan shall not merge or consolidate with, or transfer
------------
assets or liabilities to, any other plan unless each Participant would
receive a benefit immediately after such merger, consolidation or transfer
(if the Plan then terminated) that is equal to or greater than the benefit
that such Participant would have been entitled to receive immediately
before the merger, consolidation or transfer (if the Plan had then
terminated).
21.2 No Assignment of Property Rights. Except as otherwise provided in Article
--------------------------------
9 with respect to QDROs or as provided in the following sentence, the
interest or property rights of any Participant or Beneficiary in the Plan,
in the Trust Fund or in any distribution to be made under the Plan shall
not be subject to option nor be assignable, either by voluntary or
involuntary assignment or by operation of law, including (without
limitation) bankruptcy, garnishment, attachment or other creditor's
process, and any act in violation of this Section 21.2 shall be void.
Notwithstanding any Plan provision to the contrary, a Participant's Plan
benefits shall be reduced by any amount such Participant is ordered or
required to pay to the Plan if the order or requirement to pay arises (i)
under a judgement or conviction for a crime involving the Plan (ii) under
a civil judgment (including a consent order or decree) entered by a court
in an action brought in connection with a breach (or alleged breach) of
fiduciary duty under ERISA, or (iii) pursuant to a settlement agreement
entered into by the Participant and the Secretary of Labor in connection
with a breach of fiduciary duty under ERISA by a fiduciary or any other
person; provided, however, that the judgment, order, decree, or settlement
agreement expressly provides for the offset of all or part of the amount
ordered or required to be paid to the Plan against the Participant's
benefits under the Plan.
21.3 No Employment Rights. Nothing in the Plan shall be deemed to give any
--------------------
individual a right to remain in the employ of an Affiliate or affect the
right of an Affiliate to terminate an individual's employment at will with
or without cause, at any time with or without notice, for any reason or no
reason, which right is hereby reserved.
21.4 Choice of Law. The Plan and all rights thereunder shall be interpreted
-------------
and construed in accordance with ERISA and, to the extent that state law
is not preempted by ERISA, the law of the State of California.
21.5 Voting of Company Stock. Before each annual or special meeting of the
-----------------------
Company's shareholders, the Company shall cause to be sent to each
Participant who has invested any part of his or her Account in the Company
Stock fund the proxy statement and any related materials that are sent to
the Company's registered shareholders. Each Participant shall have the
right to instruct the Trustee confidentially (in writing on the prescribed
form) with respect to the
52
|
voting at such meeting of the number of shares of Company Stock that were
allocated to the Participant's Account as of the Valuation Date
immediately preceding the record date for such meeting or such later date,
up to and including the record date for such meeting, as the Plan
Administrator may deem practicable. Such instructions shall be submitted
to the Trustee by the date specified by the Company and, once received by
the Trustee, shall be irrevocable. Under no circumstances shall the
Trustee permit any Participating Company or any officer, employee or
representative thereof to see any voting instructions given by a
Participant to the Trustee. The Trustee shall vote any Company Stock for
which it has not received timely written instructions in the same
proportion as the Trustee votes the shares for which timely voting
instructions have been received from Participants.
21.6 Tender Offers. In the event that any person or group makes an offer
-------------
subject to Section 14(d) of the Exchange Act to acquire all or part of the
outstanding Company Stock, including Company Stock held in the Plan
("Acquisition Offer"), each Participant shall be entitled to direct the
Trustee confidentially (on a form prescribed by the Company) to tender all
or part of those shares of Company Stock that would then be subject to
such Participant's voting instructions under Subsection 21.5 above. If the
Trustee receives such an instruction by a date determined by the Trustee
and communicated to Participants, the Trustee shall tender such Company
Stock in accordance with such instruction. Any Company Stock as to which
the Trustee does not receive instructions within such period shall not be
tendered by the Trustee. The Trustee shall obtain and distribute to each
Participant all appropriate materials pertaining to the Acquisition Offer,
including the statement of the position of the Company with respect to
such offer issued pursuant to Regulation 14(e)-2 of the Exchange Act, as
soon as practicable after such materials are issued, provided, however,
that if the Company fails to issue such statement within five (5) business
days after the commencement of such offer, the Trustee shall distribute
such materials to each Participant without such statement by the Company
and shall separately distribute such statement by the Company as soon as
practicable after it is issued. The Trustee shall follow the procedures
regarding confidentiality and verification of compliance with voting
instructions described in Section 21.5 above.
|
22.1 Determination of Top-Heavy Status. Any other provision of the Plan
---------------------------------
notwithstanding, this Article shall apply to any Plan Year in which the
Plan is a Top-Heavy Plan. The Plan shall be considered a "Top-Heavy Plan"
for a Plan Year if, as of the Determination Date for such Plan Year, the
Top-Heavy Ratio for the Aggregation Group exceeds 60 percent.
53
|
22.2 Minimum Allocations. For any Plan Year during which the Plan is a Top-
-------------------
Heavy Plan, the Company Contributions (exclusive of Qualified Nonelective
Contributions and Qualified Matching Contributions) allocated to the
Account of each Participant who is not a Key Employee, but who is an
Employee on the last day of such Plan Year, shall not be less than the
lesser of the following amounts:
(a) Three percent of his or her Top-Heavy Compensation; or
(b) A percentage of his or her Top-Heavy Compensation equal to the
greatest allocation of Company Contributions and Participant Elected
Contributions, expressed as a percentage of Top-Heavy Compensation,
made on behalf of any Participant who is a Key Employee.
22.3 Impact on Maximum Benefits. For any Plan Year in which the Plan is a Top-
--------------------------
Heavy Plan, the number "1.00" shall be substituted for the number "1.25"
wherever it appears in Section 415(e)(2) and (3) of the Code.
22.4 Special Definitions. For purposes of this Article 22, the following
-------------------
definitions shall apply:
(a) "Aggregation Group" means either the Required Aggregation Group or any
-----------------
Permissive Aggregation Group, as the Company may elect.
(b) "Determination Date" means the December 31 next preceding the
------------------
applicable Plan Year.
(c) "Key Employee" means a "key employee" (within the meaning of Section
------------
416(i) of the Code). In applying Section 416(i) of the Code, "annual
compensation" shall mean Top-Heavy Compensation
(d) "Permissive Aggregation Group" means a group of qualified plans that
----------------------------
includes (1) the Required Aggregation Group and (2) one or more plans
of the Affiliated Group that are not part of the Required Aggregation
Group. A Permissive Aggregation Group, when viewed as a single plan,
must satisfy the requirements of Sections 401(a)(4) and 410 of the
Code.
(e) "Required Aggregation Group" means a group of qualified plans that
--------------------------
includes (1) each plan of the Affiliated Group in which a Key Employee
is a participant and (2) each other plan of the Affiliated Group that
enables any plan in which a Key Employee participates to meet the
requirements to Section 401(a)(4) or 410 of the Code.
(f) "Top-Heavy Compensation" means Section 415 Compensation, as defined in
----------------------
Section 16.5(b); provided, however, that Top-Heavy
54
|
Compensation shall not include any amount paid to a Participant for
the Plan Year in excess of the Compensation Limitation.
(g) "Top-Heavy Ratio" means a percentage determined pursuant to Section
---------------
416(g) of the Code.
22.5 Top-Heavy Vesting Rules.
----------------------
(a) The vested interest in the Nonelective Account of each Participant
with one or more Hours of Service in a Plan Year in which the Plan is
a Top-Heavy Plan shall be determined in accordance with the following
|
schedule:
Years of Service Vested Percentage ---------------- ----------------- Less than 2 0% 2 but less than 3 20% 3 but less than 4 40% 4 but less than 5 60% 5 or more 100% |
The vested interest in the Matching Contributions Account of each Participant with one or more Hours of Service in a Plan Year in which the Plan is a Top-Heavy Plan shall be determined under Section 7.2.
(b) If the Plan ceases to be a Top-Heavy Plan, the vesting rules described in Section 7.3 shall again apply to all Years of Service with respect to the Participant's Nonelective Account; however, any Participant described in Subsection (a) who has at least three (3) Years of Service to his or her credit at the time the Plan ceases to be a Top- Heavy Plan shall continue to have his or her vested percentage computed under the Plan in accordance with Subsection (a).
To record the amendment and restatement of the Plan as set forth herein, effective as of October 23, 2000, the Company has caused its authorized officer to execute the same this 6th day of December, 2000.
AMGEN INC.
By: /s/ Steven M. Odre
----------------------------
Steven M. Odre, Senior Vice
President, General Counsel and
Secretary
|
Amgen (Bermuda) Clinical Development, Limited Amgen (Bermuda) Clinical Development 2, Limited Amgen (Bermuda) Clinical Development 3, Limited Amgen (Bermuda) Clinical Development 4, Limited Amgen (Bermuda) Clinical Development 5, Limited Amgen (Bermuda) Clinical Development 6, Limited Amgen (Bermuda) Clinical Development 7, Limited Amgen (Bermuda) Clinical Development 8, Limited
EXHIBIT 10.14
FIRST AMENDMENT TO THE
AMGEN RETIREMENT AND SAVINGS PLAN
AS AMENDED AND RESTATED EFFECTIVE OCTOBER 23, 2000
The Amgen Retirement and Savings Plan as Amended and Restated Effective October 23, 2000, (the "Plan") is hereby amended as follows:
1. Effective December 14, 2000, Kinetix Pharmaceuticals, Inc. shall be a Participating Company for so long as Kinetix Pharmaceuticals, Inc. remains in existence, and Appendix A to the Plan is thereby amended to include Kinetix Pharmaceuticals, Inc.
2. Effective midnight of January 1, 2001, the Kinetix Pharmaceuticals, Inc.
401(k) Plan shall be merged into the Plan to coincide with the upstream
merger of Kinetix Pharmaceuticals, Inc. into the Company. The merged Plan
will conform to the terms of the Plan. Thereafter, Kinetix Pharmaceuticals,
Inc. shall no longer be a Participating Company and Appendix A to the Plan
is thereby amended to delete Kinetix Pharmaceuticals, Inc.
3. Effective June 1, 2001, annuities will be eliminated as a form of distribution. This effective date is at least 90 days following the date on which notice will be provided to Plan participants of the elimination. As such:
a. Section 2.41 is deleted in its entirety.
b. Section 2.47 is deleted in its entirety.
c. Section 8.3 (a) restated in its entirety to read:
Except as provided in Sections 8.5, 8.8 and 8.10, and unless a Participant elects otherwise, the distribution of a Participant's Plan Benefit under Section 8.6 shall occur or commence not later than sixty (60) days after the close of the Plan Year in which occurs the later of (i) the Participant's attainment of Normal Retirement Age or (ii) the Participant's termination of employment. If distribution of a Participant's Plan Benefit has not yet occurred, on or about nine (9) months before the Participant's Normal Retirement Date, the Company shall furnish the Participant with a written explanation of the terms, conditions and forms of distributions available from the Plan with a description of the procedures for electing a form of distribution.
d. Section 8.6 (a) is restated to read:
A Participant's Plan Benefit shall be distributed in any of the following forms that he or she elects:
e. Sections 8.6 (a) (5) is deleted in its entirety.
f. Section 8.7 is deleted in its entirety.
g. Section 8.8 is restated in its entirety to read:
h. Section 8.9 is deleted in its entirety.
i. Section 8.13 is restated in its entirety to read:
To record this First Amendment to the Plan as set forth herein, the Company has caused its authorized officer to execute this document this 26th day of February, 2001.
AMGEN INC.
By: /s/ Steven M. Odre
--------------------------------
Title: Senior Vice President, General
Counsel and Secretary
|
G-CSF UNITED STATES LICENSE AGREEMENT
by and between
KIRIN-AMGEN, INC.,
a California corporation
and
AMGEN INC.,
a Delaware corporation
Page
----
RECITALS. 1
I. DEFINITIONS..................................................... 2
1.01 Incorporation by Reference............................... 2
1.02 Territory................................................ 2
1.03 Party.................................................... 2
1.04 G-CSF.................................................... 2
1.05 G-CSF Products........................................... 2
1.06 G-CSF Technology......................................... 2
1.07 Subsidiary............................................... 3
1.08 Sales Value.............................................. 3
II. GRANT OF LICENSE................................................ 3
2.01 Grant of License........................................... 3
2.02 Rights to Sublicense....................................... 3
III. DISCLOSURE...................................................... 4
3.01 Disclosure............................................... 4
3.02 Confidentiality.......................................... 5
IV. ROYALTY......................................................... 7
4.01 Royalty.................................................. 7
4.02 Sales to Subsidiaries.................................... 7
4.03 Payment of Royalties to Sloan Kettering Cancer Center.... 7
4.04 Records.................................................. 7
4.05 Terms of Accounting...................................... 7
4.06 Late Payments............................................ 8
4.07 Payments................................................. 9
4.08 Taxes.................................................... 9
V. PATENT APPLICATIONS............................................. 10
5.01 Patent Applications...................................... 10
VI. PATENT AND TRADE SECRET ENFORCEMENT............................. 10
6.01 Enforcement.............................................. 10
6.02 Infringements............................................ 10
6.03 Maintenance of Action.................................... 11
|
TABLE OF CONTENTS (Cont'd)
Page
VII. TERM AND TERMINATION............................................. 12
7.01 Term...................................................... 12 7.02 Effective Date............................................ 13 7.03 Default................................................... 13 7.04 Survival.................................................. 13 |
VIII. INFRINGEMENTS.................................................... 14
8.01 Infringements............................................. 14
IX. CONSENTS AND APPROVALS........................................... 14
9.01 Best Efforts.............................................. 14
X. NOTICE........................................................... 15
10.01 Notices................................................... 15
|
XI. MISCELLANEOUS.................................................... 16
11.01 Entire Agreement.......................................... 16
11.02 Headings.................................................. 16
11.03 Execution in Counterparts................................. 16
11.04 Force Majeure............................................. 16
11.05 Applicable Law............................................ 17
11.06 Assignment on Written Consent............................. 17
11.07 Severability.............................................. 17
11.08 No Waiver................................................. 17
11.09 Trademarks and Tradenames................................. 18
11.10 Indemnity................................................. 18
11.11 Other Agreements.......................................... 18
11.12 Remedies.................................................. 18
11.13 Attorneys' Fees and Costs................................. 19
11.14 Number and Gender......................................... 19
11.15 Agreement to Perform Necessary Acts....................... 20
11.16 Representations........................................... 20
SIGNATURE PAGE............................................................ 21
|
EXHIBIT "A", G-CSF
THIS AMGEN/KIRIN-AMGEN, INC. G-CSF UNITED STATES LICENSE AGREEMENT ("Agreement") is made and entered into this lst day of June, 1987 and is made effective as of the 1st day of July, 1986, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN INC., a Delaware corporation ("Amgen").
RECITALS
WHEREAS, effective July 1, 1986, KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), and Amgen assigned all of their right, title and interest in and to the G-CSF Technology (as defined herein) to Company,
WHEREAS, Kirin and Amgen are each being granted a license by Company for the development, manufacture and sale of G-CSF Products (as defined herein), in Japan with respect to Kirin, and in the United States with respect to Amgen,
WHEREAS, Company now desires to more formally document the license agreements from Company to Kirin and Amgen embodied in Amendment No. 3 to the Shareholders' Agreement among Company, Kirin and Amgen dated May 11, 1984, as amended, and certain agreements among Kirin, Amgen, and Company, and
WHEREAS, Company now desires to grant Amgen an exclusive license to further develop, manufacture, and sell G-CSF Products for the territory of the United States (as defined herein),
NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:
ARTICLE I
ARTICLE II
With the prior written consent of Company, which consent shall not be
unreasonably withheld, Amgen shall have the right to sublicense any of the
rights granted to it under this Agreement; provided, however, that any such
sublicensee of Amgen shall undertake in writing to be bound by the provisions of
Section 3.02 hereof to the same extent Amgen is bound. Amgen shall notify the
Company of the identity of each sublicensee to whom a sublicense is granted and
provide the Company a true copy of such sublicense. In the event that the
license granted to Amgen hereunder is terminated at any time in accordance with
Article VII, and the Company shall not be in default under Section 7.03, the
Company shall have the option to terminate or to have Amgen assign to the
Company, retroactive to the date of such termination, any sublicenses granted
hereunder by Amgen. Amgen shall include, in all its sublicenses granted
hereunder provisions for such termination and assignment.
ARTICLE III
(a) The Company shall, in accordance with the Shareholders' Agreement, reasonably disclose and deliver to Amgen all G-CSF Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.
(b) Amgen shall have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the G-CSF Technology. Amgen shall be provided with reasonable notice of the time and place of such meetings.
(a) Any secret or confidential G-CSF Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:
(i) If the disclosure is in written form, by
prominently marking or stamping each document containing such information with a
notice indicating the confidential and proprietary nature of the information;
and
(ii) If the disclosure is in oral form, by orally
stating at the time of such disclosure that the information disclosed is
confidential and proprietary and by delivering to Amgen within fifteen (15)
days of the oral disclosure written notice confirming the confidential and
proprietary nature of the information.
(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, or by another prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential G-CSF Technology disclosed or provided to Amgen by the Company. For the purposes of this
Agreement, G-CSF Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:
(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;
(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure:
(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Amgen in breach of this Agreement; or
(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Amgen may disclose any G-CSF Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the
G-CSF Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.
(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.
ARTICLE IV
responsibility for any and all such royalties in excess of five percent (5%).
(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual period within which is made the first sale of G-CSF Products by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all G-CSF Products sold during such semiannual period, the Sales Value of
such G-CSF Products and the amount of royalty payable thereon (or if no G-CSF Products have been so sold, showing that fact).
(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.
(c) Amgen shall furnish whatever additional information the Company may reasonable prescribe from time to time to enable the Company to ascertain which G-CSF Products sold by Amgen or any of its Subsidiaries or sublicensees permitted under this Agreement are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.
or transfer of licenses or other rights or considerations hereunder, and any tax which Amgen is required to withhold or deduct from payments to the Company, except any such tax imposed upon the Company by any governmental entity within or without the United States.
ARTICLE V
ARTICLE VI
the making, use or sale of G-CSF Products. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Amgen lack standing to bring any such action then Amgen may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Amgen.
represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.
ARTICLE VII
ARTICLE VIII
ARTICLE IX
ARTICLE X
"Amgen" Amgen Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Telex No. 499-9315 (AMGEN)
Attn: Corporate Secretary
With a copy to: Cooley, Godward, Castro,
Huddleson & Tatum
Five Palo Alto Square, 4th Floor
Palo Alto, CA 94306
U.S.A.
Telex No. 910-372-7370 Cooley SFO
Attn: Alan C. Mendelson, Esq.
-15-
|
"Company" Kirin-Amgen, Inc
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
_ Telex No. 4994440 (AMGEN)
Attn: Corporate Secretary
With a copy to: Pettit & Martin
355 South Grand Avenue
Thirty-Third Floor
Los Angeles, CA 90071
Telex No. 181025 PEMLAW LSA
Attn: Joel S. Marcus, Esq.
|
Any party by giving notice to the others in the manner provided above may change such party's address for purposes of this Section 10.01.
ARTICLE XI
herein shall not in any way be affected or impaired thereby. In such event, such invalid provision or provisions shall be validly reformed to as nearly approximate the intent of the parties as possible and if unreformable, shall be severed and deleted from this Agreement.
fees may be included in and as part of such judgment. The successful party shall be the party who is entitled to recover its costs of suit, whether or not the suit proceeds to final judgment. A party not entitled to recover its costs shall not recover attorneys' fees.
[SIGNATURE PAGE FOLLOWS]
IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.
KIRIN-AMGEN, INC., a
California corporation
By /s/ Y. Yamamoto
Its --------
-------------------------
|
"Company"
AMGEN INC., a Delaware corporation
By /s/ George B. Rathmann
--------------------------
-------- Its
"Amgen"
|
Amino acids [23-30] Lys Ile Gln Gly Asp Gly Ala Ala
mRNA AAG AUC CAG GGC GAU GGC GCA GCG
Probes [24-23 mers TTC TAC GTC CCT CTA CCT GGT CG
B -12 -10
ELU TRP HIS SER ALA LEU TRP THR VAL GLN GLU ALA THR PRO LEU CIG TGG CAC AGI GIA CIC TGG ACR GIG CAG GAA GCC ACC CCC CIG
10
ALY PRO ALA SER SER LEU PRO GLN SER PHE LEU LEU LYS CYS LEU GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC AAG TGC TTA
20 30 phe ALU GLN VAL ARG LYS ILE GLN GLY ASP GLY ALA ALA LEU GLN GLN GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG
gly
LYS LEU CYS ALA THR TYR LYS LEU CYS HIS PRO GLU GLU LEU VAL AAG CTG TGT GCC ACC TAC AAG CTG TGT CAC CCC GAG GAG CTG GTG
50 60 LEU LEU GLY HIS SER LEU GLY ILE PRO TRP ALA PRO LEU SER SER CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC CTG AGC AGC
CYS PRO SER GLN ALA LEU GLN LEU ALA GLY CYS LEU SER GLN LEU TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC CAA CTC
80 90 HIS SER GLY LEU PHE LEU TYR GLN GLY LEU LEU GLN ALA LEU GLN CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG GCC CTG GAA
GLY ILE SER PRO GLU LEU GLY PRO THR LEU ASP THR LEU GLN LEU GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG
110 120 ASP VAL ALA ASP PHE ALA THR THR ILE TRP GLN GLN MET GLU GLU GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA
LEU GLY MET ALA PRO ALA LEU GLN PRO THR GLN GLY ALA MET PRO CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT GCC ATG CCG
140 150 ALA PHE ALA SER ALA PHE GLN ARG ARG ALA GLY GLY VAL LEU VAL GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT
ALA SER HIS LEU GLN SER PHE LEU GLU VAL SER TYR ARG VAL LEU GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA
170 174 ARG HIS LEU ALA GLN PRO OP CGC CAC CTT GCC CAG CCC TGA GCCAAGCCCTCCCCATCCCATGTATTTATCT
tsa (pound) 1, c CTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGG AGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCA GTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCA AGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGC CGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTC CCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGG TCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGG CTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCC CACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACT CCCGAACATCACCGACGTGTCTCCTGTTTTTCTGGGTGGCCTCGGGACACCTGCCCTGC CCCCACGAGGGTCAGGACTGTGACTCTTTTTAGGGCTAGGCAGGTGCCTGGACATTTGC CTTGCTGGACGGGGACTGGGGATGTGGGAGGGAGCAGACAGGAGGAATCATGTCAGGCC TGTGTGTGAAAGGAAGCTCCACTGTCACCCTCCACCTCTTCACCCCCCACTCACCAGTG TCCCCTCCACTGTCACATTGTAACTGAACTTCAGGATAATAAAGTGTTTGCCTCCAA EXHIBIT "A"
THIS AMENDMENT N0. 1 ("Amendment No. 1") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF UNITED STATES LICENSE AGREEMENT ("License Agreement"), is made and entered into this 20th day of October, 1988, by and between AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
R E C I T A L S
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF.
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 1.
NOW, THEREFORE, it is agreed as follows:
1. Article I, Section 1.08 at page 3 of the License Agreement is hereby deleted and the following substituted in lieu thereof:
2. Except to the extent as provided herein, the provisions of the License Agreement are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 1 to be executed as of the first day written above.
AMGEN INC.,
a Delaware corporation
By /s/ George B. Rathmann
George B. Rathmann, President
"Amgen"
|
KIRIN-AMGEN, INC.,
a California corporation
By /s/ Yashushi Yamamoto
Yasushi Yamamoto, Chairman
"Corporation"
|
R E C I T A L S
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF.
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 2.
NOW, THEREFORE, it is agreed as follows:
1. Article IV, Sections 4.01 and 4.03 at pages 7-8 of the License Agreement are hereby deleted and the following substituted in lieu thereof:
"ARTICLE IV
2. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned has caused this Amendment No. 2 to be executed as of the first day written above.
AMGEN INC., a Delaware corporation
By /s/ Gordon M. Binder Gordon M. Binder Chief Executive Officer |
"Amgen"
KIRIN-AMGEN, INC., a
Delaware corporation
By /s/ T. Sasahara
Toru Sasahara, Chairman
"Corporation"
|
AMENDMENT NO. 10
TO SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN
AMENDMENT NO. 10 (this "Amendment") made effective as of March 1, 1996 (the "Effective Date") to the Shareholders' Agreement of Kirin-Amgen dated May 11, 1984 (as amended, the "Shareholders' Agreement") among Kirin Brewery Co., Ltd., a Japanese corporation with principal offices located at 10-1, Shinkawa 2-chome, Chuo-ku, Tokyo, 104, Japan ("Kirin"), Amgen Inc. , a Delaware corporation with principal offices located at Amgen Center, Thousand Oaks, California 91320 ("Amgen") and Kirin-Amgen, Inc., a Delaware corporation with principal offices located at c/o Amgen Europe AG, Grabenhof, 6010 Kirens, Switzerland ("Kirin- Amgen").
RECITALS
WHEREAS, Amgen has discovered a novel growth factor that has erythropoiesis stimulating activity ("NM321" as further defined in the NM321 Technology Transfer Agreement effective as of March 1, 1996 among Kirin, Amgen, and Kirin- Amgen, the "Technology Agreement").
WHEREAS, Kirin and Amgen believe that NM321 may have important human therapeutic uses and its discovery and development for future sale represents a significant commercial opportunity.
WHEREAS, Kirin-Amgen wishes to obtain rights to develop and commercialize products based on NM321.
WHEREAS, Kirin and Amgen now wish to add NM321 to their existing relationship.
NOW THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties agree as follows:
Kirin-Amgen will fund Amgen's future research and development activities as provided in the Research Agreement.
(a) In exchange for the license to Kirin in the Kirin Core Territory, Kirin will pay to Kirin-Amgen a royalty equal to five percent (5%) of the Sales Value of NM321 Products (as defined in the Technology Agreement) sold by or on behalf of Kirin in the Kirin Core Territory.
(b) In the event it is necessary for Kirin to pay a royalty to a third party for making, using, or selling an NM321 Product in a country in the Kirin Core Territory, the royalty Kirin pays to Kirin-Amgen in such country will be reduced by fifty percent (50%) of the third party royalty, provided, however, in no event will Kirin's royalties in any country be reduced to less than three percent (3%) by reason of third party royalty reduction.
(c) In any case, Kirin's royalty obligation to Kirin-Amgen shall be reduced to two percent (2%) only with respect to the aggregate cumulative Sales Value of NM321 Products above Five Hundred Million US. Dollars (US $500,000,000).
(a) In exchange for the license to Amgen in the Amgen Core Territory, Amgen will pay to Kirin-Amgen a royalty equal to three percent (3%) of the Sales Value of NM321 Products sold by or on behalf of Amgen in the Amgen Core Territory. Amgen's royalty obligation to Kirin- Amgen in the Amgen Core Territory shall be reduced to two percent (2%) only with respect to the aggregate cumulative Sales Value of NM321 sold by or on behalf of Amgen in the Amgen Core Territory above five hundred million U.S. dollars (US $500,000,000).
(b) In exchange for the license to Amgen in the Amgen Additional Territory, Amgen will pay to Kirin-Amgen a royalty equal to two percent (2%) of the Sales Value of NM321 Products sold by or on behalf of Amgen in the Amgen Additional Territory.
(c) In exchange for the license to Amgen in the Amgen Option Territory, Amgen will pay to Kirin-Amgen a royalty equal to:
(i) five percent (5%) of the Sales Value of NM321 Products sold by or on behalf of Amgen in countries in the Amgen Option Territory that are not signatories to the North American Free Trade Agreement (NAFTA); and
(ii) two percent (2%) of the Sales Value of NM321 Products sold by or on behalf of Amgen in countries in the Amgen Option Territory that are signatories to the North American Free Trade Agreement (NAFTA).
the NM321 Technology, Amgen Core Technology and/or Kirin Core Technology in the Kirin-Amgen Territory shall be the simultaneous worldwide utilization of the NM321 Technology.
within the NM321 Technology in the Amgen Additional Territory and Amgen Option Territory. The associated costs and expenses will be borne by Kirin- Amgen.
associated costs and expenses will be borne as agreed between Kirin and Kirin-Amgen on a case by case basis.
making, having made, using, selling or having sold NM321 Products in the Kirin Core Territory. Kirin-Amgen shall bear all costs and expenses associated therewith.
IN WITNESS WHEREOF, the undersigned have caused this Amendment to be executed by their duly authorized representatives in the manner legally binding upon them.
Kirin Brewery Co., Ltd.
By: /s/ Koichiro Aramaki Koichiro Aramaki Ph.D. Title: President, Pharmaceutical Div. November 28, 1996 Date |
Amgen Inc.
By: /s/ K. Sharer
Kevin Sharer
Title:
December 9, 1996
Date
|
Kirin-Amgen, Inc.
By: /s/ Daryl Hill
Daryl Hill
Title:
December 9, 1996
Date
|
AMENDMENT NO. 11
TO SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN
AMENDMENT NO. 11 (this "Amendment") made effective as of March 20, 2000 (the "Effective Date") to the Shareholders' Agreement of Kirin-Amgen dated May 11, 1984 (as amended, the "Shareholders' Agreement") among Kirin Brewery Co., Ltd., a Japanese corporation with principal offices located at 10-1, Shinkawa 2-chome, Chuo-ku, Tokyo, 104, Japan ("Kirin"), Amgen Inc., a Delaware corporation with principal offices located at One Amgen Center Drive, Thousand Oaks, California 91320 ("Amgen") and Kirin-Amgen, Inc., a Delaware corporation with principal offices located at c/o Amgen Europe AG, Grabenhof, 6010 Kirens, Switzerland ("Kirin-Amgen").
RECITALS
WHEREAS, Kirin, Amgen and Kirin-Amgen have entered into the following agreements (collectively referred to as the "NM321 Agreements") regarding a novel growth factor that has erythropoiesis stimulating activity ("NM321" as further defined in the NM321 Agreements):
"Amendment No. 10 to Shareholder's Agreement of Kirin-Amgen" effective March 1, 1996 by and among Kirin, Amgen and Kirin-Amgen ("Amendment No. 10");
"NM321 Technology Transfer Agreement" effective March 1, 1996 by and among Kirin, Amgen and Kirin-Amgen ("Technology Transfer Agreement");
"Research, Development and Technology Disclosure Agreement: NM321" effective March 1, 1996 by and among Kirin, Amgen and Kirin-Amgen ("Research Development Agreement");
"NM321 License Agreement" effective March 1, 1996 by and between Kirin-Amgen and Kirin ("Kirin License Agreement"); and
"NM321 License Agreement" effective March 1, 1996 by and between Kirin-Amgen and Amgen ("Amgen License Agreement").
WHEREAS, during the time period from January 1, 1997 to December 31, 1999, Amgen conducted certain clinical trials and other development-related activities related to the development of NM321 Products outside the United States which development activities were not covered by the NM321 Agreements and which activities were not paid for by Kirin-Amgen ("Amgen 1997-1999 Ex-US NM321 Development Activities").
WHEREAS, the Amgen 1997-1999 Ex-US NM321 Development Activities have resulted in a significant amount of information and proprietary data whether tangible or intangible, including any and all data, pre-clinical and clinical results, techniques, discoveries, inventions, ideas, processes, know-how, patents, inventor's certificates, trade secrets and other proprietary information and any physical, chemical or biological material (including cell lines) and any replication of any part of such material (the "Amgen 1997-1999 Ex-US NM321 Data") to which Kirin-Amgen does not have rights under the NM321 Agreements.
WHEREAS, Kirin, Amgen and Kirin-Amgen have now determined that the Amgen 1997-1999 Ex-US NM321 Data is important to Kirin-Amgen's NESP development activities and
it is in the best interest of Kirin-Amgen to obtain access to the Data for use in connection with the development, manufacture, use or sale of NM321 Products in the Kirin Core Territories.
WHEREAS, from January 1, 2000 through the end of NESP development activity,
Amgen intends to continue to conduct Amgen Ex-US NM321 Development Activities,
which activities are likely to result in additional Amgen Ex-US NM321 Data
("Amgen 2000 Ex-US NM321 Data", "Amgen 2001 Ex-US NM321 Data", etc.)
(collectively "Future Amgen Ex-US NM321 Data").
WHEREAS, Kirin, Amgen and Kirin-Amgen believe that it is in the best interest of Kirin-Amgen to have the option prior to each calendar year to acquire access to the Amgen Ex-US NM321 Data to be generated during that coming year for use in connection with the development, manufacture, use or sale of NM321 Products in the Kirin Core Territories.
WHEREAS, Kirin plans to conduct certain development activities related to NM321 outside of Japan ("Kirin Ex-Japan NM321 Development Activities"), and the parties have determined that such activities may result in proprietary data ("Kirin Ex-Japan NM321 Data") which could be beneficial to the partnership.
WHEREAS, Kirin, Amgen and Kirin-Amgen have determined that it is in the best interest of Kirin-Amgen to obtain access to the Kirin Ex-Japan NM321 Data for use in connection with the development, manufacture, use or sale of NM321 Products world-wide.
WHEREAS, the parties entered into a Binding Term Sheet by and among Kirin, Amgen and Kirin-Amgen effective as of March 20, 2000 (the "Binding Term Sheet") containing the material terms of this Agreement, and agreeing to enter into a "Definitive Agreement" as defined in the Binding Term Sheet, and the parties now wish this to be the Definitive Agreement referenced in the Binding Term Sheet.
NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties agree as follows:
(a) Thirty Seven Million Five Hundred Thousand US Dollars (USD $37,500,000), which was paid to Amgen in March 2000 upon execution of the Binding Term Sheet.
(b) Thirty Seven Million Five Hundred Thousand US Dollars (USD $37,500,000) upon receipt by Amgen of all necessary regulatory approvals for, and the completion of, the first commercial sale of an NM321 Product in any country within the Amgen Additional Territory. Amgen will invoice Kirin-Amgen for this amount upon completion of such first commercial sale, and Kirin-Amgen shall pay that amount in full within 30 days of receipt of such invoice.
Example: For year 2001, Amgen must present Kirin-Amgen with a summary
description of its 2001 Ex-US NM321 Development Activities by August
31, 2000. Kirin Amgen must then elect by September 30, 2000 whether or
not to exercise its option to acquire a license to the Amgen 2001
Ex-US NM321 Data. Upon exercise of such option, Kirin-Amgen shall
acquire the exclusive license (within the Kirin Core Territory) to the
Amgen 2001 Ex-US NM321 Data for use in connection with the
development, manufacture, use or sale of NM321 Products in the Kirin
Core Territory.
Note: with respect to Amgen 2000 Ex-US NM321 Data only, Amgen shall
provide a description of its 2000 Ex-US Development Activities to
Kirin-Amgen and Kirin-Amgen shall have thirty days from that time to
make its election.
Upon Kirin-Amgen's exercise of its right to acquire a license to any Data pursuant to this Section 1.03, Kirin-Amgen's interest in any licensed Data shall be considered Research Project Technology for purposes of the NM321 Agreements; as such, the license granted to Kirin from Kirin-Amgen in the Kirin License Agreement will include rights to all such licensed Data. Regardless of Kirin-Amgen's exercise of its option with respect to any Future Amgen Ex-US
NM321 Data, Amgen retains sole authority and discretion over all aspects of the Amgen Ex-US NM321 Development Activities.
3. ADJUSTMENT TO ROYALTIES
In exchange for the license to Amgen in the Amgen Additional Territory, Amgen will pay to Kirin-Amgen a royalty equal to three percent (3%) of the Sales Value of NM321 Products sold by or on
behalf of Amgen in the Amgen Additional Territory. Amgen's royalty obligation to Kirin-Amgen in the Amgen Additional Territory shall be reduced to two percent (2%) only with respect to the aggregate cumulative Sales Value of NM321 Product sold by or on behalf of Amgen in the Amgen Additional Territory above five hundred million U.S. dollars (US$ 500,000,000).
4. CONSISTENCY WITH SHAREHOLDERS' AGREEMENT; RATIFICATION; DEFINED TERMS
5. MISCELLANEOUS
IN WITNESS WHEREOF, the undersigned have caused this Amendment to be executed by their duly authorized representatives in the manner legally binding upon them.
Kirin Brewery Co., Ltd.
/s/ Koichiro Aramaki
By: Koichiro Aramaki Ph.D.
Title: President, Pharmaceutical Div.
June 30, 2000
Date
|
Amgen Inc.
/s/ Craig Brooks
By: Craig Brooks
Title: Vice President,
Asia Pacific/Latin America
June 30, 2000
Date
|
Kirin-Amgen, Inc.
/s/ Katsuhiko Asano Katsuhiko Asano, Ph.D. Chairman June 30, 2000 Date |
THIS AMENDMENT N0. 1 ("Amendment No. 1") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF EUROPEAN LICENSE AGREEMENT ("License Agreement"), is made and entered into this 1st day of June, 1987, by and between AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF.
B. The parties desire to incorporate certain definitional changes into the License Agreement.
NOW, THEREFORE, it is agreed as follows:
1. Article I at pages 2-3 of the License Agreement is hereby amended as follows:
"ARTICLE I
2. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 1 to be executed as of the first day written above .
AMGEN INC., a Delaware corporation
By /s/ George B. Rathmann ------------------------------------- George B. Rathmann, President |
"Amgen"
KIRIN-AMGEN, INC., a
California corporation
By /s/ Y. Yamamoto ------------------------------------------ Yashushi Yamamoto, Chairman |
"Corporation"
A Amino acids [23-30] Lys Ile Gln Gly Asp Gly Ala Ala
mRNA AAG AUC CAG GGC GAU GGC GCA GCG
Probes [24-23 mers] TTC TAC GTC CCT CTA CCT GGT CG
B -12 -10
|
ELU TRP HIS SER ALA LEU TRP THR VAL GLN GLU ALA THR PRO LEU CIG TGG CAC AGI GIA CIC TGG ACR GIG CAG GAA GCC ACC CCC CIG
10
ALY PRO ALA SER SER LEU PRO GLN SER PHE LEU LEU LYS CYS LEU
GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC AAG TGC TTA
20 30 phe ALU GLN VAL ARG LYS ILE GLN GLY ASP GLY ALA ALA LEU GLN GLN GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG
gly
LYS LEU CYS ALA THR TYR LYS LEU CYS HIS PRO GLU GLU LEU VAL
AAG CTG TGT GCC ACC TAC AAG CTG TGT CAC CCC GAG GAG CTG GTG
50 60 LEU LEU GLY HIS SER LEU GLY ILE PRO TRP ALA PRO LEU SER SER CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC CTG AGC AGC
CYS PRO SER GLN ALA LEU GLN LEU ALA GLY CYS LEU SER GLN LEU TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC CAA CTC
80 90 HIS SER GLY LEU PHE LEU TYR GLN GLY LEU LEU GLN ALA LEU GLN CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG GCC CTG GAA
GLY ILE SER PRO GLU LEU GLY PRO THR LEU ASP THR LEU GLN LEU GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG
110 120 ASP VAL ALA ASP PHE ALA THR THR ILE TRP GLN GLN MET GLU GLU GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA
LEU GLY MET ALA PRO ALA LEU GLN PRO THR GLN GLY ALA MET PRO CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT GCC ATG CCG
140 150 ALA PHE ALA SER ALA PHE GLN ARG ARG ALA GLY GLY VAL LEU VAL GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT
ALA SER HIS LEU GLN SER PHE LEU GLU VAL SER TYR ARG VAL LEU GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA
170 174 ARG HIS LEU ALA GLN PRO OP CGC CAC CTT GCC CAG CCC TGA GCCAAGCCCTCCCCATCCCATGTATTTATCT
CTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGG
AGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCA
GTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCA
AGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGC
CGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTC
CCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGG
TCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGG
CTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCC
CACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACT
CCCGAACATCACCGACGTGTCTCCTGTTTTTCTGGGTGGCCTCGGGACACCTGCCCTGC
CCCCACGAGGGTCAGGACTGTGACTCTTTTTAGGGCTAGGCAGGTGCCTGGACATTTGC
CTTGCTGGACGGGGACTGGGGATGTGGGAGGGAGCAGACAGGAGGAATCATGTCAGGCC
TGTGTGTGAAAGGAAGCTCCACTGTCACCCTCCACCTCTTCACCCCCCACTCACCAGTG
TCCCCTCCACTGTCACATTGTAACTGAACTTCAGGATAATAAAGTGTTTGCCTCCAA
EXHIBIT "A"
THIS AMENDMENT NO. 2 ("Amendment No. 2") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF EUROPEAN LICENSE AGREEMENT ("License Agreement"), is made and entered into this 15th day of March, 1988, by and between AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF and Amendment No. 1
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No . 2.
NOW, THEREFORE, it is agreed as follows:
1. Article II, Section 2.03(c) at page 5 of the License Agreement is hereby amended as follows:
"1) $500,000 (U.S.) - Demonstration of the utility of G-CSF as an adjunct to chemotherapy.
2) $500,000 (U.S.) - Finalization of Phase III protocol and completion of investigators meeting.
3) $500,000 (U.S.) - Due on 30 days after the filing of Registration in any country in the Territory, provided such filing has not been rejected within the intervening period. If the filing is rejected within the intervening period, the amount will become due upon filing the corrected Registration."
2. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.
In WITNESS WHEREOF, the undersigned have caused this Amendment No. 2 to be executed as of the first day written above.
AMGEN INC.,
a Delaware corporation
By /s/ George B. Rathmann
-----------------------------------------
George B. Rathmann, President
"Amgen"
|
KIRIN -AMGEN, INC.,
a California corporation
By /s/ Y. Yamamoto
-----------------------------------------
Yashushi Yamamoto, Chairman
"Corporation"
|
[LETTERHEAD OF KIRIN]
April 1, 1988
Mr. Robert D. Weist
Senior Vice President
Amgen, Inc.
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.
Dear Bob:
As per your request, we will send you by faxcimile a copy of letter agreement for G-CSF registration milestone amendment with Dr. Yamamoto's signature.
We will send you the original letter by separate mail.
Formal documentation should be executed at the coming Board of Directors Meeting on April 15, 1988.
Sincerely yours,
/s/ Toshikazu Doi ----------------- Toshikazu Doi Pharmaceuticals Dept. |
cc: Mr. G. Binder
Mr. L. Sears
Mr. K. Aramaki
Amgen and Kirin agree that Section 2.03(c) of the G-CSF European License Agreement between Kirin-Amgen and Amgen should be amended so that the milestone be payable as follows:
1)$500,000 (U.S.) - Demonstration of the utility of G-CSF as an adjunct to chemotherapy.
2)$500,000 (U.S.) - Finalization of Phase III protocol and completion of investigators meeting.
3)$500,000 (U.S.) - Due on 30 days after the filing of Registration in any country in the Territory, provided such filing has not been rejected within the intervening period. If the filing is rejected within the intervening period, the amount will become due upon filing the corrected Registration.
/s/ George B. Rathmann ------------------------------------- George B. Rathmann, Amgen Inc. /s/ Y. Yamamoto ------------------------------------- Kirin Brewery Company, Ltd. |
THIS AMENDMENT N0. 3 ("Amendment No. 3") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF EUROPEAN LICENSE AGREEMENT ("License Agreement"), is made and entered into this 20th day of October, 1988, by and between AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF and Amendment Nos. 1 and 2.
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 3.
NOW, THEREFORE, it is agreed as follows:
1. Article I, Section 1.08 at page 3 of the License Agreement is hereby deleted and the following substituted in lieu thereof:
2. Exhibit "A" attached hereto listing the countries of Europe which comprise the Territory of Europe shall be substituted in lieu of the map of the Territory of Europe attached as Exhibit "A" to the License Agreement.
3. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 3 to be executed as of the first day written above.
AMGEN INC.,
a Delaware corporation
By /s/ George B. Rathmann
--------------------------------
George B. Rathmann, President
"Amgen"
|
KIRIN-AMGEN, INC.,
a California corporation
By /s/ Yashushi Yamamoto
--------------------------------
Yashushi Yamamoto, Chairman
"Corporation"
|
EXHIBIT "A"
THIS AMENDMENT NO. 4 ("Amendment No. 4") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF EUROPEAN LICENSE AGREEMENT ("License Agreement"), is made and entered into this 29/TH/ day of December, 1989, by and between AMGEN INC., a Delaware corporation ("Amgen") and KIRIN-AMGEN, INC., a California corporation ("Corporation").
A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF and Amendment Nos. 1, 2 and 3.
B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 4.
NOW, THEREFORE, it is agreed as follows:
1. Article II, Section 2.03(d) and (e) at page 5 of the License Agreement are hereby deleted and the following substituted in lieu thereof:
"(d) $3,000,000 (U.S.) -- Filing of a Product Licensing Application in the United States."
2. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 4 to be executed as of the first day written above.
AMGEN INC., a Delaware corporation
By /s/ Gordon M. Binder
------------------------------
Gordon M. Binder, Chief
Executive Officer
|
"Amgen"
KIRIN-AMGEN, INC.,
a California corporation
By /s/ Y. Yamamoto
------------------------------
Yashushi Yamamoto, Chairman
|
"Corporation"
EXHIBIT 10.40
KINETIX PHARMACEUTICALS, INC.
AMENDED AND RESTATED 1997 EQUITY INCENTIVE PLAN
1. Purpose
2. Administration
The Plan shall be administered by the Committee. The Committee shall select the Participants to receive Awards and shall determine the terms and conditions of the Awards. The Committee shall have authority to adopt, alter and repeal such administrative rules, guidelines and practices governing the operation of the Plan as it shall from time to time consider advisable, and to interpret the provisions of the Plan. The Committee's decisions shall be final and binding. To the extent permitted by applicable law, the Committee may delegate to one or more executive officers of the Company the power to make Awards to Participants and all determinations under the Plan with respect thereto, provided that the Committee shall fix the maximum amount of such Awards for all such Participants and a maximum for any one Participant.
3. Eligibility
All employees and consultants of the Company or any Affiliate capable of contributing significantly to the successful performance of the Company, other than a person who has irrevocably elected not to be eligible, are eligible to be Participants in the Plan. Incentive Stock Options may be granted only to persons eligible to receive such Options under the Code.
4. Stock Available for Awards
(a) Amount. Subject to adjustment under subsection (b), Awards may be made under the Plan for up to 10,144,483 shares of Common Stock. If any Award expires or is terminated unexercised or is forfeited or settled in a manner that results in fewer shares outstanding than were awarded, the shares subject to such Award, to the extent of such expiration, termination, forfeiture or decrease, shall again be available for award under the Plan. Common Stock issued through the assumption or substitution of outstanding grants from an acquired company shall not reduce the shares available for Awards under the Plan. Shares issued under the Plan may consist in whole or in part of authorized but unissued shares or treasury shares.
(b) Adjustments Upon Certain Transactions. In the event that any dividend or other distribution (whether in the form of cash, Common Stock, other securities, or other property), recapitalization, reclassification, stock split, reverse stock split, reorganization, merger, consolidation, split-up, spin-off, combination, repurchase, liquidation, dissolution, or sale, transfer, exchange or other disposition of all or substantially all of the asserts of the Company, or exchange of Common Stock or other securities of the Company (other than pursuant to the conversion of convertible securities), issuance of warrants or other rights to purchase Common Stock or other securities of the Company, or other similar corporate transaction or event, in the Committee's sole discretion, affects the Common Stock, such that an adjustment is determined by the Committee to be appropriate in order to prevent dilution or enlargement of the benefits or potential benefits intended to be made available under the Plan or with respect to Awards, then the Committee shall (subject in the case of Incentive Stock Options to any limitation required under the Code), in such manner as it may deem equitable, may make the following adjustments to the Plan and with respect to any or all of the outstanding Awards:
(1) the number and kind of shares of Common Stock (or other securities or property) with respect to which Awards may be granted under the Plan (including, but not limited to, adjustments of the limitations in paragraph 4(a) on the maximum number),
(2) the number and kind of shares of Common Stock (or other securities or property) subject to outstanding Awards, including by providing, either by the terms of such Awards or by action taken prior to the occurrence of such transaction or event, that upon such event, such Award shall be assumed by a successor or survivor corporation, or a parent or subsidiary thereof, or shall be substituted for by similar Awards covering the stock of a successor or survivor corporation, or a parent or subsidiary thereof, with appropriate adjustments as to the number and kind of shares and prices, and
(3) the grant or exercise price with respect to any Award.
(c) Effect of Adjustments. Any adjustments made by the Committee under paragraphs 4(b)(1) and 4(b)(2) shall be final, binding and conclusive on all persons.
5. Stock Options
(b) Terms and Conditions. Each Option shall be exercisable at such times and subject to such terms and conditions as the Committee may specify in the applicable grant or thereafter. The Committee may impose such conditions with respect to the exercise of Options, including conditions relating to applicable federal or state securities laws, as it considers necessary or advisable.
(c) Payment. Payment for shares to be delivered pursuant to any exercise of an Option may be made in whole or in part in cash or, to the extent permitted by the Committee at or after the grant of the Option, by delivery of a note or other commitment satisfactory to the Committee or shares of Common Stock owned by the optionee, including Restricted Stock, or by retaining shares otherwise issuable pursuant to the Option, in each case valued at their Fair Market Value on the date of delivery or retention, or such other lawful consideration as the Committee may determine.
6. Restricted Stock
(b) Restrictions. Shares of Restricted Stock may not be sold, assigned, transferred, pledged or otherwise encumbered, except as permitted by the Committee, during the Restricted Period. Shares of Restricted Stock shall be evidenced in such manner as the Committee may determine. Any certificates issued in respect of shares of Restricted Stock shall be registered in the name of the Participant and unless otherwise determined by the Committee, deposited by the Participant, together with a stock power endorsed in blank, with the Company. At the expiration of the Restricted Period, the Company shall deliver such certificates to the Participant or if the Participant has died, to the Participant's Designated Beneficiary.
7. General Provisions Applicable to Awards
(a) Documentation. Each Award under the Plan shall be evidenced by a writing delivered to the Participant specifying the terms and conditions thereof and containing such other terms and conditions not inconsistent with the provisions of the Plan as the Committee considers necessary or advisable to achieve the purposes of the Plan or to comply with applicable tax and regulatory laws and accounting principles.
(b) Committee Discretion. Each type of Award may be made alone, in addition to or in relation to any other Award. The terms of each type of Award need not be identical, and the Committee need not treat Participants uniformly. Except as otherwise provided by the Plan or a particular Award, any determination with respect to an Award may be made by the Committee at the time of grant or at any time thereafter.
(c) Dividends and Cash Awards. In the discretion of the Committee, any Award under the Plan may provide the Participant with (i) dividends or dividend equivalents payable currently or deferred with or without interest and (ii) cash payments in lieu of or in addition to an Award.
(d) Termination of Employment. The Committee shall determine the effect on an Award of the disability, death, retirement or other termination of employment of a Participant and the extent to which, and the period during which, the Participant's legal representative, guardian or Designated Beneficiary may receive payment of an Award or exercise rights thereunder.
(e) Change in Control.
(1) Notwithstanding anything to the contrary in this Plan, in the event of a Change in Control (as hereinafter defined), then, to the extent permitted by applicable law: (i) the time during which Awards become vested shall automatically be accelerated so that the unvested portions of all Awards shall be vested prior to the Change in Control and (ii) the time during which the Options may be exercised shall automatically be accelerated to immediately prior to the Change in Control. Upon and following the acceleration of the vesting and exercise periods, the Award may be: (x) exercised (with respect to Options) or, if the surviving or acquiring corporation agrees to assume the Awards or substitute similar stock awards, (y) assumed; or (z) replaced with substitute stock awards. Options not exercised, substituted or assumed prior to or upon the Change in Control shall be terminated.
(2) For purposes of the Plan, subject to Section 7(e)(3) below, a "Change of Control" shall be deemed to have occurred at any of the following times:
(i) upon the acquisition (other than from the Company) by any person, entity or "group," within the meaning of Section 13(d)(3) or 14(d)(2) of the Exchange Act (excluding, for this purpose, the Company or its Affiliates, or any employee benefit plan of the Company or its Affiliates which acquires beneficial ownership of voting securities of the Company), of
beneficial ownership (within the meaning of Rule 13d-3 promulgated under the Exchange Act) of fifty percent (50%) or more of either the then outstanding shares of Common Stock or the combined voting power of the Company's then outstanding voting securities entitled to vote generally in the election of directors; or
(ii) at the time individuals who, as of the Effective Time, constitute the Board (the "Incumbent Board") cease for any reason to constitute at least a majority of the Board, provided that any person becoming a director subsequent to the Effective Time, whose election, or nomination for election by the Company's stockholders, was approved by a vote of at least a majority of the directors then comprising the Incumbent Board (other than an election or nomination of an individual whose initial assumption of office is in connection with an actual or threatened election contest relating to the election of the directors of the Company, as such terms are used in Rule 14a-11 of Regulation 14A promulgated under the Exchange Act) shall be, for purposes of the Plan, considered as though such person were a member of the Incumbent Board; or
(iii) immediately prior to the consummation by the Company of a reorganization, merger, consolidation, (in each case, with respect to which persons who were the stockholders of the Company immediately prior to such reorganization, merger or consolidation do not, immediately thereafter, own more than fifty percent (50%) of the combined voting power entitled to vote generally in the election of directors of the reorganized, merged or consolidated company's then outstanding voting securities) or a liquidation or dissolution of the Company or of the sale of all or substantially all of the assets of the Company; or
(iv) the occurrence of any other event which the Incumbent Board in its sole discretion determines constitutes Change of Control.
(3) For purposes of any Award granted pursuant to (S)6(e) of the Merger Agreement, a "Change of Control" shall not be deemed to have occurred upon the Closing of the Merger or the Upstream Merger (as defined in the Merger Agreement) or as a result of any transaction or event contemplated in the Merger Agreement.
(f) Loans. The Committee may authorize the making of loans or cash payments to Participants in connection with the grant or exercise of any Award under the Plan, which loans may be secured by any security, including Common Stock, underlying or related to such Award (provided that the loan shall not exceed the Fair Market Value of the security subject to such Award), and which may be forgiven upon such terms and conditions as the Committee may establish at the time of such loan or at any time thereafter.
(g) Withholding Taxes. The Participant shall pay to the Company, or make provision satisfactory to the Committee for payment of, any taxes required by law to be withheld in respect of Awards under the Plan no later than the date of the event creating the tax liability. In the Committee's discretion, such tax obligations may be paid in whole or in part in shares of Common Stock, including shares retained from the Award creating the tax obligation, valued at
their Fair Market Value on the date of delivery, but in no event greater than the amount of the Company's minimum statutory withholding rates for federal, state, local and foreign tax purposes and for payroll taxes that are applicable to supplemental taxable income. The Company and its Affiliates may, to the extent permitted by law, deduct any such tax obligations from any payment of any kind otherwise due to the Participant.
(h) Foreign Nationals. Awards may be made to Participants who are foreign nationals or employed outside the United States on such terms and conditions different from those specified in the Plan as the Committee considers necessary or advisable to achieve the purposes of the Plan or to comply with applicable laws.
(i) Amendment of Award. The Committee may amend, modify or terminate any outstanding Award, including substituting therefor another Award of the same or a different type, changing the date of exercise or realization and converting an Incentive Stock Option to a Nonstatutory Stock Option, provided that the Participant's consent to such action shall be required if the action, taking into account any related action, would adversely affect the Participant.
(j) Qualified Domestic Relations Orders.
(1) Anything in the Plan to the contrary notwithstanding, rights under Awards may be assigned to an Alternate Payee to the extent that a QDRO so provides. (The terms "Alternate Payee" and "QDRO" are defined in paragraph 12(c) below.) The assignment of an Award to an Alternate Payee pursuant to a QDRO shall not be treated as having caused a new grant. If an Award is assigned to an Alternate payee, the Alternate Payee generally has the same rights as the grantee under the terms of the Plan; provided however, that (i) the Award shall be subject to the same vesting terms and exercise period as if the Award were still held by the grantee, and (ii) an Alternate Payee may not transfer an Award.
(2) In the event of the Plan administrator's receipt of a domestic relations order or other notice of adverse claim by an Alternate Payee of a grantee of an Award, transfer of the proceeds of the exercise of such Award, whether in the form of cash, stock or other property, may be suspended. Such proceeds shall thereafter be transferred pursuant to the terms of a QDRO or other agreement between the grantee and Alternate Payee. A grantee's ability to exercise an Award may be barred if the Plan administrator received a court order directing the Plan administrator not to permit exercise.
(3) The word "QDRO" as used in the Plan shall mean a court order (i) that creates or recognizes the right of the spouse, former spouse or child (an "Alternate Payee") of an individual who is granted an Award to an interest in such Award relating to marital property rights or support obligations and (ii) that the administrator of the Plan determines would be a "qualified domestic relations order," as that term is defined in section 414(p) of the Code and section 206(d) of the Employee Retirement Income Security Act ("ERISA"), but for the fact that the Plan is not a plan described in section 3(3) of ERISA.
8. Certain Definitions
"Award" means any Option or Restricted Stock granted under the Plan. ----- "Board" means the Board of Directors of the Company. ----- "Code" means the Internal Revenue Code of 1986, as amended from time to ---- |
time, or any successor law.
9. Miscellaneous
(a) No Right To Employment. Nothing in the Plan or any instrument executed or Award granted pursuant thereto shall confer upon any eligible employee, consultant, optionee or holder of Awards under the Plan any right to continue in the employ of the Company or any Affiliate or to continue acting as a consultant or shall affect the right of the Company or any Affiliate to terminate the employment or consulting relationship of any eligible employee, consultant, optionee or holder of Awards under the Plan with or without cause, at any time and with or without notice. In the event that a holder of Awards under the Plan is permitted or otherwise entitled to take a leave of absence, the Company shall have the unilateral right to (i) determine whether such leave of absence will be treated as a termination of employment or relationship as consultant for purposes hereof, and (ii) suspend or otherwise delay the time or
times at which exercisability or vesting would otherwise occur with respect to any outstanding Awards under the Plan.
(b) No Rights As Stockholder. Subject to the provisions of the applicable Award, no Participant or Designated Beneficiary shall have any rights as a stockholder with respect to any shares of Common Stock to be distributed under the Plan until he or she becomes the holder thereof. A Participant to whom Common Stock is awarded shall be considered the holder of the Stock at the time of the Award except as otherwise provided in the applicable Award.
(c) Effective Date. The original Plan was approved by the stockholders of the Company and was effective as of February 7, 1997. The Amended and Restated Plan shall be effective immediately prior to the Closing of the Merger.
(d) Amendment of Plan. The Board may amend, suspend or terminate the Plan or any portion thereof at any time, subject to such stockholder approval as the Board determines to be necessary or advisable to comply with any tax or regulatory requirement.
(e) Governing Law. The provisions of the Plan shall be governed by and interpreted in accordance with the laws of Delaware.
THIS AMENDMENT NO. 6 ("Amendment No. 6") TO THAT CERTAIN SHAREHOLDERS' AGREEMENT, OF KIRIN-AMGEN, INC., dated May 11, 1984, as previously amended ("Shareholders' Agreement"), is made and entered into this 1st day of June, 1987, by and among KIRIN BREWERY, CO., LTD., a Japanese corporation ("Kirin"), AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
R E C I T A L S
A. Kirin and Amgen have previously entered into certain agreements and understandings ("Prior Agreements") regarding G-CSF (having been previously sometimes referred to as "PPO") and hereby acknowledge and reconfirm that on and after July 1, 1986, Corporation had the obligation to fund all development costs of the G-CSF Technology.
B. Kirin and Amgen have assigned and transferred to Corporation all of their right, title and interest in and to the G-CSF (PPO) technology effective as of and pursuant to certain transfer agreements dated July 1, 1986.
C. The parties have made certain business agreements regarding the further development of G-CSF (PPO) and wish to formalize said agreements.
NOW, THEREFORE, it is agreed as follows:
1. The research and development performed by Amgen on behalf of Corporation with respect to G-CSF (PPO) pursuant to the Prior Agreements, shall, from the effective date of that certain Development Agreement between Amgen and Amgen Clinical Partners, L.P., dated June 1, 1987, be conducted in connection with uses of G-CSF other than in the Field of Activity as defined in the Glossary attached thereto. Subject to Amgen's rights under that certain G-CSF European License Agreement dated December 30, 1986, and Kirin's rights under that certain G-CSF Japanese License Agreement dated June 1, 1987, Corporation shall have all rights with respect to such research and development outside of such Field of Activity (as defined in the Glossary attached to the Development Agreement).
2. Except to the extent as provided herein, the provisions of the Shareholders' Agreement, as amended, are hereby ratified and confirmed in all respects:
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 6 to be executed as of the first day written above.
KIRIN BREWERY CO., LTD., a
Japanese corporation
By /s/ Y. Yamamoto Yashushi Yamamoto, Senior Managing Director |
"Kirin"
AMGEN INC., a Delaware corporation
By /s/ George B. Rathmann
George B. Rathmann, President
"Amgen"
|
KIRIN-AMGEN, INC., a California corporation
By /s/ Y. Yamamoto
Yashushi Yamamoto, Chairman
"Corporation"
|
AMENDMENT NO. 7
To
THIS AMENDMENT NO. 7 ("Amendment No. 7") TO THAT CERTAIN SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN, INC., dated May 11, 1984, as previously amended ("Shareholders' Agreement"), is made and entered into this 17th day of July, 1987, and is made effective as of April 1, 1987, by and among KIRIN BREWERY, CO., LTD., a Japanese corporation ("Kirin"), AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").
R E C I T A L
The parties desire to memorialize their intent to make changes to certain agreements and understandings previously entered into regarding the payment of EPO and G-CSF clinical and non-clinical expenses.
From and after April 1, 1987, Kirin and Amgen (and not Corporation) shall each pay one-half (1/2) of the total clinical expenses incurred for EPO and G-CSF for Japan and the United States.
2. NON-CLINICAL EXPENSES
Corporation has requested that Kirin arrange and guarantee a credit facility with Mitsubishi Bank, Ltd. to pay for non-clinical expenses incurred by Corporation for EPO and G-CSF. Corporation is hereby authorized and directed to take such steps as are reasonable and necessary to assist in arranging the credit facility, including but not limited to, the issuance of the letter to Kirin attached hereto as Exhibit "A" requesting it to arrange the credit facility for Corporation and to guarantee the same. Corporation shall also present to the Board of Directors the credit facility loan documentation for formal approval.
3. Except to the extent as provided herein, the provisions of the Shareholders' Agreement, as amended, are hereby ratified and confirmed in all respects.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 7 to be executed as of the first day written above.
KIRIN BREWERY CO., LTD., a Japanese corporation
By /s/ Y. Yamamoto Yashushi Yamamoto Senior Managing Director |
"Kirin"
AMGEN INC.,
a Delaware corporation
By /s/ George B. Rathman
George B. Rathmann, President
"Amgen"
|
KIRIN-AMGEN, INC., a
California corporation
By /s/ Y. Yamamoto
Yashushi Yamamoto, Chairman
"Corporation"
|
AMENDMENT NO. 8
TO
SHAREHOLDERS' AGREEMENT
OF
KIRIN-AMGEN, INC.
THIS AMENDMENT NO. 8 TO SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN, INC., a Delaware corporation ("K-A") ("Amendment No. 8"), dated May 28, 1993, and made effective as of November 13, 1990, is made and entered into by and among KIRIN BREWERY, CO., LTD., a Japanese corporation ("Kirin"), AMGEN INC., a Delaware corporation ("Amgen"), and K-A.
A. The parties hereto are parties to that certain Shareholders' Agreement of K-A dated May 11, 1984, as amended ("Shareholders' Agreement").
B. The parties hereto have entered into various agreements with each other and third parties with respect to the glycoprotein molecule consisting of the amino acid sequence of granulocyte-colony stimulating factor or "G-CSF," as such agreements are more particularly described below.
C. The parties have benefitted from their relationship with respect to G-CSF and desire to adopt this Amendment No. 8 to clarify their agreements and understandings with respect to G-CSF and the payment of royalties on the commercial sale of G-CSF products ("G-CSF Products") throughout the world.
D. Pursuant to that certain Agreement by and between Sloan-Kettering Institute for Cancer Research ("SKI") and Amgen dated February 12, 1986, as amended ("SKI Agreement"), K-A is defined as an affiliate of Amgen thereunder.
NOW, THEREFORE, in consideration of the mutual covenants set forth herein and for other good and valuable consideration, the receipt of which is hereby acknowledged, the parties hereby agree as follows:
(1) Pursuant to that certain G-CSF United States License Agreement dated June 1, 1987, by and between K-A and Amgen, as amended ("G-CSF United States License Agreement"), Amgen is obligated to pay to K-A royalties on the Sales Value (as defined therein) of G-CSF Products in the United States equal to between zero percent (0%) and five percent (5%).
(2) Pursuant to that certain Agreement dated February 12, 1986, by and between Sloan-Kettering Institute for Cancer Research, a not-for-profit corporation of the State of New York ("SKI"), and Amgen, as amended ("SKI Agreement"), as further amended by that certain Amendment No. 2 to the SKI Agreement dated November 13, 1990, by and between SKI and Amgen (together with the SKI Agreement, collectively, "Amended SKI Agreement"), Amgen is obligated to pay to SKI royalties on the Net Sales (as defined therein) of G-CSF Products in the United States each year equal to three percent (3%) of such Net Sales in excess of three hundred and fifty million dollars ($350,000,000) (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays royalties with respect to the sale of such G-CSF Products in such territory to a third party or parties based upon the patent rights of such third party or parties.
(3) Pursuant to the G-CSF United States License Agreement, (a) K-A is obligated to bear responsibility for royalties payable by Amgen to SKI pursuant to the Amended SKI Agreement for sales of G-CSF Products in the United States, up to five percent (5%), and (b) Amgen is obligated to bear responsibility for all such royalties in excess of five percent (5%).
(4) In addition to the royalties described above, the Amended SKI Agreement requires Amgen to pay to SKI two milestone payments of ten million dollars ($10,000,000) and fifteen million dollars ($15,000,000), respectively, upon the occurrence of the events described in the Amended SKI Agreement, subject to the terms set forth therein.
(1) Pursuant to the G-CSF Japanese License Agreement dated June 1, 1987, by and between K-A and Kirin, as amended (the "G-CSF Japanese License Agreement"), Kirin is obligated to pay to K-A royalties on the Sales Value (as defined therein) of G-CSF Products in Japan equal to between zero percent (0%) and five percent (5%).
(2) Pursuant to the Amended SKI Agreement, Amgen is obligated to pay to SKI royalties equal to five percent (5%) of Net Sales (as defined therein) of G-CSF Products in Japan (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays to a third party or parties based upon the patent rights of such third party or parties).
(3) Pursuant to the G-CSF Japanese License Agreement, K-A is obligated to bear responsibility for all royalties payable by Amgen to SKI pursuant to the Amended SKI Agreement on sales of G-CSF Products in Japan.
To the extent that K-A realizes a tax benefit from the use of any withholding tax originating from the royalty payments made by Kirin to K-A, after first using all tax withholdings that originated from K-A's business operations, K-A shall pay to SKI the amount of any such benefit realized. Kirin shall provide to K-A, on a timely basis, copies of tax receipts issued by the government of Japan relating to the required payments.
(1) Pursuant to that certain G-CSF European License Agreement dated December 30, 1986, by and between K-A and Amgen, as amended ("G- CSF European License Agreement"), Amgen is obligated to pay to K-A royalties on the Sales Value (as defined
therein) of G-CSF Products in Europe (including European Community and non- European Community countries) equal to ten percent (10%). Pursuant to the G-CSF European License Agreement, Amgen also is required to pay to K-A certain milestone payments as set forth therein, upon the occurrence of the events described in the G-CSF European License Agreement and subject to the terms set forth therein.
(2) Pursuant to the Amended SKI Agreement, Amgen is
obligated to pay to SKI royalties equal to five percent (5%) of Net Sales (as
defined therein) of G-CSF Products in Europe (which royalties shall be reduced
as provided in the Amended SKI Agreement in the event that Amgen pays royalties
on sales of such G-CSF Products in such territory to a third party or parties
based upon the patent rights of such third party or parties). The parties
hereby acknowledge that such royalties currently paid by Amgen with respect to
sales of G-CSF Products in Europe include (a) royalties to the Board of Trustees
of Leland Stanford Junior University equal to one-half of one percent (.5%) of
net sales of G-CSF Products, and (b) royalties paid to Nycomed Pharma AS equal
to between one and one-half percent (1.5%) and five-hundredths of one percent
(.05), with the applicable percentage to depend on the worldwide net sales of G-
CSF Products in a given royalty period. The parties acknowledge and agree that
Amgen may be obligated to pay such additional royalties in the future.
(3) Pursuant to the G-CSF European License Agreement, K-A and Amgen each are obligated to bear the responsibility for one-half (1/2) of all royalties payable by Amgen to SKI pursuant to the Amended SKI Agreement on sales of G-CSF Products in Europe.
(4) Pursuant to that certain Agreement on G-CSF in the EC dated September 26, 1988, by and between Amgen and F. Hoffman LaRoche & Co., Limited Company, a Switzerland corporation ("Roche"), as amended ("Roche EC Agreement"), Amgen and Roche have agreed to share on a 60/40 basis (with the higher proportion to Amgen) the Operating Profit or Operating Loss (each as defined in the Roche EC Agreement), as the case may be, relating to the sale of G-CSF Products in the countries comprisingthe European Community, subject to the terms set forth therein. Pursuant to the Roche EC Agreement, Roche also is obligated to pay to Amgen certain milestone payments, as set forth therein, upon the occurrence of the events set forth in the Roche EC Agreement and subject to the terms set forth therein.
(5) Pursuant to that certain Agreement on G-CSF on Certain European Countries dated January 1, 1989, by and between Amgen and Roche ("Roche Non-EC Agreement"), Roche is obligated to pay to Amgen royalties on Net Sales (as defined therein) of G-CSF Products in certain European countries, other than the countries comprising the European Community, equal to twenty five percent (25%) of Net Sales (as defined therein) of G-CSF Products in each country where relevant patents exist until
August 22, 2006 (subject to reduction to sixteen percent (16%) of such Net Sales of G-CSF Products in applicable countries in the event of significant unlicensed competition by third parties in such countries, as described in the Roche Non-EC Agreement), and sixteen percent (16%) of such Net Sales of G-CSF Products in each country where such patents have expired, or where no patent otherwise exists, until August 22, 2006.
(1) Pursuant to that certain G-CSF Australia, Canada and New Zealand License Agreement dated October 20, 1988, by and between K-A and Amgen, as amended ("G-CSF Australian License Agreement"), Amgen is obligated to pay to K-A royalties on the Sales Value (as defined therein) of G-CSF Products in Australia, Canada and New Zealand equal to ten percent (10%).
(2) Pursuant to the Amended SKI Agreement, Amgen is obligated to pay to SKI royalties equal to five percent (5%) of Net Sales (as defined therein) of G-CSF Products in Australia, Canada and New Zealand (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays royalties on sales of such G-CSF Products in such territory to a third party or parties based upon the patent rights of such third party or parties).
(3) Pursuant to the G-CSF Australian License Agreement, K-A is obligated to bear responsibility for all royalties payable by Amgen to SKI pursuant to the Amended SKI Agreement on sales of G-CSF Products in Australia, Canada and New Zealand.
its obligations under the G-CSF Australian License Agreement with respect to royalties payable by Amgen to K-A on sales of G-CSF Products in Australia, Canada and New Zealand, and K-A shall have satisfied its obligations under the G CSF Australian License Agreement with respect to the royalties payable by K-A to SKI on sales of G-CSF Products in Australia, Canada and New Zealand, if (i) Amgen shall pay to K-A the royalties payable to K-A under the G-CSF Australian License Agreement, reduced by the royalties payable by K-A to SKI pursuant to the G-CSF Australian License Agreement, and (ii) Amgen shall further pay to SKI all of the royalties payable by Amgen to SKI under the Amended SKI Agreement on sales of G-CSF Products in Australia, Canada and New Zealand.
(1) Pursuant to that certain G-CSF Republic of China and Republic of Korea License Agreement dated October 20, 1988, by and between K A and Kirin, as amended ("G-CSF ROC/ROK License Agreement"), Kirin is obligated to pay to K-A royalties on the Sales Value (as defined therein) of G-CSF Products in the Republic of China (Taiwan) and the Republic of Korea equal to ten percent (10%).
(2) Pursuant to the Amended SKI Agreement, Amgen is obligated to pay to SKI royalties equal to five percent (5%) of Net Sales (as defined therein) of G-CSF Products in the Republic of China and the Republic of Korea (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays any royalties on sales of such G-CSF Products in such territory to a third party or parties based upon the patent rights of such third party or parties).
(3) Pursuant to the G-CSF ROC/ROK License Agreement, K-A is obligated to bear responsibility for all royalties payable by Amgen to SKI pursuant to the Amended SKI Agreement on sales of G-CSF Products in the Republic of China and the Republic of Korea.
To the extent that K-A realizes a tax benefit from the use of any withholding tax originating from the royalty payments made by Kirin to K-A, after first using all tax withholdings that
originated from K-A's business operations, K-A shall pay to SKI the amount of any such benefit realized. Kirin shall provide to K-A, on a timely basis, copies of tax receipts issued by the government of Japan, Republic of China or Republic of Korea relating to the required payments.
(1) Pursuant to that certain License Agreement for the People's Republic of China dated May 29, 1992, by and among K-A, Kirin and Amgen ("PRC License Agreement"), each of Kirin and Amgen is obligated to pay to K-A royalties on Net Sales (as defined therein) of G-CSF Products by each such party in the People's Republic of China equal to five percent (5%).
(2) Pursuant to the Amended SKI Agreement, Amgen is obligated to pay to SKI royalties equal to five percent (5%) of Net Sales (as defined therein) of G-CSF Products in the People's Republic of China (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays to third party or parties based upon the patent rights of such third party or parties royalties on sales of such G-CSF Products in such territory).
(3) Pursuant to the PRC License Agreement, each of Kirin and Amgen is obligated to bear responsibility for all third party royalties (as described in Section 3.4 of the PRC License Agreement) payable by such party on sales in the People's Republic of China.
(1) Pursuant to that certain G-CSF Rest of the World License Agreement dated January 1, 1989 ("ROW Agreement"), by and between K-A and Roche, Roche shall pay royalties to K-A equal to twenty-five percent (25%) of Net Sales (as defined therein) of G-CSF Products in each country where relevant patents exist until August 22, 2006 (subject to reduction to sixteen percent (16%) of such Net Sales of G-CSF Products in applicable countries in the event of significant unlicensed competition by third parties in such countries, as described in the ROW Agreement), and sixteen percent (16%) of such Net Sales of G-CSF Products in each country where such patents have expired, or where no patent otherwise exists, until August 22, 2006.
(2) Pursuant to that certain Supply Agreement between Amgen and K-A, dated January 1, 1989 ("Supply Agreement"), (a) Amgen has agreed to supply K-A with Roche's requirements of G-CSF Products pursuant to the ROW Agreement, and (b) K-A has agreed to pay to Amgen two (2) times Amgen's cost of G-CSF Products supplied by Amgen to K-A pursuant to the Supply Agreement (manufactured at standard cost), as determined by Amgen (collectively, the "K-A Product Payments").
(3) Pursuant to the Amended SKI Agreement, Amgen is obligated to pay to SKI royalties equal to five percent (5%) of net sales of G-CSF Products in the world other than the United States (which royalties may be reduced as provided in the Amended SKI Agreement in the event that Amgen pays any royalties on sales of such G-CSF Products in such territory to a third party or parties based upon the patent rights of such third party or parties).
Each party hereto agrees to perform any and all further acts and to execute and deliver any and all further documents and instruments which may be reasonable or necessary to carry out the purposes of this Amendment and the Shareholder Agreement, as amended.
Except to the extent provided herein, the provisions of the Shareholders' Agreement and the License Agreements, as amended through the date hereof, are hereby ratified and confirmed in all respects. Without limiting the foregoing, the Shareholder's Agreement (as amended through the date hereof and including this Amendment), together with the License Agreements (as amended through the date hereof, including the amendments effected by this Amendment), constitutes the entire agreement among the parties hereto with respect to the subject matter hereof, and supersedes all other agreements, whether oral or written, express or implied, with respect to the subject matter hereof. This Amendment may not be amended or modified except by a written instrument signed by the parties hereto.
This Amendment shall be construed under and in accordance with, and governed in all respects by, the laws of the State of California (without giving effect to principles of conflicts of law). If any provision of this Amendment is deemed invalid or unenforceable by a court of competent jurisdiction, such invalidity or enforceability shall not affect or limit the validity or enforceability of any other provision hereof.
This Amendment may be executed in two or more counterparts, each of which shall be deemed an original and all of which together shall constitute one instrument.
IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 8 to be duly executed as of May 28, 1993.
KIRIN BREWERY CO., LTD., a Japanese corporation
By /s/ T. Sasahara
---------------
Toru Sasahara,
President, Pharmaceuticals
Division
|
AMGEN INC.,
a Delaware corporation
By /s/ Lowell E. Sears
-------------------
Lowell E. Sears, Sr. Vice
President
|
KIRIN-AMGEN, INC.,
a Delaware corporation
By /s/ Lowell E. Sears
-------------------
Lowell E. Sears, President
|
AMENDMENT NO. 9
TO SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN
AMENDMENT NO. 9 (this "Amendment") dated December 9,1994 and made effective as of June 14,1994 to the Shareholders' Agreement of Kirin-Amgen dated May 11,1984 (as amended, the "Shareholders' Agreement") among Kirin Brewery Co., Ltd., a Japanese corporation with principal offices located at 26-1, Jingumae, 6-chome, Shibuya-ku, Tokyo, 150-11, Japan ("Kirin"), Amgen Inc., a Delaware corporation with principal offices located at Amgen Center, Thousand Oaks, California 91320 ("Amgen") and Kirin-Amgen, Inc., a Delaware corporation with principal offices located at c/o Amgen Europe AG, Grabenhof, 6010 Kirens, Switzerland ("Kirin-Amgen").
WHEREAS
WHEREAS, Kirin and Amgen mutually agree that their relationship with respect to EPO and G-CSF has been beneficial to both companies.
WHEREAS, Kirin and Amgen have each performed extensive research and development and filed patent applications on a growth factor with the activity of thrombopoietin/megakaryocyte growth and differentiation factor ("TPO/MGDF," as further defined in the TPO/MGDF Technology Transfer Agreement effective as of June 14,1994 among Kirin, Amgen and Kirin-Amgen, the "Technology Agreement").
WHEREAS, Kirin and Amgen now wish to expand their relationship to include the joint development of TPO/MGDF and commercialization of TPO/MGDF Products.
WHEREAS, this Amendment No. 9 sets forth certain agreements between the parties with respect to TPO/MGDF and the manufacture, production and worldwide commercial sale of TPO/MGDF products.
NOW THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties agree as follows:
party in connection with the Research and Development Project ("Research Project Technology").
and/or Kirin Core Technology in the Kirin-Amgen Territory shall be the simultaneous worldwide utilization of the TPO/MGDF Technology.
(a) U.S. Amgen and Kirin will each file and prosecute the patent applications and applications for trademark and copyright registration relating to intellectual property owned or developed by such party and included within the TPO/MGDF Technology in the United States and maintain the resultant patents, trademarks and copyrights. Amgen shall bear the costs and expenses of both Kirin and Amgen associated therewith.
Technology in the Amgen Territory. The associated costs and expenses will be borne by (i) Amgen with respect to TPO/MGDF Technology in the Amgen Core Territory and (ii) Kirin-Amgen with respect to TPO/MGDF Technology in the Amgen Additional Territory.
Products in the Amgen Territory. Amgen shall bear all costs and expenses associated therewith.
IN WITNESS WHEREOF, the undersigned have caused this Amendment to be executed by their duly authorized representatives in the manner legally binding upon them.
Kirin Brewery Co., Ltd.
By: /s/ T. Sasahara, Ph.D.
Title: Senior Managing Director
President of Pharmaceutical Div.
|
Amgen, Inc.
By: /s/ Title: |
Kirin-Amgen, Inc.
By: /s/ Daryl Hill Title: |
IN WITNESS WHEREOF, the undersigned have caused this Amendment to be executed by their duly authorized representatives in the manner legally binding upon them.
Kirin Brewery Co., Ltd.
By:
Title:
Amgen, Inc.
By: /s/ K. Sharer Title: |
Kirin-Amgen, Inc.
By: /s/ Title: |
AMEGEN INC.
Exhibit 21
SUBSIDIARY STATE OF
INCORPORATION
(Name under which OR
subsidiary does business) ORGANIZATION
Amgen AB Sweden
Amgen AG Switzerland
Amgen Australia Pty Limited Australia
Amgen (Bermuda) Clinical Development,
Limited Bermuda
Amgen (Bermuda) Clinical Development 2,
Limited Bermuda
Amgen (Bermuda) Clinical Development 3,
Limited Bermuda
Amgen (Bermuda) Clinical Development 4,
Limited Bermuda
Amgen (Bermuda) Clinical Development 5,
Limited Bermuda
Amgen (Bermuda) Clinical Development 6,
Limited Bermuda
Amgen (Bermuda) Clinical Development 7,
Limited Bermuda
Amgen (Bermuda) Clinical Development 8,
Limited Bermuda
Amgen (Bermuda), Limited Bermuda
Amgen (Bermuda) Manufacturing, Limited Bermuda
Amgen - Bio-Farmaceutica, Lda. Portugal
Amgen Boulder Development
Corporation Colorado
Amgen Boulder Production
Corporation Colorado
Amgen B.V. The Netherlands
Amgen Cambridge Real Estate
Holdings Inc. Delaware
|
AMEGEN INC.
Exhibit 21
SUBSIDIARY STATE OF
INCORPORATION
(Name under which OR
subsidiary does business) ORGANIZATION
Amgen Canada Inc. Canada
Amgen Caribe Corporation Puerto Rico
Amgen (Europe) AG Switzerland
Amgen Europe B.V. The Netherlands
Amgen GmbH Austria
Amgen GmbH Germany
Amgen Greater China, Ltd. Hong Kong
Amgen Holding, Inc. California
Amgen International Inc. Delaware
Amgen Kabushiki Kaisha Japan
Amgen Limited United Kingdom
Amgen N.V. Belgium
Amgen Puerto Rico, Inc. Delaware
Amgen Rheumatology Development Corp. Delaware
Amgen Sales Corporation Barbados
Amgen S.A. France
Amgen, S.A. Spain
Amgen S.p.A. Italy
Kirin-Amgen, Inc. Delaware
Synergen B.V. The Netherlands
Synergen Europe, Inc. Colorado
|