EXHIBIT 10.1
AMGEN INC.

(a) The purpose of the Amended and Restated 1991 Equity Incentive Plan as amended and restated in February 1999 (the "Plan") is to provide a means by which employees or directors of and consultants to Amgen Inc., a Delaware corporation (the "Company"), and its Affiliates, as defined in paragraph 1(b), directly, or indirectly through Trusts, may be given an opportunity to benefit from increases in value of the stock of the Company through the granting of (i) incentive stock options, (ii) nonqualified stock options, (iii) stock bonuses, and (iv) rights to purchase restricted stock, all as defined below. For purposes of the incentive stock option rules of Section 422 of the Internal Revenue Code of 1986, as amended (the "Code"), the Plan is a new plan.

(b) The word "Affiliate" as used in the Plan means any parent corporation or subsidiary corporation of the Company, as those terms are defined in Sections 424(e) and (f), respectively, of the Code.

(c) The Company, by means of the Plan, seeks to retain the services of persons now employed by or serving as directors or consultants to the Company, to secure and retain the services of persons capable of filling such positions, and to provide incentives for such persons to exert maximum efforts for the success of the Company.

(d) The Company intends that the rights issued under the Plan ("Stock Awards") shall, in the discretion of the Board of Directors of the Company (the "Board") or any committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), be either (i) stock options granted pursuant to Sections 5 or 6 hereof, including incentive stock options as that term is used in Section 422 of the Code ("Incentive Stock Options"), or options which do not qualify as Incentive Stock Options ("Nonqualified Stock Options") (together hereinafter referred to as "Options"), or (ii) stock bonuses or rights to purchase restricted stock granted pursuant to Section 7 hereof.

(e) The word "Trust" as used in the Plan shall mean a trust created for the benefit of the employee, director or consultant, his or her spouse, or members of their immediate family. The word optionee shall mean the person to whom the option is granted or the employee, director or consultant for whose benefit the option is granted to a Trust, as the context shall require.

(a) The Plan shall be administered by the Board unless and until the Board delegates administration to a committee, as provided in paragraph 2(c).

(b) The Board shall have the power, subject to, and within the limitations of, the express provisions of the Plan:

(1) To determine from time to time which of the persons eligible under the Plan shall be granted Stock Awards; when and how Stock Awards shall be granted; whether a Stock Award will be an Incentive Stock Option, a Nonqualified Stock Option, a stock bonus, a right to purchase restricted stock, or a combination of the foregoing; the provisions of each Stock Award granted (which need not be identical), including the time or times when a person shall be permitted to purchase or receive stock pursuant to a Stock Award; and the number of shares with respect to which Stock Awards shall be granted to each such person.

(2) To construe and interpret the Plan and Stock Awards granted under it, and to establish, amend and revoke rules and regulations for its administration. The Board, in the exercise of this power, may correct any defect, omission or inconsistency in the Plan or in any Stock Award, in a manner and to the extent it shall deem necessary or expedient to make the Plan fully effective.

(3) To amend the Plan as provided in Section 14.

(4) Generally, to exercise such powers and to perform such acts as the Board deems necessary or expedient to promote the best interests of the Company.

(c) The Board may delegate administration of the Plan to a committee composed of not fewer than two (2) members of the Board (the "Committee"). One or more of these members may be non-employee directors and outside directors, if required and as defined by the provisions of paragraphs 2(d) and 2(e). If administration is delegated to a Committee, the Committee shall have, in connection with the administration of the Plan, the powers theretofore possessed by the Board (except amendment of Section 6 or the options granted thereunder shall only be by action taken by the Board or a committee of one or more members of the Board to which such authority has been specifically delegated by the Board), subject, however, to such resolutions, not inconsistent with the provisions of the Plan, as may be adopted from time to time by the Board. Notwithstanding anything else in this paragraph 2(c) to the contrary, at any time the Board or the Committee may delegate to a committee of one or more members of the Board the authority to grant or amend options to all employees, directors or consultants or any portion or class thereof.

(d) The term "non-employee director" shall mean a member of the Board who (i) is not currently an officer of the Company or a parent or subsidiary of the Company (as defined in Rule 16a-1(f) promulgated by the Securities and Exchange Commission under

Section 16 of the Securities Exchange Act of 1934, as amended (the "Exchange Act")) or an employee of the Company or a parent or subsidiary of the Company;
(ii) does not receive compensation from the Company or a parent or subsidiary of the Company for services rendered in any capacity other than as a member of the Board (including a consultant) in an amount required to be disclosed to the Company's stockholders under Rule 404 of Regulation S-K promulgated by the Securities and Exchange Commission ("Rule 404"); (iii) does not possess an interest in any other transaction required to be disclosed under Rule 404; or
(iv) is not engaged in a business relationship required to be disclosed under Rule 404, as all of these provisions are interpreted by the Securities and Exchange Commission under Rule 16b-3 promulgated under the Exchange Act.

(e) The term "outside director," as used in this Plan, shall mean an administrator of the Plan, whether a member of the Board or of any Committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), who is considered to be an "outside director" in accordance with the rules, regulations or interpretations of Section 162(m) of the Code.

(f) Any requirement that an administrator of the Plan be a "non- employee director" or "outside director" shall not apply if the Board or the Committee expressly declares that such requirement shall not apply.

(a) Subject to the provisions of Section 11 relating to adjustments upon changes in stock, the stock that may be issued pursuant to Stock Awards granted under the Plan shall not exceed in the aggregate One Hundred Ninety-Two Million (192,000,000) shares of the Company's $.0001 par value common stock (the "Common Stock"). If any Stock Award granted under the Plan shall for any reason expire or otherwise terminate without having been exercised in full, the Common Stock not purchased under such Stock Award shall again become available for the Plan. Shares repurchased by the Company pursuant to any repurchase rights reserved by the Company pursuant to the Plan shall not be available for subsequent issuance under the Plan.

(b) The Common Stock subject to the Plan may be unissued shares or reacquired shares, bought on the market or otherwise.

(c) An Incentive Stock Option may be granted to an eligible person under the Plan only if the aggregate fair market value (determined at the time the Incentive Stock Option is granted) of the Common Stock with respect to which incentive stock options (as defined by the Code) are exercisable for the first time by such optionee during any calendar year under all such plans of the Company and its Affiliates does not exceed one hundred thousand dollars

($100,000). If it is determined that an entire Option or any portion thereof does not qualify for treatment as an Incentive Stock Option by reason of exceeding such maximum, such Option or the applicable portion shall be considered a Nonqualified Stock Option.

(a) Incentive Stock Options may be granted only to employees (including officers) of the Company or its Affiliates. A director of the Company shall not be eligible to receive Incentive Stock Options unless such director is also an employee of the Company or any Affiliate. Stock Awards other than Incentive Stock Options may be granted to employees (including officers) or directors of or consultants to the Company or any Affiliate or to Trusts of any such employee, director or consultant.

(b) A director shall in no event be eligible for the benefits of the Plan (other than from a Director NQSO under Section 6 of the Plan) unless and until such director is expressly declared eligible to participate in the Plan by action of the Board or the Committee, and only if, at any time discretion is exercised by the Board or the Committee in the selection of a director as a person to whom Stock Awards may be granted, or in the determination of the number of shares which may be covered by Stock Awards granted to a director, the Plan complies with the requirements of Rule 16b-3 promulgated under the Exchange Act, as from time to time in effect. The Board shall otherwise comply with the requirements of Rule 16b-3 promulgated under the Exchange Act, as from time to time in effect. Notwithstanding the foregoing, the restrictions set forth in this paragraph 4(b) shall not apply if the Board or Committee expressly declares that such restrictions shall not apply.

(c) No person shall be eligible for the grant of an Incentive Stock Option under the Plan if, at the time of grant, such person owns (or is deemed to own pursuant to Section 424(d) of the Code) stock possessing more than ten percent (10%) of the total combined voting power of all classes of stock of the Company or of any of its Affiliates unless the exercise price of such Incentive Stock Option is at least one hundred and ten percent (110%) of the fair market value of the Common Stock at the date of grant and the Incentive Stock Option is not exercisable after the expiration of five (5) years from the date of grant.

(d) Stock Awards shall be limited to a maximum of 2,000,000 shares of Common Stock per person per calendar year.

An option granted pursuant to this Section 5 (a "Discretionary Stock Option") shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Options need not be identical,

but each Option shall include (through incorporation of provisions hereof by reference in the Option or otherwise) the substance of each of the following provisions:

(a) No Option shall be exercisable after the expiration of ten (10) years from the date it was granted.

(b) The exercise price of each Incentive Stock Option and each Nonqualified Stock Option shall be not less than one hundred percent (100%) of the fair market value of the Common Stock subject to the Option on the date the Option is granted.

(c) The purchase price of Common Stock acquired pursuant to an Option shall be paid, to the extent permitted by applicable statutes and regulations, either: (i) in cash at the time the Option is exercised; or (ii) at the discretion of the Board or the Committee, either at the time of grant or exercise of the Option (A) by delivery to the Company of shares of Common Stock that have been held for the period required to avoid a charge to the Company's reported earnings and valued at the fair market value on the date of exercise, (B) according to a deferred payment or other arrangement with the person to whom the Option is granted or to whom the Option is transferred pursuant to paragraph
5(d), or (C) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion; including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instruction to pay the aggregate exercise price to the Company from the sales proceeds before Common Stock is issued.

In the case of any deferred payment arrangement, interest shall be payable at least annually and shall be charged at not less than the minimum rate of interest necessary to avoid the treatment as interest, under any applicable provisions of the Code, of any amounts other than amounts stated to be interest under the deferred payment arrangement.

(d) An Option granted to a natural person shall be exercisable during the lifetime of such person only by such person, provided that such person during such person's lifetime may designate a Trust to be such person's beneficiary with respect to any Incentive Stock Options granted after February 25, 1992 and with respect to any Nonqualified Stock Options, and such beneficiary shall, after the death of the person to whom the Option was granted, have all the rights that such person has while living, including the right to exercise the Option. In the absence of such designation, after the death of the person to whom the Option is granted, the Option shall be exercisable by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution.

(e) The total number of shares of Common Stock subject to an Option may, but need not, be allotted in periodic installments (which may, but need not, be equal). From

time to time during each of such installment periods, the Option may become exercisable ("vest") with respect to some or all of the shares allotted to that period, and may be exercised with respect to some or all of the shares allotted to such period and/or any prior period as to which the Option was not fully exercised. During the remainder of the term of the Option (if its term extends beyond the end of the installment periods), the Option may be exercised from time to time with respect to any shares then remaining subject to the Option. The provisions of this paragraph 5(e) are subject to any Option provisions governing the minimum number of shares as to which an Option may be exercised.

(f) The Company may require any optionee, or any person to whom an Option is transferred under paragraph 5(d), as a condition of exercising any such Option: (i) to give written assurances satisfactory to the Company as to such person's knowledge and experience in financial and business matters and/or to employ a purchaser representative who has such knowledge and experience in financial and business matters, and that such person is capable of evaluating, alone or together with the purchaser representative, the merits and risks of exercising the Option; and (ii) to give written assurances satisfactory to the Company stating that such person is acquiring the Common Stock subject to the Option for such person's own account and not with any present intention of selling or otherwise distributing the Common Stock. These requirements, and any assurances given pursuant to such requirements, shall be inoperative if: (x) the issuance of the shares upon the exercise of the Option has been registered under a then currently effective registration statement under the Securities Act of 1933, as amended (the "Securities Act"); or (y) as to any particular requirement, a determination is made by counsel for the Company that such requirement need not be met in the circumstances under the then applicable securities law.

(g) An Option shall terminate three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate, unless: (i) such termination is due to the optionee's permanent and total disability, within the meaning of Section 422(c)(6) of the Code and with such permanent and total disability being certified by the Social Security Administration prior to such termination, in which case the Option may, but need not, provide that it may be exercised at any time within one (1) year following such termination of employment or relationship as a consultant or director; (ii) the optionee dies while in the employ of or while serving as a consultant or director to the Company or an Affiliate, or within not more than three (3) months after termination of such employment or relationship as a consultant or director, in which case the Option may, but need not, provide that it may be exercised at any time within eighteen (18) months following the death of the optionee by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution; or (iii) the Option by its term specifies

either (A) that it shall terminate sooner than three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate; or (B) that it may be exercised more than three (3) months after termination of the optionee's employment or relationship as a consultant or director with the Company or an Affiliate. This paragraph 5(g) shall not be construed to extend the term of any Option or to permit anyone to exercise the Option after expiration of its term, nor shall it be construed to increase the number of shares as to which any Option is exercisable from the amount exercisable on the date of termination of the optionee's employment or relationship as a consultant or director.

(h) The Option may, but need not, include a provision whereby the optionee may elect at any time during the term of the optionee's employment or relationship as a consultant or director with the Company or any Affiliate to exercise the Option as to any part or all of the shares subject to the Option prior to the stated vesting dates of the Option. Any shares so purchased from any unvested installment or Option may be subject to a repurchase right in favor of the Company or to any other restriction the Board or the Committee determines to be appropriate.

(i) To the extent provided by the terms of an Option, each optionee may satisfy any federal, state or local tax withholding obligation relating to the exercise of such Option by any of the following means or by a combination of such means: (i) tendering a cash payment; (ii) authorizing the Company to withhold from the shares of the Common Stock otherwise issuable to the optionee as a result of the exercise of the Option a number of shares having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding; or (iii) delivering to the Company owned and unencumbered shares of the Common Stock having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding.

(j) Without in any way limiting the authority of the Board or Committee to make or not to make grants of Discretionary Stock Options under this Section 5, the Board or Committee shall have the authority (but not an obligation) to include as part of any Option agreement a provision entitling the optionee to a further Option (a "Re-Load Option") in the event the optionee exercises the Option evidenced by the Option agreement, in whole or in part, by surrendering other shares of Common Stock in accordance with this Plan and the terms and conditions of the Option agreement. Any such Re-Load Option (i) shall be for a number of shares equal to the number of shares surrendered as part or all of the exercise price of such Option; (ii) shall have an expiration date which is the same as the expiration date of the Option the exercise of which gave rise to such Re-Load Option; and (iii) shall have an exercise price which is equal to one hundred percent (100%) of the fair market value of the Common Stock subject to the Re-Load Option on the date of exercise of the original Option or, in the case of a

Re-Load Option which is an Incentive Stock Option and which is granted to a 10% stockholder (as defined in paragraph 4(c)), shall have an exercise price which is equal to one hundred and ten percent (110%) of the fair market value of the Common Stock subject to the Re-Load Option on the date of exercise of the original Option.

Any such Re-Load Option may be an Incentive Stock Option or a Nonqualified Stock Option, as the Board or Committee may designate at the time of the grant of the original Option, provided, however, that the designation of any Re-Load Option as an Incentive Stock Option shall be subject to the one hundred thousand dollars ($100,000) annual limitation on exercisability of Incentive Stock Options described in paragraph 3(c) of the Plan and in Section 422(d) of the Code. There shall be no Re-Load Option on a Re-Load Option. Any such Re-Load Option shall be subject to the availability of sufficient shares under paragraph 3(a) and shall be subject to such other terms and conditions as the Board or Committee may determine.

(a) On January 27 of each year, each person who is at that time an Eligible Director of the Company, (as defined in paragraph 6(k)), shall automatically be granted under the Plan, without further action by the Company, the Board, or the Company's stockholders, a Nonqualified Stock Option (a "Director NQSO") to purchase sixteen thousand (16,000) shares of Common Stock on the terms and conditions set forth herein. An Eligible Director may designate that such Director NQSO be granted in the name of a Trust instead of in the name of such Eligible Director. The Director NQSO shall be on the terms and conditions set forth herein and should the date of grant set forth above be a Saturday, Sunday or legal holiday, such grant shall be made on the next business day.

(b) Each person who becomes an Eligible Director, shall, upon the date such person first becomes an Eligible Director, automatically be granted under the Plan, without further action by the Company, the Board, or the Company's stockholders, a Director NQSO to purchase sixty thousand (60,000) shares of Common Stock on the terms and conditions set forth herein. An Eligible Director may designate that such Director NQSO be granted in the name of a Trust instead of in the name of such Eligible Director. The Director NQSO shall be on the terms and conditions set forth herein and should the date of grant set forth above be a Saturday, Sunday or legal holiday, such grant shall be made on the next business day.

(c) Each Director NQSO granted pursuant to this Section 6 (or any Director Re-Load Option granted pursuant to paragraph 6(j)) shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Director NQSO's need not be identical, but each

Director NQSO shall include (through incorporation of provisions hereof by reference in the Director NQSO or otherwise) the substance of each of the following provisions as set forth in paragraphs 6(d) through 6(j), inclusive.

(d) The term of each Director NQSO shall be ten (10) years from the date it was granted.

(e) The exercise price of each Director NQSO shall be one hundred percent (100%) of the fair market value of the Common Stock subject to such Director NQSO on the date such Director NQSO is granted.

(f) The purchase price of Common Stock acquired pursuant to a Director NQSO shall be paid, to the extent permitted by applicable statutes and regulations, either (i) in cash at the time the Director NQSO is exercised; (ii) by delivery to the Company of shares of Common Stock that have been held for the period required to avoid a charge to the Company's reported earnings and valued at their fair market value on the date of exercise; or (iii) pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instructions to pay the aggregate exercise price to the Company from the sales proceeds before Common Stock is issued.

(g) A Director NQSO shall be exercisable during the lifetime of the Eligible Director with respect to whom it was granted only by the person to whom it was granted (whether the Eligible Director or a Trust), provided that such person during the Eligible Director's lifetime may designate a Trust to be a beneficiary with respect to the Director NQSO, and such beneficiary shall, after the death of the Eligible Director to whom the Director NQSO was granted, have all of the rights designated for such beneficiary. In the absence of such designation, after the death of the Eligible Director with respect to whom the Director NQSO was granted, if such Director NQSO was granted to the Eligible Director, the Director NQSO shall be exercisable by the person or persons to whom the optionee's rights under such option pass by will or by the laws of descent and distribution.

(h) A Director NQSO shall not vest with respect to an Eligible Director, or the affiliate of such Eligible Director, as the case may be, (i) unless the Eligible Director, has, at the date of grant, provided three (3) years of prior continuous service as an Eligible Director, or (ii) until the date upon which such Eligible Director has provided one year of continuous service as an Eligible Director following the date of grant of such Director NQSO, whereupon such Director NQSO shall become fully vested and exercisable in accordance with its terms.

(i) The Company may require any optionee under this Section 6, or any person to whom a Director NQSO is transferred under paragraph 6(g), as a condition of exercising any such option: (i) to give written assurances satisfactory to the Company as to

such person's knowledge and experience in financial and business matters and/or to employ a purchaser representative who has such knowledge and experience in financial and business matters, and that such person is capable of evaluating, alone or together with the purchaser representative, the merits and risks of exercising the Director NQSO; and (ii) to give written assurances satisfactory to the Company stating that such person is acquiring the Common Stock subject to the Director NQSO for such person's own account and not with any present intention of selling or otherwise distributing the stock. These requirements, and any assurances given pursuant to such requirements, shall be inoperative if
(i) the issuance of the shares upon the exercise of the Director NQSO has been registered under a then currently effective registration statement under the Securities Act of 1933, as amended (the "Securities Act"), or (ii), as to any particular requirement, a determination is made by counsel for the Company that such requirement need not be met in the circumstances under the then applicable securities laws.

(j) Subject to the last sentence of this paragraph 6(j), each Director NQSO shall include a provision entitling the optionee to a further Nonqualified Stock Option (a "Director Re-Load Option") in the event the optionee exercises the Director NQSO evidenced by the Director NQSO grant, in whole or in part, by surrendering other shares of Common Stock in accordance with the Plan and the terms of the Director NQSO grant. Any such Director Re-Load Option (i) shall be for a number of shares equal to the number of shares surrendered as part or all of the exercise price of the original Director NQSO; (ii) shall have an expiration date which is the same as the expiration date of the original Director NQSO; and (iii) shall have an exercise price which is equal to one hundred percent (100%) of the fair market value of the Common Stock subject to the Director Re-Load Option on the date of exercise of the original Director NQSO. Any such Director Re-Load Option shall be subject to the availability of sufficient shares under paragraph 3(a). There shall be no Director Re-Load Option on a Director Re-Load Option. Notwithstanding anything else in the Plan to the contrary, this paragraph 6(j) shall be of no force and effect from and after June 23, 1998.

(k) For purposes of this Section 6, the term "Eligible Director" shall mean a member of the Board who is not an employee of the Company or any Affiliate, and the term "affiliate" shall mean a person that directly or indirectly controls, is controlled by, or is under common control with, the Eligible Director.

Each stock bonus or restricted stock purchase agreement shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The terms and conditions of stock bonus or restricted stock purchase agreements

may change from time to time, and the terms and conditions of separate agreements need not be identical, but each stock bonus or restricted stock purchase agreement shall include (through incorporation of provisions hereof by reference in the agreement or otherwise) the substance of each of the following provisions as appropriate:

(a) The purchase price under each stock purchase agreement shall be such amount as the Board or Committee shall determine and designate in such agreement. Notwithstanding the foregoing, the Board or the Committee may determine that eligible participants in the Plan may be awarded stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.

(b) No rights under a stock bonus or restricted stock purchase agreement shall be assignable by any participant under the Plan, either voluntarily or by operation of law, except where such assignment is required by law or expressly authorized by the terms of the applicable stock bonus or restricted stock purchase agreement.

(c) The purchase price of stock acquired pursuant to a stock purchase agreement shall be paid either: (i) in cash at the time of purchase; (ii) at the discretion of the Board or the Committee, according to a deferred payment or other arrangement with the person to whom the Common Stock is sold; or (iii) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion; including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instruction to pay the aggregate exercise price of the Company from the sales proceeds before Common Stock is issued. Notwithstanding the foregoing, the Board or the Committee to which administration of the Plan has been delegated may award Common Stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.

(d) Shares of Common Stock sold or awarded under the Plan may, but need not, be subject to a repurchase option in favor of the Company in accordance with a vesting schedule to be determined by the Board or the Committee.

(e) In the event a person ceases to be an employee of or ceases to serve as a director or consultant to the Company or an Affiliate, the Company may repurchase or otherwise reacquire any or all of the shares of Common Stock held by that person which have not vested as of the date of termination under the terms of the stock bonus or restricted stock purchase agreement between the Company and such person.

(a) During the terms of the Stock Awards granted under the Plan, the

Company shall keep available at all times the number of shares of Common Stock required to satisfy such Stock Awards up to the number of shares of Common Stock authorized under the Plan.

(b) The Company shall seek to obtain from each regulatory commission or agency having jurisdiction over the Plan such authority as may be required to issue and sell shares of Common Stock under the Stock Awards granted under the Plan; provided, however, that this undertaking shall not require the Company to register under the Securities Act either the Plan, any Stock Award granted under the Plan or any Common Stock issued or issuable pursuant to any such Stock Award. If, after reasonable efforts, the Company is unable to obtain from any such regulatory commission or agency the authority that counsel for the Company deems necessary for the lawful issuance and sale of Common Stock under the Plan, the Company shall be relieved from any liability for failure to issue and sell Common Stock upon exercise of such Stock Awards unless and until such authority is obtained.

(a) The Board or Committee shall have the power to accelerate the time during which a Stock Award may be exercised or the time during which a Stock Award or any part thereof will vest, notwithstanding the provisions in the Stock Award stating the time during which it may be exercised or the time during which it will vest. Each Discretionary Stock Option providing for vesting pursuant to paragraph 5(e) shall also provide that if the employee's employment or a director's or consultant's affiliation with the Company is terminated by reason of death or disability (within the meaning of Title II or XVI of the Social Security Act and with such permanent and total disability certified by the Social Security Administration prior to such termination), then the vesting schedule of Discretionary Stock Options granted to such employee, director or consultant or to the Trusts of such employee, director or consultant shall be accelerated by twelve months for each full year the employee has been employed by or the director or consultant has been affiliated with the Company. Discretionary Stock Options granted under the Plan that are outstanding on February 25, 1992, shall be amended to include the accelerated vesting upon death provided for in the preceding sentence of this paragraph 10(a) and Discretionary Stock Options granted under the Plan that are outstanding on June 18, 1996, shall be amended to include the accelerated vesting upon disability provided for in the preceding sentence of this paragraph 10(a).

(b) Neither an optionee nor any person to whom an Option is transferred under the provisions of the Plan shall be deemed to be the holder of, or to have any of the rights of a holder with respect to, any shares subject to such Option unless and until such person has satisfied all requirements for exercise of the Option pursuant to its terms.

(c) Nothing in the Plan or any instrument executed or Stock Award granted pursuant thereto shall confer upon any eligible employee, consultant, director, optionee or holder of Stock Awards under the Plan any right to continue in the employ of the Company or any Affiliate or to continue acting as a consultant or director or shall affect the right of the Company or any Affiliate to terminate the employment or consulting relationship or directorship of any eligible employee, consultant, director, optionee or holder of Stock Awards under the Plan with or without cause. In the event that a holder of Stock Awards under the Plan is permitted or otherwise entitled to take a leave of absence, the Company shall have the unilateral right to (i) determine whether such leave of absence will be treated as a termination of employment or relationship as consultant or director for purposes hereof, and (ii) suspend or otherwise delay the time or times at which exercisability or vesting would otherwise occur with respect to any outstanding Stock Awards under the Plan.

If any change is made in the Common Stock subject to the Plan, or subject to any Stock Award granted under the Plan (through merger, consolidation, reorganization, recapitalization, stock dividend, dividend in property other than cash, stock split, liquidating dividend, combination of shares, exchange of shares, change in corporate structure or other transaction not involving the receipt of consideration by the Company), the Plan and outstanding Stock Awards will be appropriately adjusted in the class(es) and maximum number of shares subject to the Plan, the maximum number of shares which may be granted to a participant in a calendar year, the class(es) and number of shares and price per share of stock subject to outstanding Stock Awards, and the number of shares of Common Stock to be granted as provided for in paragraphs 6(a) and 6(b). Such adjustment shall be made by the Board or the Committee, the determination of which shall be final, binding and conclusive. (The conversion of any convertible securities of the Company shall not be treated as a "transaction not involving the receipt of consideration".)

(a) Notwithstanding anything to the contrary in this Plan, in the event of a Change in Control (as hereinafter defined), then, to the extent permitted by applicable law: (i) the time during which Stock Awards become vested shall automatically be accelerated so that the unvested portions of all Stock Awards shall be vested prior to the Change in Control and (ii) the time during which the Options may be exercised shall automatically be accelerated to prior to the Change in Control. Upon and following the acceleration of the vesting and exercise periods, at the election of the holder of the Stock Award, the Stock Award may be: (x) exercised (with respect to Options) or, if the surviving or acquiring corporation agrees to assume the Stock Awards or substitute similar stock awards, (y) assumed; or (z) replaced with substitute stock awards. Options not exercised, substituted or assumed prior to or upon the Change in Control shall be terminated.

(b) For purposes of the Plan, a "Change of Control" shall be deemed to have occurred at any of the following times:

(i) upon the acquisition (other than from the Company) by any person, entity or "group," within the meaning of Section 13(d)(3) or 14(d)(2) of the Exchange Act (excluding, for this purpose, the Company or its affiliates, or any employee benefit plan of the Company or its affiliates which acquires beneficial ownership of voting securities of the Company), of beneficial ownership (within the meaning of Rule 13d-3 promulgated under the Exchange Act) of fifty percent (50%) or more of either the then outstanding shares of Common Stock or the combined voting power of the Company's then outstanding voting securities entitled to vote generally in the election of directors; or

(ii) at the time individuals who, as of April 2, 1991, constitute the Board (the "Incumbent Board") cease for any reason to constitute at least a majority of the Board, provided that any person becoming a director subsequent to April 2, 1991, whose election, or nomination for election by the Company's stockholders, was approved by a vote of at least a majority of the directors then comprising the Incumbent Board (other than an election or nomination of an individual whose initial assumption of office is in connection with an actual or threatened election contest relating to the election of the Directors of the Company, as such terms are used in Rule 14a-11 of Regulation 14A promulgated under the Exchange Act) shall be, for purposes of the Plan, considered as though such person were a member of the Incumbent Board; or

(iii) immediately prior to the consummation by the Company of a reorganization, merger, consolidation, (in each case, with respect to which persons who were the stockholders of the Company immediately prior to such reorganization, merger or consolidation do not, immediately thereafter, own more than fifty percent (50%) of the

combined voting power entitled to vote generally in the election of directors of the reorganized, merged or consolidated company's then outstanding voting securities) or a liquidation or dissolution of the Company or of the sale of all or substantially all of the assets of the Company; or

(iv) the occurrence of any other event which the Incumbent Board in its sole discretion determines constitutes a Change of Control.

(a) Anything in the Plan to the contrary notwithstanding, rights under Stock Awards may be assigned to an Alternate Payee to the extent that a QDRO so provides. (The terms "Alternate Payee" and "QDRO" are defined in paragraph 13(c) below.) The assignment of a Stock Award to an Alternate Payee pursuant to a QDRO shall not be treated as having caused a new grant. The transfer of an Incentive Stock Option to an Alternate Payee may, however, cause it to fail to qualify as an Incentive Stock Option. If a Stock Award is assigned to an Alternate Payee, the Alternate Payee generally has the same rights as the grantee under the terms of the Plan; provided however, that (i) the Stock Award shall be subject to the same vesting terms and exercise period as if the Stock Award were still held by the grantee, (ii) an Alternate Payee may not transfer a Stock Award and (iii) an Alternate Payee is ineligible for Re-Load Options described at paragraph 5(j) or Director Re-Load Options described at paragraph 6(j).

(b) In the event of the Plan administrator's receipt of a domestic relations order or other notice of adverse claim by an Alternate Payee of a grantee of a Stock Award, transfer of the proceeds of the exercise of such Stock Award, whether in the form of cash, stock or other property, may be suspended. Such proceeds shall thereafter be transferred pursuant to the terms of a QDRO or other agreement between the grantee and Alternate Payee. A grantee's ability to exercise a Stock Award may be barred if the Plan administrator receives a court order directing the Plan administrator not to permit exercise.

(c) The word "QDRO" as used in the Plan shall mean a court order (i) that creates or recognizes the right of the spouse, former spouse or child (an "Alternate Payee") of an individual who is granted a Stock Award to an interest in such Stock Award relating to marital property rights or support obligations and (ii) that the administrator of the Plan determines would be a "qualified domestic relations order," as that term is defined in section 414(p) of the Code and section 206(d) of the Employee Retirement Income Security Act ("ERISA"), but for the fact that the Plan is not a plan described in section 3(3) of ERISA.

(a) The Board at any time, and from time to time, may amend the Plan. However, except as provided in Section 10 relating to adjustments upon changes in the Common Stock, no amendment shall be effective unless approved by the stockholders of the Company within twelve (12) months before or after the adoption of the amendment, where the amendment will:

(i) increase the number of shares reserved for Stock Awards under the Plan;

(ii) modify the requirements as to eligibility for participation in the Plan (to the extent such modification requires stockholder approval in order for the Plan to satisfy the requirements of Section 422(b) of the Code); or

(iii) modify the Plan in any other way if such modification requires stockholder approval in order for the Plan to satisfy the requirements of Section 422(b) of the Code.

(b) The Board may in its sole discretion submit any other amendment to the Plan for stockholder approval, including, but not limited to, amendments to the Plan intended to satisfy the requirements of Section 162(m) of the Code and the regulations promulgated thereunder regarding the exclusion of performance- based compensation from the limit on corporate deductibility of compensation to certain executive officers.

(c) It is expressly contemplated that the Board may amend the Plan in any respect the Board deems necessary or advisable to provide optionees with the maximum benefits provided or to be provided under the provisions of the Code and the regulations promulgated thereunder relating to employee Incentive Stock Options and/or to bring the Plan and/or Options granted under it into compliance therewith.
(d) Rights and obligations under any Stock Award granted before amendment of the Plan shall not be impaired by any amendment of the Plan, unless: (i) the Company requests the consent of the person to whom the Stock Award was granted; and (ii) such person consents in writing.

(a) The Board may suspend or terminate the Plan at any time. No Stock Awards may be granted under the Plan while the Plan is suspended or after it is terminated. No Incentive Stock Options may be granted under the Plan after February 22, 2009.

(b) Rights and obligations under any Stock Awards granted while the Plan is in effect shall not be impaired by suspension or termination of the Plan, except with the consent of the person to whom the Stock Award was granted.

The Plan shall become effective as determined by the Board.

EXHIBIT 10.2

AMGEN INC.

AMENDED AND RESTATED 1997 SPECIAL NON-OFFICER EQUITY INCENTIVE PLAN

(a) The purpose of the 1997 Special Non-Officer Equity Incentive Plan (the "Plan") is to provide a means by which non-Officer employees of and consultants to Amgen Inc., a Delaware corporation (the "Company"), and employees of and consultants to the Company's Affiliates, as defined in paragraph 1(b), directly, or indirectly through Trusts, may be given an opportunity to benefit from increases in value of the stock of the Company through the granting of (i) stock options, (ii) stock bonuses, and (iii) rights to purchase restricted stock, all as defined below.

(b) The word "Affiliate" as used in the Plan means any parent corporation or subsidiary corporation of the Company, as those terms are defined in Sections 424(e) and (f), respectively, of the Internal Revenue Code of 1986, as amended (the "Code").

(c) The Company, by means of the Plan, seeks to retain the services of non-Officer employees of the Company and persons serving as consultants to the Company, to secure and retain the services of persons capable of filling such positions, and to provide incentives for such persons to exert maximum efforts for the success of the Company.

(d) The Company intends that the rights issued under the Plan ("Stock Awards") shall, in the discretion of the Board of Directors of the Company (the "Board") or any committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), be either (i) stock options granted pursuant to Section 5 hereof, which option shall not qualify as incentive stock options as that term is used in Section 422 of the Code ("Options") or (ii) stock bonuses or rights to purchase restricted stock granted pursuant to Section 6 hereof.

(e) The word "Trust" as used in the Plan shall mean a trust created for the benefit of the employee or consultant, his or her spouse, or members of their immediate family. The word optionee shall mean the person to whom the option is granted or the employee or consultant for whose benefit the option is granted to a Trust, as the context shall require.

(a) The Plan shall be administered by the Board unless and until the Board delegates administration to a committee, as provided in paragraph 2(c).

(b) The Board shall have the power, subject to, and within the limitations of, the express provisions of the Plan:

(1) To determine from time to time which of the persons eligible under the Plan shall be granted Stock Awards; when and how Stock Awards shall be granted; whether a Stock Award will be an Option, a stock bonus, a right to purchase restricted stock, or a combination of the foregoing; the provisions of each Stock Award granted (which need not be identical), including the time or times when a person shall be permitted to purchase or receive stock pursuant to a Stock Award; and the number of shares with respect to which Stock Awards shall be granted to each such person.

(2) To construe and interpret the Plan and Stock Awards granted under it, and to establish, amend and revoke rules and regulations for its administration. The Board, in the exercise of this power, may correct any defect, omission or inconsistency in the Plan or in any Stock Award, in a manner and to the extent it shall deem necessary or expedient to make the Plan fully effective.

(3) To amend the Plan as provided in Section 13.

(4) Generally, to exercise such powers and to perform such acts as the Board deems necessary or expedient to promote the best interests of the Company.

(c) The Board may delegate administration of the Plan to a committee composed of not fewer than two (2) members of the Board (the "Committee") which members may be non-employee directors and outside directors. If administration is delegated to a Committee, the Committee shall have, in connection with the administration of the Plan, the powers theretofore possessed by the Board, subject, however, to such resolutions, not inconsistent with the provisions of the Plan, as may be adopted from time to time by the Board. Notwithstanding anything else in this paragraph 2(c) to the contrary, at any time the Board or the Committee may delegate to a committee of one or more members of the Board the authority to grant or amend options to all employees or consultants or any portion or class thereof.

(d) The term "non-employee director" shall mean a member of the Board who (i) is not currently an officer of the Company or a parent or subsidiary of the Company (as defined in Rule 16a-1(f) promulgated by the Securities and Exchange Commission under Section 16 of the Securities Exchange Act of 1934, as amended (the "Exchange Act")) or an employee of the Company or a parent or subsidiary of the Company; (ii) does not receive compensation from the Company or a parent or subsidiary of the Company for services rendered in any capacity other than as a member of the Board (including a consultant) in an amount required to be disclosed to the Company's stockholders under Rule 404 of Regulation S-K promulgated by the Securities and Exchange Commission ("Rule 404"); (iii) does not possess an interest in any other transaction required to be disclosed under Rule 404; or (iv) is not engaged in a business relationship required to be disclosed under Rule 404, as all of these provisions are interpreted by the Securities and Exchange Commission under Rule 16b-3 promulgated under the Exchange Act.

(e) The term "outside director," as used in this Plan, shall mean an administrator of the Plan, whether a member of the Board or of any Committee to which responsibility for administration of the Plan has been delegated pursuant to paragraph 2(c), who is considered to be an "outside director" in accordance with the rules, regulations or interpretations of Section 162(m) of the Code.

(a) Subject to the provisions of Section 10 relating to adjustments upon changes in stock, the stock that may be issued pursuant to Stock Awards granted under the Plan shall not exceed in the aggregate Eighty-Nine Million (89,000,000) shares of the Company's $.0001 par value common stock (the "Common Stock"). If any Stock Award granted under the Plan shall for any reason expire or otherwise terminate without having been exercised in full, the Common Stock not purchased under such Stock Award shall again become available for the Plan. Shares repurchased by the Company pursuant to any repurchase rights reserved by the Company pursuant to the Plan shall not be available for subsequent issuance under the Plan.

(b) The Common Stock subject to the Plan may be unissued shares or reacquired shares, bought on the market or otherwise.

(a) Stock Awards may be granted to non-Officer employees of the Company, or employees of any Affiliate, or consultants to the Company or any Affiliate, or to Trusts of any such employee or consultant. Notwithstanding any other provisions in this Plan to the contrary, Officers of the Company shall not be eligible to receive Stock Awards. The term "Officer" shall include any natural person who is elected as a corporate officer of the Company by the Board.

(b) Stock Awards shall be limited to a maximum of 2,000,000 shares of Common Stock per person per calendar year.

An Option granted pursuant to this Section 5 shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The provisions of separate Options need not be identical, but each Option shall include (through incorporation of provisions hereof by reference in the Option or otherwise) the substance of each of the following provisions:

(a) No Option shall be exercisable after the expiration of ten (10) years from the date it was granted.

(b) The exercise price of each Option shall be not less than one hundred percent (100%) of the fair market value of the Common Stock subject to the Option on the date the Option is granted.

(c) The purchase price of Common Stock acquired pursuant to an Option shall be paid, to the extent permitted by applicable statutes and regulations, either: (i) in cash at the time the Option is exercised; or (ii) at the discretion of the Board or the Committee, either at the time of grant or exercise of the Option (A) by delivery to the Company of shares of Common Stock that have been held for the period required to avoid a charge to the Company's reported earnings and valued at the fair market value of the shares of Common Stock on the date of exercise, (B) according to a deferred payment or other arrangement with the person to whom the Option is granted or to whom the Option is transferred pursuant to paragraph 5(d), or (C) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion, including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or, prior to the issuance of Common Stock, receipt by the Company of evidence from the person authorized to sell the underlying stock that they have received irrevocable instructions from the option holder to pay to the Company the aggregate exercise price of the Option from the sale proceeds.

In the case of any deferred payment arrangement, interest shall be payable at least annually and shall be charged at not less than the minimum rate of interest necessary to avoid the treatment as interest, under any applicable provisions of the Code, of any amounts other than amounts stated to be interest under the deferred payment arrangement.

(d) An Option granted to a natural person shall be exercisable during the lifetime of such person only by such person, provided that such person during such person's lifetime may designate a Trust to be such person's beneficiary, and such beneficiary shall, after the death of the person to whom the Option was granted, have all the rights that such person had while living, including the right to exercise the Option. In the absence of such designation, after the death of the person to whom the Option is granted, the Option shall be exercisable by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution.

(e) The total number of shares of Common Stock subject to an Option may, but need not, be allotted in periodic installments (which may, but need not, be equal). From time to time during each of such installment periods, the Option may become exercisable ("vest") with respect to some or all of the shares allotted to that period, and may be exercised with respect to some or all of the shares allotted to such period and/or any prior period as to which the Option was not fully exercised. During the remainder of the term of the Option (if its term extends beyond the end of the installment periods), the Option may be exercised from time to time with respect to any shares then remaining subject to the Option. The provisions of this paragraph 5(e) are subject to any Option provisions governing the minimum number of shares as to which an Option may be exercised.

(f) The Company may require any optionee, or any person to whom an Option is transferred under paragraph 5(d), as a condition of exercising any such Option: (i) to give written assurances satisfactory to the Company as to such person's knowledge and experience in financial and business matters and/or the employment of such person's purchaser

representative who has such knowledge and experience in financial and business matters, and that such person is capable of evaluating, alone or together with the purchaser representative, the merits and risks of exercising the Option; and
(ii) to give written assurances satisfactory to the Company stating that such person is acquiring the Common Stock subject to the Option for such person's own account and not with any present intention of selling or otherwise distributing the Common Stock. These requirements, and any assurances given pursuant to such requirements, shall be inoperative if: (x) the issuance of the shares upon the exercise of the Option has been registered under a then currently effective registration statement under the Securities Act of 1933, as amended (the "Securities Act"); or (y) as to any particular requirement, a determination is made by counsel for the Company that such requirement need not be met in the circumstances under the then applicable securities law.

(g) An Option shall terminate three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate, unless: (i) such termination is due to the optionee's permanent and total disability, within the meaning of Section 422(c)(6) of the Code and with such permanent and total disability being certified by the Social Security Administration prior to such termination, in which case the Option may, but need not, provide that it may be exercised at any time within one (1) year following such termination of employment or relationship as a consultant; (ii) the optionee dies while in the employ of or while serving as a consultant to the Company or an Affiliate, or within not more than three (3) months after termination of such employment or relationship as a consultant, in which case the Option may, but need not, provide that it may be exercised at any time within eighteen (18) months following the death of the optionee by the person or persons to whom the optionee's rights under such Option pass by will or by the laws of descent and distribution; or (iii) the Option by its term specifies either (A) that it shall terminate sooner than three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate; or (B) that it may be exercised more than three (3) months after termination of the optionee's employment or relationship as a consultant with the Company or an Affiliate. Notwithstanding any other provision in this Plan to the contrary, (x) no portion of an Option shall be exercisable by any person to the extent that the Company's federal income tax deduction with respect to the exercise of such portion of the Option would be subject to disallowance pursuant to Section 162(m) of the Code, or any successor thereto, and (y) subject to paragraph 5(a), if any portion of an Option is not exercisable solely because of the preceding clause (x) on the date on which such Option would otherwise terminate pursuant to the foregoing provisions of this paragraph 5(g), such Option shall not terminate until three (3) months after such Option thereafter ceases to be subject to the preceding clause (x). Subject to the preceding sentence, any portion of an Option which is not exercisable on the date on which an optionee's employment or relationship as a consultant with the Company or an Affiliate ceases shall terminate immediately on such date. This paragraph 5(g) shall not be construed to extend the term of any Option or to permit anyone to exercise the Option after expiration of its term, nor shall it be construed to increase the number of shares as to which any Option is exercisable from the amount exercisable on the date of termination of the optionee's employment or relationship as a consultant.

(h) The Option may, but need not, include a provision whereby the optionee may elect at any time during the term of the optionee's employment or relationship as a

consultant with the Company or any Affiliate to exercise the Option as to any part or all of the shares subject to the Option prior to the stated vesting dates of the Option. Any shares so purchased from any unvested installment or Option may be subject to a repurchase right in favor of the Company or to any other restriction the Board or the Committee determines to be appropriate.

(i) To the extent provided by the terms of an Option, each optionee may satisfy any federal, state or local tax withholding obligation relating to the exercise of such Option by any of the following means or by a combination of such means: (i) tendering a cash payment; (ii) authorizing the Company to withhold from the shares of the Common Stock otherwise issuable to the optionee as a result of the exercise of the Option a number of shares having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding; or (iii) delivering to the Company owned and unencumbered shares of the Common Stock having a fair market value less than or equal to the amount of the Company's required minimum statutory withholding.

Each stock bonus or restricted stock purchase agreement shall be in such form and shall contain such terms and conditions as the Board or the Committee shall deem appropriate. The terms and conditions of stock bonus or restricted stock purchase agreements may change from time to time, and the terms and conditions of separate agreements need not be identical, but each stock bonus or restricted stock purchase agreement shall include (through incorporation of provisions hereof by reference in the agreement or otherwise) the substance of each of the following provisions as appropriate:

(a) The purchase price under each stock purchase agreement shall be such amount as the Board or Committee shall determine and designate in such agreement. Notwithstanding the foregoing, the Board or the Committee may determine that eligible participants in the Plan may be awarded stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.

(b) No rights under a stock bonus or restricted stock purchase agreement shall be assignable by any participant under the Plan, either voluntarily or by operation of law, except where such assignment is required by law or expressly authorized by the terms of the applicable stock bonus or restricted stock purchase agreement.

(c) The purchase price of stock acquired pursuant to a stock purchase agreement shall be paid either: (i) in cash at the time of purchase; (ii) at the discretion of the Board or the Committee, according to a deferred payment or other arrangement with the person to whom the Common Stock is sold; or (iii) in any other form of legal consideration that may be acceptable to the Board or the Committee in their discretion; including but not limited to payment of the purchase price pursuant to a program developed under Regulation T as promulgated by the Federal Reserve Board which results in the receipt of cash (or a check) by the Company before Common Stock is issued or the receipt of irrevocable instruction to pay the aggregate exercise price of the Company from the sales proceeds before Common Stock is

issued. Notwithstanding the foregoing, the Board or the Committee to which administration of the Plan has been delegated may award Common Stock pursuant to a stock bonus agreement in consideration for past services actually rendered to the Company or for its benefit.

(d) Shares of Common Stock sold or awarded under the Plan may, but need not, be subject to a repurchase option in favor of the Company in accordance with a vesting schedule to be determined by the Board or the Committee.

(e) In the event a person ceases to be an employee of or ceases to serve as a consultant to the Company or an Affiliate, the Company may repurchase or otherwise reacquire any or all of the shares of Common Stock held by that person which have not vested as of the date of termination under the terms of the stock bonus or restricted stock purchase agreement between the Company and such person.

(a) During the terms of the Stock Awards granted under the Plan, the Company shall keep available at all times the number of shares of Common Stock required to satisfy such Stock Awards up to the number of shares of Common Stock authorized under the Plan.

(b) The Company shall seek to obtain from each regulatory commission or agency having jurisdiction over the Plan such authority as may be required to issue and sell shares of Common Stock under the Stock Awards granted under the Plan; provided, however, that this undertaking shall not require the Company to register under the Securities Act either the Plan, any Stock Award granted under the Plan or any Common Stock issued or issuable pursuant to any such Stock Award. If, after reasonable efforts, the Company is unable to obtain from any such regulatory commission or agency the authority that counsel for the Company deems necessary for the lawful issuance and sale of Common Stock under the Plan, the Company shall be relieved from any liability for failure to issue and sell Common Stock upon exercise of such Stock Awards unless and until such authority is obtained.

Proceeds from the sale of Common Stock pursuant to Stock Awards granted under the Plan shall constitute general funds of the Company.

(a) The Board or Committee shall have the power to accelerate the time during which a Stock Award may be exercised or the time during which a Stock Award or any part thereof will vest, notwithstanding the provisions in the Stock Award stating the time during which it may be exercised or the time during which it will vest. Each Option providing for vesting pursuant to paragraph 5(e) shall also provide that if the employee's employment or a consultant's affiliation with the Company is terminated by reason of death or disability (within the meaning of Title II or XVI of the Social Security Act and with such permanent and total disability certified by the Social Security Administration prior to such termination), then the

vesting schedule of Options granted to such employee or consultant or to the Trusts of such employee or consultant shall be accelerated as of the date of such termination by twelve months for each full year the employee has been employed by or the consultant has been affiliated with the Company.

(b) Neither an optionee nor any person to whom an Option is transferred under the provisions of the Plan shall be deemed to be the holder of, or to have any of the rights of a holder with respect to, any shares subject to such Option unless and until such person has satisfied all requirements for exercise of the Option pursuant to its terms.

(c) Nothing in the Plan or any instrument executed or Stock Award granted pursuant thereto shall confer upon any eligible employee, consultant, optionee or holder of Stock Awards under the Plan any right to continue in the employ of the Company or any Affiliate or to continue acting as a consultant or shall affect the right of the Company or any Affiliate to terminate the employment or consulting relationship of any eligible employee, consultant, optionee or holder of Stock Awards under the Plan with or without cause, at any time and with or without notice. In the event that a holder of Stock Awards under the Plan is permitted or otherwise entitled to take a leave of absence, the Company shall have the unilateral right to (i) determine whether such leave of absence will be treated as a termination of employment or relationship as consultant for purposes hereof, and (ii) suspend or otherwise delay the time or times at which exercisability or vesting would otherwise occur with respect to any outstanding Stock Awards under the Plan.

(a) In the event that any dividend or other distribution (whether in the form of cash, Common Stock, other securities, or other property), recapitalization, reclassification, stock split, reverse stock split, reorganization, merger, consolidation, split-up, spin-off, combination, repurchase, liquidation, dissolution, or sale, transfer, exchange or other disposition of all or substantially all of the assets of the Company, or exchange of Common Stock or other securities of the Company (other than pursuant to the conversion of convertible securities), issuance of warrants or other rights to purchase Common Stock or other securities of the Company, or other similar corporate transaction or event, in the Board's or the Committee's sole discretion, affects the Common Stock such that an adjustment is determined by the Board or the Committee to be appropriate in order to prevent dilution or enlargement of the benefits or potential benefits intended to be made available under the Plan or with respect to Stock Awards, then the Committee or the Board shall, in such manner as it may deem equitable, may make the following adjustments to the Plan and with respect to any or all of the outstanding Stock Awards:

a. the number and kind of shares of Common Stock (or other securities or property) with respect to which Stock Awards may be granted under the Plan (including, but not limited to, adjustments of the limitations in paragraph 3(a) on the maximum number and kind of shares which may be issued under the Plan and in paragraph 4(b) on the maximum number of shares subject to Stock Awards which can be granted any person in a calendar year),

b. the number and kind of shares of Common Stock (or other securities or property) subject to outstanding Stock Awards, including by providing, either by the terms of such Stock Awards or by action taken prior to the occurrence of such transaction or event, that upon such event, such Stock Award shall be assumed by a successor or survivor corporation, or a parent or subsidiary thereof, or shall be substituted for by similar Stock Awards covering the stock of a successor or survivor corporation, or a parent or subsidiary thereof, with appropriate adjustments as to the number and kind of shares and prices, and

c. the grant or exercise price with respect to any Stock Award.

(b) In the event that the Board or Committee adjusts any or all of the outstanding Stock Awards by providing that such Stock Awards shall be assumed by a successor or survivor corporation, or a parent or subsidiary thereof, or shall be substituted for by similar options, rights or awards covering the stock of a successor or survivor corporation, or a parent or subsidiary thereof, the Board or the Committee may, in its sole discretion, determine that the transfer of the optionee's or other holder's employment or consulting relationship to such successor or survivor corporation or a parent or subsidiary thereof shall not constitute a cessation of the optionee's or holder's employment or consulting relationship with the Company or an Affiliate for the purposes of paragraph 5(g).

(c) Any adjustments made by the Board or the Committee under paragraphs 10(a) and 10(b) shall be final, binding and conclusive on all persons.

(a) Notwithstanding anything to the contrary in this Plan, in the event of a Change in Control (as hereinafter defined), then, to the extent permitted by applicable law: (i) the time during which Stock Awards become vested shall automatically be accelerated so that the unvested portions of all Stock Awards shall be vested prior to the Change in Control and (ii) the time during which the Options may be exercised shall automatically be accelerated to immediately prior to the Change in Control. Upon and following the acceleration of the vesting and exercise periods, at the election of the holder of the Stock Award, the Stock Award may be: (x) exercised (with respect to Options) or, if the surviving or acquiring corporation agrees to assume the Stock Awards or substitute similar stock awards, (y) assumed; or (z) replaced with substitute stock awards. Options not exercised, substituted or assumed prior to or upon the Change in Control shall be terminated.

(b) For purposes of the Plan, a "Change of Control" shall be deemed to have occurred at any of the following times:

(i) upon the acquisition (other than from the Company) by any person, entity or "group," within the meaning of Section 13(d)(3) or 14(d)(2) of the Exchange Act (excluding, for this purpose, the Company or its affiliates, or any employee benefit plan of the Company or its affiliates which acquires beneficial ownership of voting securities of the Company), of beneficial ownership (within the meaning of Rule 13d-3 promulgated under the

Exchange Act) of fifty percent (50%) or more of either the then outstanding shares of Common Stock or the combined voting power of the Company's then outstanding voting securities entitled to vote generally in the election of directors; or

(ii) at the time individuals who, as of December 9, 1997, constitute the Board (the "Incumbent Board") cease for any reason to constitute at least a majority of the Board, provided that any person becoming a director subsequent to December 9, 1997, whose election, or nomination for election by the Company's stockholders, was approved by a vote of at least a majority of the directors then comprising the Incumbent Board (other than an election or nomination of an individual whose initial assumption of office is in connection with an actual or threatened election contest relating to the election of the directors of the Company, as such terms are used in Rule 14a-11 of Regulation 14A promulgated under the Exchange Act) shall be, for purposes of the Plan, considered as though such person were a member of the Incumbent Board; or

(iii) immediately prior to the consummation by the Company of a reorganization, merger, consolidation, (in each case, with respect to which persons who were the stockholders of the Company immediately prior to such reorganization, merger or consolidation do not, immediately thereafter, own more than fifty percent (50%) of the combined voting power entitled to vote generally in the election of directors of the reorganized, merged or consolidated company's then outstanding voting securities) or a liquidation or dissolution of the Company or of the sale of all or substantially all of the assets of the Company; or

(iv) the occurrence of any other event which the Incumbent Board in its sole discretion determines constitutes a Change of Control.

(a) Anything in the Plan to the contrary notwithstanding, rights under Stock Awards may be assigned to an Alternate Payee to the extent that a QDRO so provides. (The terms "Alternate Payee" and "QDRO" are defined in paragraph 12(c) below.) The assignment of a Stock Award to an Alternate Payee pursuant to a QDRO shall not be treated as having caused a new grant. If a Stock Award is assigned to an Alternate Payee, the Alternate Payee generally has the same rights as the grantee under the terms of the Plan; provided however, that
(i) the Stock Award shall be subject to the same vesting terms and exercise period as if the Stock Award were still held by the grantee, and (ii) an Alternate Payee may not transfer a Stock Award.

(b) In the event of the Plan administrator's receipt of a domestic relations order or other notice of adverse claim by an Alternate Payee of a grantee of a Stock Award, transfer of the proceeds of the exercise of such Stock Award, whether in the form of cash, stock or other property, may be suspended. Such proceeds shall thereafter be transferred pursuant to the terms of a QDRO or other agreement between the grantee and Alternate Payee. A grantee's ability to exercise a Stock Award may be barred if the Plan administrator receives a court order directing the Plan administrator not to permit exercise.

(c) The word "QDRO" as used in the Plan shall mean a court order (i) that creates or recognizes the right of the spouse, former spouse or child (an "Alternate Payee") of an individual who is granted a Stock Award to an interest in such Stock Award relating to marital property rights or support obligations and (ii) that the administrator of the Plan determines would be a "qualified domestic relations order," as that term is defined in section 414(p) of the Code and section 206(d) of the Employee Retirement Income Security Act ("ERISA"), but for the fact that the Plan is not a plan described in section 3(3) of ERISA.

The Board at any time, and from time to time, may amend the Plan. Rights and obligations under any Stock Award granted before amendment of the Plan shall not be impaired by any amendment of the Plan, unless: (i) the Company requests the consent of the person to whom the Stock Award was granted; and (ii) such person consents in writing.

(a) The Board may suspend or terminate the Plan at any time. Unless sooner terminated, the Plan shall terminate on December 9, 2007. No Stock Awards may be granted under the Plan while the Plan is suspended or after it is terminated.

(b) Rights and obligations under any Stock Awards granted while the Plan is in effect shall not be impaired by suspension or termination of the Plan, except with the consent of the person to whom the Stock Award was granted.

The Plan shall become effective as determined by the Board.

SHAREHOLDERS' AGREEMENT

OF

KIRIN-AMGEN, INC.,

a California corporation

                                                                                 Page
                                                                                 ----
RECITALS.........................................................................   1

1.    CERTAIN DEFINITIONS........................................................   3

      1.01    Stock..............................................................   3
      1.02    EPO................................................................   3
      1.03    Field of Activity..................................................   4
      1.04    Expression Systems.................................................   4
      1.05    Transferred Technology.............................................   4
      1.06    EPO Technology.....................................................   5
      1.07    EPO Organisms......................................................   6
      1.08    Core Technology....................................................   6
      1.09    Development Program................................................   6
      1.10    Party..............................................................   7

2.    FORMATION..................................................................   7

      2.01    Formation..........................................................   7
      2.02    Name...............................................................   7
      2.03    Principal Office...................................................   8
      2.04    Articles of Incorporation..........................................   8
      2.05    Bylaws.............................................................   8
      2.06    Business Purpose...................................................   8
      2.07    Fiscal Year .......................................................   8
      2.08    California Agent for Service of Process............................   9
      2.09    Counsel to Corporation ............................................   9
      2.10    Accountants to Corporation.........................................   9
      2.11    Initial Capital....................................................   9
      2.12    Subscription.......................................................  10
      2.13    Additional Capital.................................................  11
      2.14    Withdrawals........................................................  12
      2.15    Default on Additional Capital Contribution Obligation..............  12
      2.16    Title to Property..................................................  13
      2.17    Occurrence of the Conversion Event.................................  13

3.    CLOSING....................................................................  14

4.    CLOSING DOCUMENTS..........................................................  14

                                                                                 Page
                                                                                 ----
5.        REPRESENTATIONS AND WARRANTIES OF AMGEN.............................     15
          5.01    Good Standing...............................................     15
          5.02    Authorization...............................................     15
          5.03    No Breach...................................................     15
          5.04    Title.......................................................     16
          5.05    No Violations...............................................     17
          5.06    No Litigation...............................................     18
          5.07    Representations and Warranties..............................     18

6.        REPRESENTATIONS AND WARRANTIES OF KIRIN.............................     19
          6.01    Good Standing...............................................     19
          6.02    Authorization...............................................     19
          6.03    No Breach...................................................     19
          6.04    No Violations...............................................     20
          6.05    No Litigation...............................................     20
          6.06    Representations and Warranties..............................     20

7.        [INTENTIONALLY OMITTED].............................................     21

8.        CONDITIONS PRECEDENT TO THE OBLIGATIONS OF KIRIN....................     21
          8.01    No Misrepresentations.......................................     21
          8.02    Compliance with Agreement...................................     21
          8.03    Delivery....................................................     21
          8.04    Opinion of Counsel..........................................     23
          8.05    No Litigation...............................................     24
          8.06    Additional Documents........................................     24
          8.07    Hart-Scott-Rodino Clearance.................................     25

9.        CONDITIONS PRECEDENT TO THE OBLIGATIONS OF AMGEN....................     25
          9.01    No Misrepresentations.......................................     25
          9.02    Compliance with Agreement...................................     25
          9.03    Delivery....................................................     25
          9.04    Opinion of Counsel..........................................     26
          9.05    No Litigation...............................................     28
          9.06    Additional Documents........................................     28

10.       SURVIVAL AND INDEMNIFICATION........................................     28
          10.01   Survival of Representations and Warranties..................     28
          10.02   Indemnification.............................................     28
          10.03   Mechanism...................................................     29

                                                                            Page
                                                                            ----
11.   BROKERS.............................................................    30

12.   MANAGEMENT..........................................................    31
      12.01   Board of Directors..........................................    31
      12.02   Officers....................................................    31
      12.03   Actions Requiring Consent...................................    32
      12.04   Accounting and Internal Controls............................    33
      12.05   Financial and Business Information and Tax Returns..........    34
      12.06   Bank Accounts...............................................    35
      12.07   Independent Enterprise......................................    35
      12.08   Compensation of Officers and Directors......................    35
      12.09   Fiduciary Duty..............................................    36
      12.10   Other Activities............................................    36
      12.11   Non-Competition.............................................    36

13.   BUSINESS MATTERS....................................................    37
      13.01   License Agreements..........................................    37
      13.02   Development Program.........................................    38
      13.03   Services Agreements.........................................    39

14.   RESTRICTIONS ON SHARES..............................................    39
      14.01   Overall Restrictions........................................    39
      14.02   Additional Restrictions.....................................    40
      14.03   Purchase Price and Payment Date.............................    41
      14.04   Delivery of Shares..........................................    42

15.   ADDITIONAL SHARES...................................................    42

16.   ENDORSEMENT OF CERTIFICATE..........................................    42

17.   [INTENTIONALLY OMITTED].............................................    43

18.   COSTS AND EXPENSES..................................................    43

19.   EXPORT CONTROL LAWS.................................................    44
      19.01   Export Law Compliance.......................................    44
      19.02   Specific Authorization......................................    44

20.   DISTRIBUTIONS OF CASH...............................................    45

                                                                                 Page
                                                                                 ----
21.        DISSOLUTION/LIQUIDATION............................................     45

           21.01    Event of Dissolution......................................     45
           21.02    Final Accounting and Tax Returns..........................     46
           21.03    Liquidation...............................................     46
           21.04    Cancellation of Certificates..............................     47

22.        MISCELLANEOUS PROVISIONS...........................................     48
           22.01    Notices...................................................     48
           22.02    Publicity and Disclosure..................................     49
           22.03    Entire Agreement; Amendment...............................     49
           22.04    Waiver....................................................     50
           22.05    Enforcement...............................................     50
           22.06    Remedies..................................................     51
           22.07    Headings..................................................     51
           22.08    Effectiveness.............................................     51
           22.09    Attorneys' Fees and Costs.................................     52
           22.10    Governing Law.............................................     52
           22.11    Binding Effect............................................     52
           22.12    Exhibits..................................................     52
           22.13    Number and Gender.........................................     53
           22.14    Counterparts..............................................     53
           22.15    Agreement to Perform Necessary Acts.......................     53
           22.16    Validity..................................................     53
           22.17    Representations...........................................     54
           22.18    Force Majeure.............................................     54
           22.19    Expansion of Business.....................................     55

SIGNATURES....................................................................     55

EXHIBIT SCHEDULE

THIS SHAREHOLDERS' AGREEMENT ("Agreement") is made and entered into at Los Angeles, California, U.S.A. this 11th day of May, 1984, by and among AMGEN, a California corporation, having its principal office at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A . ("Amgen"), KIRIN BREWERY COMPANY, LIMITED, a Japanese corporation, having its principal office at 26-1, Jingumae, 6 Chome, Shibuya-Ku, Tokyo 150, Japan ("Kirin"), and KIRIN-AMGEN, INC., a California corporation, having its principal office at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A. ("Corporation").

R E C I T A L S

A. Amgen has conducted research, has developed and possesses certain existing proprietary technical information, technology and know-how relating to genetic engineering which has enabled it to clone and express the gene for human erythropoietin, and Amgen is continuing to develop human erythropoietin.

B. Kirin and Amgen believe that the aforementioned genetic engineering techniques will have important application to the development of human therapeutic products.

C. Kirin and Amgen desire to form Corporation for purposes of development, manufacture, production and worldwide commercial sale of erythropoietin for human therapeutic use.

D. Kirin and Amgen believe that a joint business effort between them dedicated to such purposes would be of mutual benefit to the accomplishment thereof and that the compatibility between Amgen and Kirin is such that substantial economic returns may be gained by each through cooperative effort.

E. Amgen intends to contribute cash to Corporation, to assign to Corporation, perpetually and irrevocably, all of its right, title and interest in and to the Transferred Technology (as defined in Paragraph 1.05 below), and to license to Corporation the Core Technology (as defined in Paragraph 1.08 below), exclusively with respect to its direct application to the Field of Activity (as defined in Paragraph 1.03 below), as more fully set forth herein, in consideration of the issuance to Amgen of capital stock in Corporation as more fully set forth herein.

F. Kirin intends to contribute cash to Corporation in consideration of the issuance to Kirin of capital stock in Corporation as more fully set forth herein.

G. The simultaneous transfers and resultant issuances contemplated in Recitals E. and F. above are intended to qualify as a tax-free incorporation of Corporation pursuant to Section 351 of the Internal Revenue Code of 1954, as amended.

H. It is the desire of Kirin and Amgen to cooperate in other mutually agreeable areas of business interest.

NOW, THEREFORE, it is agreed as follows:

As used in this Agreement, the following terms shall have the following meanings:

(a) The term Class A Common Stock shall mean the duly authorized no par common stock of Corporation with no preference rights on liquidation.

(b) The term Class B Common Stock shall mean the duly authorized no par common stock of Corporation which contains certain preference rights on liquidation (as set forth in Para- graph 21 below), which preference rights shall be in effect until the occurrence of the Conversion Event (as defined in Paragraph 2.17 below), at which time all issued and outstanding Class B Common Stock shall be automatically converted into Class A Common Stock on a share-for- share basis eliminating any shareholder preference rights on liquidation of Corporation.

1.02 EPO

The term EPO shall mean erythropoietin or a fragment thereof for use in human therapeutic applications, whether

manufactured or isolated from natural materials, and whether glycosylated or not glycosylated.

The term Field of Activity shall mean- the areas of development, manufacture, production and worldwide commercial sale of EPO, including EPO pharmaceuticals, for human therapeutic use, but not for animal therapeutic use nor- for commercial diagnostic use (collectively "EPO Products"), and shall include but not be limited to, toxicology, dosage studies, pre-clinical studies, clinical trials, product registration and government approvals, all relative to the development, manufacture, production and worldwide commercial sale of such EPO Products.

The term Expression Systems shall mean any system of production of EPO utilizing natural or synthetic genes or vectors or recombinant DNA materials, including but not limited to, expression in e. coli, mammalian and/or yeast cell systems.

The term Transferred Technology shall mean all proprietary technical information, technology and know-how, heretofore developed by Amgen, relating specifically to EPO Products which are owned by Amgen, or which is covered or protected by letters patent, patent applications, trademarks, service marks, trade names, copyrights or licenses held by Amgen,

as of the Closing Date, and which are required in the development, manufacture, production, testing, assay, use or sale of EPO Products, including the EPO Organisms (as defined in Paragraph 1.07 below) in existence as of the Closing Date. By way of illustration, but not limitation, with respect to the foregoing, Transferred Technology shall include the sequence of the EPO gene and restriction map of the related vector and any information, know-how, data, process, technique, algorithm, program, design, drawing, formula or test data relating to any toxicology, dosage studies, pre-clinical studies, clinical trials or testing in progress relating to EPO,as more fully set forth on Exhibit "A" attached hereto. The Transferred Technology shall be assigned to Corporation effective on the Closing Date pursuant to that certain Assignment and License Agreement which is attached hereto as Exhibit "B" ("Amgen Assignment"); provided, however, that until such time as the Conversion Event occurs, Amgen shall hold as custodian for Corporation and Kirin, the sequence of the EPO gene and restriction map of the related vector.

The term EPO Technology shall mean the Transferred Technology, as well as all improvements and enhancements thereto developed by the Parties hereafter- under the Development Program, and the Core Technology (as defined in Paragraph 1.08 below), as well as all improvements and enhancements thereto developed by the Parties hereafter which have been used in the development of EPO Products whether within or without of the Development Program

The term EPO Organisms shall mean any and all organisms developed by Amgen which are assigned perpetually and irrevocably to Corporation pursuant to the Amgen Assignment, and which have been genetically engineered to produce biologically active EPO, as well as all improvements and enhancements thereto developed by Amgen subsequent to the Closing Date pursuant to the Development Program.

The term Core Technology shall mean Amgen's proprietary technical information, technology and know-how, including without limitation, protein purification, fermentation, process development and hybridomas, other than Transferred Technology, which is required to conduct Corporation's business in the Field of Activity. The Core Technology shall be licensed to Corporation exclusively with respect to its direct application to the Field of Activity pursuant to the Amgen Assignment.

The term Development Program, as more fully set forth in the Development and Supply Agreement attached hereto as Exhibit "C," and which shall have appended thereto the preliminary R&D Plan and Budget therefor, shall mean any development conducted by Amgen, Kirin and/or Corporation and paid for by Corporation relating to (i) toxicology, dosage studies, preclinical studies, clinical trials and product registration of EPO

in accordance with the laws, regulations and guidelines of the United States and Japan, respectively, (ii) commercial manufacturing scale production of EPO in one or more Expression Systems, and (iii) other mutually agreed upon development activities related to the Field of Activity.

The term Party shall mean Kirin, Amgen or Corporation, as the context shall indicate, or, when used in the plural, Kirin, Amgen and Corporation, as the context shall indicate.

On or before the Closing Date (as defined in Paragraph 3 below), Kirin and Amgen shall establish or cause to be established, "Kirin-Amgen, Inc.," which shall be a corporation organized under the laws of the State of California. Immediately after its formation, Kirin-Amgen, Inc. shall become a Party to this Agreement.

The corporate designation of Corporation shall be "Kirin-Amgen, Inc." or such other name as may be mutually agreed to by Kirin and Amgen.

The principal office and place of business of Corporation shall be located at 1900 Oak Terrace Lane, Thousand Oaks, California 91320, U.S.A., or at such other place as may be mutually agreed to by Kirin and Amgen.

The Articles of Incorporation of Corporation ("Articles") shall be as attached hereto as Exhibit "D," as may be amended from time to time as may be mutually agreed to by Kirin and Amgen.

The Bylaws of Corporation ("Bylaws") shall be as attached hereto as Exhibit "E", as may be amended from time to time as may be mutually agreed to by Kirin and Amgen.

The business of Corporation shall be to engage in the development, manufacture, production and sale of EPO Products for human therapeutic use in the Field of Activity and to otherwise exploit such EPO Technology for commercial purposes by whatever means including, but not limited to, the license or sale of such EPO Technology by mutual agreement of Kirin and Amgen, and to do all things necessary, appropriate or advisable in furtherance thereof.

The fiscal year of Corporation shall be the calendar year ("Corporate Year").

The name of the initial agent for service of process on Corporation in California is Joel S. Marcus, Esq., Musick, Peeler & Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017.

The law firm of Musick, Peeler and Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017, shall act as general counsel for Corporation until otherwise mutually agreed between Kirin and Amgen pursuant to that certain Conflicts Letter of even date herewith which is attached hereto as Exhibit "F".

The independent certified public accounting firm of Arthur Young and Company, 515 South Flower Street, Suite 2600, Los Angeles, California 90071, shall act as independent accountants to Corporation pursuant to that certain engagement letter attached hereto as Exhibit "G".

2.11 Initial Capital

The initial capital of Corporation pursuant to the two (2) subscriptions described in Paragraph 2.12 below, shall consist of a total of twelve million (12,000,000) shares of no par value Class A Common Stock with the right to one (1) vote per share ("Class A Common Stock"), and twelve million (12,000,000) shares of no par value Class B Common Stock with the right to one

(1) vote per share ("Class B Common Stock"). Upon the occurrence of the Conversion Event (as defined in Paragraph 2.17 below), Kirin's shares of Class B Common Stock shall be automatically converted on a share-for-share basis into shares of Class A common stock subject to the terms of Paragraph 2.17 below and the provisions contained in Corporation's Articles.

2.12 Subscription

Kirin hereby subscribes for twelve million (12,000,000) shares of Class B Common Stock of Corporation, and Amgen hereby subscribes for twelve million shares (12,000,000) shares of Class A Common Stock of Corporation. The subscription price for all shares, whether of Class A Common Stock or Class B Common Stock, shall be ONE DOLLAR (U.S. $1.00) per share, and shall be payable as follows:

2.12.1 Kirin shall pay its full subscription price for the Class B Common Stock by cashiers or certified check or by wire transfer from Kirin to Corporation's account at a bank to be designated by both Kirin and Amgen ("Corporate Bank Account") on the Closing Date of the full subscription price of TWELVE MILLION DOLLARS (US $12,000,000.00).

2.12.2 Amgen shall pay its full subscription price for the Class A Common Stock as follows: (i) FOUR MILLION DOLLARS (U.S. $4,000,000.00) by cashiers or certified check or by wire transfer from Amgen to the Corporate Bank Account on the Closing Date, and (ii) a contribution and complete assignment in

kind to Corporation on the Closing Date of all of the Transferred Technology, such transfer to be made pursuant to the Amgen Assignment. Kirin and Amgen acknowledge that the fair market value of Amgen's capital contribution to Corporation described in subparagraph (ii) above shall be EIGHT MILLION DOLLARS (U.S. $8,000,000.00).

2.13.1 Subject to Paragraph 2.15 below, no additional capital stock may be issued by Corporation other than by the mutual written consent of Kirin and Amgen. The Parties hereto shall meet no less frequently than annually following the formation of Corporation to determine its capital needs and the business and Development Program for the next succeeding year.

2.13.2 In the event that the initial capital contributions to Corporation pursuant to Paragraph 2.11 above (together with interest earned by Corporation on the cash so contributed) are insufficient to fund the activities of Corporation and the Development Program until such time as all approvals (governmental or otherwise) have been obtained for the manufacture and sale of EPO Products in the Field of Activity in the Kirin Territory and the Amgen Territory (as defined in Paragraph 13 below), then in such event, Kirin and Amgen may, but shall not be obligated to, agree to make additional capital contributions to Corporation. Any such agreed upon capital contributions shall be made in the proportion to which each Party's total capital contribution bears to the

aggregate capital contributions of Kirin and Amgen, from time to time existing. Upon written notification by Corporation's Board of Directors to Kirin and Amgen that Corporation does not have sufficient capital to complete the development of the EPO Technology and to accomplish the business purposes of Corporation as contemplated by this Agreement, Kirin and Amgen shall promptly meet with management of Corporation to ascertain the amount of funding reasonably required by Corporation under the circumstances. Kirin and Amgen shall thereafter enter into a mutually acceptable agreement with respect to such additional capital contributions, if any.

Except as otherwise specifically provided in this Agreement, neither Kirin nor Amgen shall have the right to withdraw or to demand a return of all or any part of its capital contribution.

To the extent that either Kirin or Amgen fails to contribute its proportionate share of the additional capital called for under Paragraph 2.13 above, then from and after the date such capital was to have been contributed to Corporation, the shareholding percentages of Kirin or Amgen shall promptly be adjusted by Corporation to reflect the increase in capital contributed by either Kirin or Amgen such that the shareholding interest of Kirin and Amgen shall accurately reflect the percent-

age of each Party's total Capital contribution as it bears to the aggregate capital contributions of both Kirin and Amgen.

Legal title to any and all property of Corporation shall be taken and at all times held in the name of "Kirin-Amgen, Inc."

2.17.1 The "Conversion Event" shall occur when the EPO Organisms produce biologically active EPO in sufficient levels, as set forth below, which Kirin can reasonably verify within thirty (30) days after receiving written notice of the attainment thereof, to enable Corporation to conduct pre-clinical studies in the E. Coli (50 mg EPO/1), Mammalian (50 Units EPO/ml), or Yeast Cell (50 mg EPO/1) systems, both in Japan and in the United States.

2.17.2 The occurrence of the Conversion Event as set forth in Paragraph 2.17.1 above, shall give rise to the automatic conversion of all of Kirin's Class B Common Stock into Class A Common Stock on a share-for-share basis. All Class B Common Stock shall thereafter be promptly cancelled, the Articles amended, and only one class of common stock (to be designated common stock) of Corporation shall thereafter be issued and outstanding.

The Closing hereunder shall take place at the offices of Musick, Peeler & Garrett, One Wilshire Boulevard, Suite 2000, Los Angeles, California 90017, USA, at 1:00 p.m. Pacific Daylight Time on June 15, 1984 ("Closing" and the "Closing Date"), or such other date and/or place as shall be mutually agreed to by Kirin and Amgen.

At the Closing, each Party shall deliver such documents, instruments and materials as are called for by this Agreement or as may be reasonably required in order to carry out the provisions and purposes hereof, all of which shall be satisfactory in substance and form to legal counsel for each Party. Without limitation as to the foregoing and in addition to the various documents, instruments and agreements contemplated in Paragraphs 8 and 9 below, the Parties agree that, upon the request of any Party, each of them will from time to time after the Closing Date execute, acknowledge and deliver or cause to be so done, at their expense, any and all such further documents and instruments as may be reasonably required for carrying out the purposes of this Agreement. Simultaneously with such delivery and Closing, all steps shall be taken as may be reasonably required to put

Corporation in actual possession and operating control of the Transferred Technology.

5. REPRESENTATIONS AND WARRANTIES OF AMGEN

To induce Kirin to enter into this Agreement, Amgen represents and warrants to Kirin as of the date hereof as follows:

Amgen is a corporation duly organized, validly existing and in good standing under the laws of the State of California and has all requisite power and authority to: (i) own its assets to be conveyed in connection with this Agreement; (ii) lawfully carry on its business as now being conducted; and (iii) to make, execute, deliver and perform this Agreement and all contracts -and documents to be executed in connection herewith.

This Agreement has been duly authorized and, prior to the Closing Date, will be approved by all necessary corporate action of Amgen and will be a valid and legally binding obligation of Amgen in accordance with its terms.

Neither execution or delivery of this Agreement, the contracts and instruments to be executed in connection herewith, nor its performance by Amgen will conflict with, violate or

result in a breach of any term, condition or provision of, nor constitute a material default under, or result in the acceleration of any material obligation under, or permit the termination of any indenture, material contract or other material agreement to which Amgen is a party or by which Amgen or its properties is subject or bound; nor will such execution, delivery or performance by Amgen conflict with or violate the provisions of any judgment, decree, order to which Amgen is subject or Amgen's restated Articles of Incorporation or Bylaws, or to the best of its knowledge, any law or regulation.

Amgen has valid legal title in and to all of the assets to be transferred and/or licensed to Corporation on the Closing Date pursuant to the Amgen Assignment, including but not limited to, the Transferred Technology, the Core Technology, free and clear of all security interests, liens, charges and encumbrances whatsoever, and to the best of Amgen's knowledge, tax or other inchoate liens. Amgen owns and has the right to use the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date. To the best of Amgen's knowledge: (i) the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date do not conflict with the rights of others; (ii) there are no infringements by third parties of any letters patent or patent applications which are part of the Transferred Technology and Core Technology in exis-

tence as of the date hereof and to be in existence as of the Closing Date; and
(iii) Amgen's operations and business as conducted as of and prior to the Closing Date with respect to patent applications which are part of the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date do not infringe upon the rights of any person and/or entity not a Party hereto. No right, privilege, permission or license, express or implied, under the Transferred Technology or Core Technology in existence as of the date hereof and to be in existence as of the Closing Date, has been granted or is in force pursuant to which any party, other than Corporation, Kirin or Amgen, may make, have made, use or sell any Transferred Technology or Core Technology in existence as of the date hereof and to be in existence as of the Closing Date. No claims have been asserted by any person relating to the EPO Technology in existence as of the date hereof and to be in existence as of the Closing Date or challenging or questioning the validity or effectiveness of any license or agreement related thereto, and there is no valid basis for any such claim.

Amgen is not in violation of any applicable ordinance or statute, or, to the best of its knowledge, any law or regulation, with respect to its ownership and operation of the Transferred Technology and Core Technology in existence as of the date hereof and to be in existence as of the Closing Date, nor has it received any notices or citations from any public or

quasi-public authority in respect thereto, including but not limited to, the Food and Drug Administration.

Amgen is not a party to any pending or threatened suit, action or legal, administrative, arbitration or other proceeding which might materially and adversely affect the business of Corporation, the Transferred Technology or the Core Technology, in existence as of the date hereof or to be in existence as of the Closing Date, or the transactions contemplated by this Agreement, nor does Amgen know of any facts which are likely with the passage of time to give rise to such a suit, action or proceeding.

No representation or warranty of Amgen, nor any exhibit, document, statement, certificate or schedule furnished to Kirin pursuant hereto or in connection with the transactions contemplated hereby, contains any untrue statement of a material fact, or omits to state a material fact necessary to make statements or facts contained therein not misleading. The representations and warranties of Amgen set forth in this Agreement and in any exhibit, document, statement, certificate or schedule furnished or to be furnished pursuant hereto shall be true on and as of the Closing Date as though such representations and warranties were made on and as of Closing Date.

To induce Amgen to enter into and perform this Agreement, Kirin represents and warrants to Amgen as of the date hereof as follows:

Kirin is a corporation duly organized and validly existing and in good standing under the laws of the country of Japan and has all requisite power and authority to lawfully carry on its business as now being conducted and to make, execute, deliver and perform this Agreement and all instruments and documents to be executed in connection herewith.

This Agreement has been duly authorized and, prior to the Closing Date will be approved by all necessary corporate action of Kirin and will be a valid and legally binding obligation of Kirin in accordance with its terms.

Neither execution or delivery of this Agreement, the contracts and instruments to be executed in connection herewith, nor its performance by Kirin will conflict with, violate or result in a breach of any term, condition or provision of, nor constitute a material default under, or result in the acceleration of any material obligation under, or permit the termination of any indenture, material contract or other material agreement to which Kirin is a party or by which Kirin or its properties is

subject or bound; nor will such execution, delivery or performance by Kirin conflict with or violate the provisions of any judgment, decree, order to which Kirin is subject or Kirin's Bylaws, or to the best of its knowledge, any law or regulation.

Kirin is not in violation of any applicable ordinance or statute, or to the best of its knowledge, any law or regulation, nor has it received any notices or citations from any public or quasi-public authority in respect thereto.

Kirin is not a party to any pending or threatened suit, action or legal, administrative, arbitration or other proceeding which might materially and adversely affect the transactions contemplated by this Agreement, nor does Kirin know of any facts which are likely with the passage of time to give rise to such a suit, action or proceeding.

No representation or warranty of Kirin, nor any exhibit, document, statement, certificate or schedule furnished or to be furnished to Amgen pursuant hereto or in connection with the transactions contemplated hereby, contains or will contain any untrue statement of a material fact, or omits or will omit to state a material fact necessary to make statements or facts contained therein not misleading. The representations and warranties of Kirin set forth in this Agreement and in any

exhibit, document, statement, certificate or schedule furnished or to be furnished pursuant hereto shall be true on and as of the Closing Date as though such representations and warranties were made on and as of Closing Date.

All of the obligations of Kirin under this Agreement are subject to the fulfillment, at or prior to the Closing Date, of each of the following conditions:

8.01 No Misrepresentations

Kirin shall not have discovered any material error, misstatement or omission in the representations and warranties made by Amgen in Paragraph 5 above.

8.02 Compliance with Agreement

Amgen shall have performed and complied with all agreements, covenants and conditions required by this Agreement prior to the Closing Date.

8.03 Delivery

Kirin shall have had delivered to it each of the following:

8.03.1 Confirmation in form and substance reasonably satisfactory to Kirin evidencing receipt of Amgen's monetary

capital contribution in the amount specified in Paragraph 2.12 above;

8.03.2 Duly executed counterpart of the Amgen Assignment effective to (i) vest valid legal title to all Transferred Technology in Corporation, and
(ii) license the Core Technology exclusively to Corporation with respect to its direct application to the Field of Activity, together with such other documents and instruments as may be necessary to effectuate the assignments and licensing contemplated by this Agreement;

8.03.3 Duly executed counterparts of the Bylaws and organizational minutes of Corporation;

8.03.4 Duly executed, validly authorized and issued, fully paid and non-assessable Class B Common Stock represented by Certificate No. 1, duly issuing twelve million (12,000,000) shares thereof to Kirin;

            8.03.5  Duly executed counterpart of the Development and Supply
Agreement;

            8.03.6  Duly executed counterparts of the Kirin/ Kirin-Amgen, Inc.

and Amgen/Kirin-Amgen, Inc. Services Agreements which are attached hereto as Exhibits "H" and "I", respectively ("Services Agreements");

8.03.7 Duly executed counterparts of the Kirin/ Kirin-Amgen, Inc. and Amgen/Kirin-Amgen, Inc. License Agreements which are attached hereto as Exhibits "J" and "K", respectively ("License Agreements"); and

            8.03.8  Opinion of Amgen's counsel (as defined in Paragraph 8.04
below).

                                      -22-

            8.04    Opinion of Counsel
                    ------------------

                    Amgen shall have delivered to Kirin an opinion of Cooley,

Godward, Castro, Huddleson & Tatum, legal counsel for Amgen, in a form satisfactory to counsel for Kirin, dated as of the Closing Date, to the effect that (i) Amgen is a corporation duly organized, validly existing and in good standing under the laws of the State of California, and Amgen has the corporate power to conduct its business where such business is now conducted and to execute and deliver the Agreement; (ii) the execution, delivery and performance of this Agreement, together with all instruments and documents executed in connection therewith, and the transactions contemplated hereby have been duly authorized and approved by the Board of Directors of Amgen; (iii) the Agreement, together with all instruments and documents executed in connection therewith, constitute valid and binding obligations of Amgen, enforceable in accordance with their terms, except as limited by bankruptcy, insolvency or other laws of general application relating to or affecting the enforcement of creditors' rights; (iv) the execution, delivery and performance by Amgen, together with all instruments and documents executed in connection therewith, and the consummation of the transactions contemplated hereby will not result in any conflict with or material breach or violation by Amgen of, or default by Amgen under, its Articles of Incorporation, Bylaws, or any judgment, decree, order, or indenture, material obligation or agreement, or other

material instrument or document of or applicable to them known to such legal counsel; and (v) the Amgen Assignment has been duly authorized, executed and delivered by and on behalf of Amgen and effectively transfers to and vests in Corporation (i) valid legal title to the Transferred Technology, and (ii) a valid license of the Core Technology, free and clear of all claims, liens, encumbrances or security interests of any kind.

In rendering the foregoing opinion, Cooley, Godward, Castro, Huddleson & Tatum may rely on opinions of other counsel, reasonably acceptable to Kirin, and, as to matters of fact, on searches of public records and certificates of officers and directors of Amgen.

No suit, action or proceeding against Amgen shall be pending or threatened before any court or governmental agency in which it is sought to restrain or prohibit or to obtain damages or other relief in connection with this Agreement or the transaction contemplated hereby.

Amgen shall have delivered to Kirin such other instruments and documents as may be, in the opinion of counsel for Kirin, reasonably necessary to effectuate the transactions contemplated by this Agreement, and all legal matters in connection with this Agreement and the transactions contemplated hereby shall have been approved by counsel for Kirin.

The waiting period described in Section 7A of the Clayton Act, 15 U.S.C.ss.18a has expired without adverse action by the Federal Trade Commission ("FTC") or Department of Justice ("DJ") of the United States, or an affirmative response has been received from the FTC or DJ which has the effect of shortening the waiting period.

9. CONDITIONS PRECEDENT TO THE OBLIGATIONS OF AMGEN

All of the obligations of Amgen under this Agreement are subject to the fulfillment, at or prior to the Closing Date, of each of the following conditions:

Amgen shall not have discovered any material error, misstatement or omission in the representations and warranties made by Kirin in Paragraph 6 above.

Kirin shall have performed and complied with all agreements, covenants and conditions required by this Agreement prior to the Closing Date.

Amgen shall have had delivered to it each of the following:

9.03.1 Confirmation in form and substance reasonably satisfactory to Amgen evidencing receipt of Kirin's monetary capital contribution in the amount specified in Paragraph 2.12 above;

9.03.2 Duly executed counterparts of the Articles, Bylaws and Organizational Minutes of Corporation;

9.03.3 Duly executed, validly authorized and issued, fully paid and non-assessable Class A Common Stock represented by Certificate No. 1, duly issuing twelve million (12,000,000) shares thereof to Amgen;

            9.03.4  Duly executed counterpart of the Development and Supply
Agreement;

            9.03.5  Duly executed counterparts of the Services Agreements;

            9.03.6  Duly executed counterparts of the License Agreements; and

            9.03.7  Opinion of Counsel to Kirin (as defined in Paragraph 9.04
below).

Kirin shall have delivered to Amgen an opinion of Musick, Peeler & Garrett, legal counsel for Kirin, in a form satisfactory to counsel for Amgen, dated as of the Closing Date, to the effect that (i) Kirin is a corporation duly organized, validly existing and in good standing under the laws of Japan and Kirin has the corporate power to conduct its business where such

business is now conducted and to execute and deliver the Agreement; (ii) the execution, delivery and performance of this Agreement, together with all instruments and documents executed in connection therewith, and the transactions contemplated hereby have been duly authorized and approved by the Board of Directors of Kirin; (iii) the Agreement, together with all instruments and documents executed in connection therewith, constitute valid and binding obligations of Kirin, enforceable in accordance with their terms, except as limited by bankruptcy, insolvency or other laws of general application relating to or affecting the enforcement of creditors' rights; and (iv) the execution, delivery and performance by Kirin, together with all instruments and documents executed in connection therewith, and the consummation of the transactions contemplated hereby will not result in any conflict with or material breach or violation by Kirin of, or default by Kirin under, its Articles of Incorporation, Bylaws, or any judgment, decree, order, or indenture, material obligation or agreement, or other material instrument or document of or applicable to them known to such legal counsel.

In rendering the foregoing opinion, Musick, Peeler & Garrett may rely on opinions of other counsel, reasonably acceptable to Amgen, and, as to matters of fact, on searches of public records and certificates of officers and directors of Kirin.

No suit, action or proceeding against Kirin shall be pending or threatened before any court or governmental agency in which it is sought to restrain or prohibit or to obtain damages or other relief in connection with this Agreement or the transaction contemplated hereby.

Kirin shall have delivered to Amgen such other instruments and documents as may be, in the opinion of counsel for Amgen; reasonably necessary to effectuate the transactions contemplated by this Agreement, and all legal matters in connection with this Agreement and the transactions contemplated hereby shall have been approved by counsel for Amgen.

The respective representations and warranties of Kirin and of Amgen shall survive the Closing and continue in full force and effect for a period thereafter equal to the earlier of (i) five (5) years following the Closing Date, or (ii) four (4) years after the Conversion Event.

Amgen shall indemnify and hold Kirin, Corporation and their respective directors, officers, employees and agents harm-

less from and against any and all claims, liabilities, losses, costs, damages and expenses, including costs of investigation, court costs, reasonable attorneys' fees, to which any of them may become subject arising from or in any manner connected with, directly or indirectly, any material misstatement, error or omission in any representation or warranty of Amgen contained in this Agreement (without effect upon Amgen's liability under the various instruments and documents to be executed in connection herewith). Kirin agrees to indemnify Amgen, Corporation and their respective directors, officers, employees and agents, to the same extent that Kirin is being indemnified pursuant to the immediately preceding section.

The Party seeking indemnification hereunder ("Indemnified Party") shall give written notice to the indemnifying party or parties ("Indemnifying Party") of its indemnification claims hereunder, specifying the amount and nature of the claim, and giving the Indemnifying Party the right to contest any such claim represented by counsel of its choice; if any such claim is made hereunder by the Indemnified Party and such claim arises from the claims of a third party against the Indemnified Party and the Indemnifying Party does not elect to undertake the defense thereof by written notice within fifteen (15) days after receipt of the original notice from the Indemnified Party, the Indemnified Party shall be entitled to indemnity pursuant to the

terms of this Agreement to the extent of its payment in respect of such claim. To the extent that the Indemnifying Party undertakes the defense of such claim in good faith by proceeding diligently at its expense, and without materially impairing the financial conditions or operations of the Indemnified Party, the Indemnified Party shall be entitled to indemnity hereunder only if, and to the extent that, such defense is unsuccessful as determined by a final judgment of a court of competent jurisdiction or is settled with the consent of the Indemnifying Party. The Party defending a third party claim shall have the right to choose its own counsel.

Each of the Parties represents and warrants that it has dealt with no broker or finder in connection with any of the transactions contemplated by this Agreement, and, insofar as it knows, no broker or other person is entitled to any commission or finder's fee in connection with any of these transactions. The Parties hereto each agree to indemnify and hold harmless one another against any loss, liability, damage, cost, claim, or expense, including reasonable attorneys' fees, incurred by reason of any brokerage, commission, or finder's fee alleged to be payable because of any act, omission, or statement of the Indemnifying Party.

Corporation shall be managed by a Board of Directors consisting initially of six (6) members. Kirin and Amgen shall each have the right to nominate three (3) members of the Board of Directors. In the event of a default in the payment of any additional capital contribution, as described in Paragraph 2.15 above, the authorized number of members of the Board of Directors shall be increased to seven (7) and four (4) of such members shall be nominees of the non-defaulting party. The number of members of the Board of Directors cannot be decreased or otherwise increased without the mutual written consent of Kirin and Amgen. All actions by the Board of Directors shall require the affirmative vote of a majority of the total members of Board of Directors at a meeting at which a quorum is present, except for such actions as to which a higher than majority vote is required pursuant to the provisions of this Agreement, the Articles, the Bylaws or applicable law.

Corporation shall have a Chairman of the Board, a President, Vice President - Amgen, Vice President - Kirin, a Secretary, an Assistant Secretary, a Chief Financial Officer and such other officers with such titles and duties as the Board of Directors may determine. Any two or more offices may be held by

the same person. The Chairman of the Board, the Vice President - Kirin, the Chief Financial Officer and the Assistant Secretary shall be nominees of Kirin. The President, the Vice President - Amgen and the Secretary shall be nominees of Amgen.

In addition to any other items referred to in this Agreement requiring consent of both of Kirin and Amgen, none of the following actions shall be permitted to be taken by Corporation unless it shall have obtained the consent of both Kirin and Amgen:

(i) The entry by Corporation into any business outside the Field of Activity;

(ii) Any lending or borrowing of money by Corporation;

(iii) The acquisition, mortgage, pledge, sale, assignment, transfer, or other disposition of any property of Corporation having a fair market value in excess of ONE HUNDRED THOUSAND DOLLARS (US $100,000.00) by Corporation (other than in connection with the sale of products and services in the ordinary course of its business) or of any interest (regardless of value) in the legal or beneficial ownership of any other corporation or enterprise;

(iv) The adoption of a business plan, annual capital, operating and development plans and budgets,

including any material modification thereof pursuant to Paragraph 12.07 below ("Business Documents");

(v) Any capital expenditure in excess of ONE HUNDRED THOUSAND DOLLARS (US $100,000.00) by Corporation; and

(vi) Any material act in material contravention of this Agreement.

Kirin and Amgen shall cause the management of Corporation to conduct the business of Corporation at all times in accordance with high standards of business ethics and to maintain Corporation's accounts in accordance with generally accepted accounting principles consistently applied and, specifically, to:

(i) Maintain full and accurate books, records, and accounts which shall, in reasonable detail, accurately and fairly reflect all transactions of Corporation; and

(ii) Devise and maintain a system of internal accounting controls sufficient to provide reasonable assurances that (a) transactions are executed in accordance with general or specific authorizations, and (b) transactions are recorded as necessary to permit preparation of financial statements in conformity with generally accepted accounting principles, all tax returns and to maintain accountability for assets.

Kirin and Amgen shall cause the management of Corporation to:

(i) Present Business Documents to the Board of Directors and Kirin and Amgen for approval;

(ii) Make available to all members of the Board of Directors together with Kirin and Amgen on a regular basis, and as reasonably requested, all such information and/or documents as may be required to permit the Board of Directors and/or Kirin and Amgen, as the case may be, to make informed judgments with respect to such Business Documents and all other matters of interest to them;

(iii) Prior to March 15 of each Corporate Year, provide to Kirin and Amgen regular annual audited financial statements by Corporation's independent certified public accountants which shall include a statement of profits and losses, changes in financial position and a balance sheet for the year then ended, and including such other appropriate financial information reasonably requested by the Parties; and

(iv) Cause to be prepared all federal, state and local tax returns of Corporation ("Returns").

All funds of Corporation shall be deposited in the name of Corporation in such bank account or accounts as shall be determined by mutual agreement of Kirin and Amgen. All withdrawals therefrom shall be made upon checks signed on behalf of Corporation by any one officer, except for (i) amounts in excess of FIVE THOUSAND DOLLARS (US $5,000.00), and (ii) any payments to be made to Kirin and/or Amgen, in which case all such checks shall require the signature of one (1) Kirin officer and one (1) Amgen officer. The Parties hereto shall not make deposits in or issue any checks against the Corporation bank account(s) without full, proper and complete supporting records.

Kirin and Amgen agree to cause Corporation at all times to be conducted as an independent enterprise for profit. Except as otherwise provided herein, all commercial transactions between Corporation and Kirin and/or Amgen (or their affiliates) shall be conducted on an arm's-length basis with neither granting to the other terms or conditions more favorable than would be accorded non-related third-parties, except as Kirin and Amgen may otherwise mutually agree prior to such transaction.

The officers and directors of Corporation will serve in their respective positions for no compensation or remuneration whatsoever.

Kirin, Amgen, the officers and members of the Board of Directors of Corporation shall all have the fiduciary responsibility for the safekeeping and use of all funds and assets (including records) of Corporation, whether or not in immediate possession or control, for the exclusive benefit of Corporation and its shareholders.

Kirin and Amgen may engage in or possess an interest in other business ventures of any nature or description, independently or with others, whether presently existing or hereafter created, other than for the purpose of development, manufacture, production and sale of EPO Products.

Kirin and Amgen agree that, except as specifically authorized by the respective License Agreements, they shall not, directly or indirectly, nor shall they permit any of their respective subsidiaries or affiliates, as applicable, to engage in any business of a substantially similar nature to the business of Corporation in the Field of Activity for a period of twenty (20) years from and after the Closing Date, anywhere throughout the world, it being acknowledged that the business of Corporation shall be worldwide.

As more fully set forth in those certain License Agreements, Kirin and Amgen agree that:

(i) Kirin will have an exclusive right to manufacture and sell EPO Products in the Field of Activity in the territory composed of the country of Japan ("Kirin Territory") pursuant to the Kirin License Agreement and in no other territory without the prior written consent of Amgen and Corporation.

(ii) Amgen will have an exclusive right to manufacture and sell EPO Products in the Field of Activity in the territory composed of the fifty
(50) states of the United States of America, including the District of Columbia and U.S. territories and possessions ("Amgen Territory") pursuant to the Amgen License Agreement and in no other territory without the prior written consent of Kirin and Corporation.

(iii) The Parties agree that Corporation may license one (1) other entity in addition to Kirin and Amgen for the manufacture of EPO Products in the Field of Activity outside of the Amgen Territory and Kirin Territory and may license other entities in addition to Kirin and Amgen for the marketing of EPO Products in the Field of Activity outside of the Amgen Territory and Kirin Territory (that area of the world outside of the Amgen Territory and Kirin Territory is herein referred to as

"Corporation Territory"); provided, however, that the Parties may mutually agree to amend this Agreement and the appropriate License Agreement at any time to permit Kirin and/or Amgen to manufacture and sell EPO Products in the Field of Activity in parts of Corporation Territory. The rights of Corporation to grant further licenses as set forth above shall not be diminished thereafter with respect to the remainder of Corporation Territory.

As more fully set forth in the Development and Supply Agreement, Kirin and Amgen agree to conduct on behalf of Corporation, on an accelerated and coordinated basis, development, toxicology, dosage studies, pre-clinical studies, clinical trials and/or product registration for the purpose of securing all approvals (governmental or otherwise) necessary for Kirin and Amgen to engage in the Field of Activity and manufacture and sell EPO Products in their respective territories. Corporation will retain responsibility for (and with the consent of both Kirin and Amgen may enter into agreements similar to those contemplated hereunder) the conduct of toxicology, dosage studies, pre-clinical studies, clinical trials and product registration for the purpose of securing all approvals (governmental or otherwise) necessary for Corporation to engage in the Field of Activity and manufacture and sell EPO Products in the Corporation Territory.

As more fully set forth in those certain Service Agreements, Kirin and Amgen agree that each will provide certain services to Corporation in order to promote the business of Corporation in the Field of Activity.

Corporation will be owned on the Closing Date by two (2) entities which have the compatability and financial stability which are major elements contributing toward the prospect of the future success of Corporation. Except in accordance with the terms of this Agreement, neither Kirin nor Amgen shall sell, transfer, assign, pledge, hypothecate or in any other way dispose of or encumber, voluntarily or involuntarily, by bankruptcy, operation of law or otherwise (any such event is referred to as a "Transfer") any of its shares or any right or interest therein without the prior written consent of the other ("Nontransferring Shareholder"). Unless such prior written consent is given, the proposed transfer may not take place, and any attempted Transfer in derogation hereof shall be deemed null and void. If for any reason any clause or provision of this Paragraph 14.01 should be held unenforceable, invalid or in violation of law by any court or tribunal, then the Nontransferring Shareholder shall have the

right, exercisable in writing within ninety (90) days of the date of final determination of invalidity or unenforceability, to purchase all of the shares of the transferring shareholder pursuant to the terms of Paragraph 14.03 below which such transferring shareholder purported to Transfer.

Upon the occurrence of any of the following events with respect to Kirin or Amgen ("Occurrence Shareholder") (wherein there is not a continuity of proprietary interest of the Shareholders of Kirin or Amgen who owned shares of Kirin or Amgen, as the case may be, prior to the occurrence of such an event):
(i) any transfer of substantially all of its assets, (ii) any transfer of more than fifty percent (50%) of the duly issued and outstanding stock, (iii) a liquidation, dissolution, merger, consolidation or reorganization, or (iv) any insolvency or bankruptcy proceeding, the Party which is not involved with such an occurrence, shall have the right, exercisable in writing within sixty (60) days after the later of (a) receipt of written notice of such occurrence, or (b) the conclusion of the appraisal contemplated in Paragraph 14.03 below, to purchase all of the shareholding interest in Corporation which is held directly or indirectly by the Occurrence Shareholder pursuant to the terms of Paragraph 14.03 below. The Occurrence Shareholder shall notify the other Party in writing of any occurrence described above in this Paragraph 14.02 at the very earliest time practicable.

For purposes of Paragraphs 14.01 and 14.02 above, the purchase price to be paid for each share of the Transferring or Occurrence Shareholder shall be computed as follows:

(ii) After the occurrence of the Conversion Event, and within sixty (60) days after the occurrence of an event described in Paragraphs 14.01 or 14.02 above, Kirin and Amgen either (a) shall jointly appoint an investment banking firm, or (b) failing this joint action, each separately shall designate an investment banking firm and, within thirty (30) days after their appointment, the designated investment banking firms shall designate an investment banking firm which shall make the final determination of value ("Neutral Investment Banker"). The failure by either Kirin or Amgen to appoint an investment banking firm within the time allowed shall be deemed equivalent to appointing the other Party's investment banking firm as the Neutral Investment Banker. Within sixty
(60) days after the

appointment of the Neutral Investment Banker, the Neutral Investment Banker shall render its appraisal of the fair market value of shares being purchased, which appraisal shall be binding and conclusive. Corporation shall bear all appraisal expenses.

(iii) The payment date of the purchase price pursuant to this Paragraph 14 shall not be later than sixty (60) days after the sixty (60) day period set forth in Paragraph 14.02 above.

Any purchase of shares pursuant to this Agreement shall take place on the payment date thereof. The certificates representing all of the shares so purchased shall be duly endorsed and delivered to the purchaser(s) thereof on the payment date.

In the event Kirin and/or Amgen acquire any additional shares of Corporation, then any and all such shares shall be subject to the terms and provisions of this Agreement.

Upon the execution of this Agreement, the certificates of stock subject hereto shall be endorsed to read as follows:

"Any sale, assignment, transfer, pledge, bequest or other disposition of the shares of stock represented by this Certificate is restricted by and subject to the terms and provisions of a Shareholders' Agreement dated May 11, 1984 by and among this Corporation, Kirin and Amgen, a copy of which Agreement is on file in the principal office of this Corporation, which Agreement may from time to time hereafter be amended. The shares of stock evidenced by this Certificate have not been registered with the Securities and Exchange Commission, but have been issued pursuant to the private offering exemption under the Securities Act of 1933, as amended." All certificates of stock hereafter issued to or transferred to Kirin and Amgen shall bear the same endorsement.

17. [INTENTIONALLY OMITTED]

Kirin and Amgen shall each bear and pay for their respective costs and expenses regarding the negotiation and preparation of this Agreement and all documents, instruments and agreements related thereto. The actual out-of-pocket cost to form Corporation shall be reimbursed by Corporation to Musick, Peeler &

Garrett promptly after the Closing Date. Costs and expenses incurred by Corporation after the Closing Date shall be paid by Corporation.

The Parties hereby agree that any Technical Data (as that term is defined in Section 379.1 of the U.S. Export Administration Regulations) exported from the United States pursuant to this Agreement and any other related agreements, and any direct product thereof, shall not be shipped, either directly or indirectly, to Afghanistan or any Group P, Q, S, W, Y or Z Countries (as specified in Supplement No. 1 to Part 370 of the Export Administration Regulations), unless (i) separate specific authorization to reexport such Technical Data or such direct products is provided by the U.S. Office of Export Administration or (ii) such specific authorization is not required pursuant to Part 379.8 of the U.S. Export Administration Regulations. The Parties further agree that the export and reexport of commodities pursuant to this Agreement and any other related agreements shall be subject to the licensing requirements of the U.S. Export Regulations.

In the event that a specific authorization of, or a validated license from, a government other than that of the

exporting party is required, Kirin and Amgen each agree that the Party, including (if applicable) Corporation, within the jurisdiction of such other government shall, upon the request of the Party proposing to make the export, use its best efforts to obtain, as expeditiously as applicable, the requisite authorization or license.

Subject to the terms of Paragraph 21 below, and upon the mutual consent of Kirin and Amgen, distributions (as defined in Section 166 of the California Corporate Securities Act of 1968, as amended) of cash shall be made to Kirin and Amgen in accordance with their respective aggregate capital contributions.

(i) Corporation shall be dissolved upon the mutual written consent of Kirin and Amgen. (ii) Kirin shall have the unilateral right to cause Corporation to be dissolved if the Conversion Event does not take place on or before December 31, 1985. (iii) Corporation may be dissolved for federal and California income tax purposes, but preserved in nominal form for California state law purposes, by either Kirin or Amgen upon the

bankruptcy, receivership or insolvency of the other Party or Corporation, or upon the material breach of this Agreement by the other Party.

Upon the dissolution of Corporation, a complete and accurate accounting shall be made by Corporation's independent certified public accountants from the date of the last previous accounting to the date of dissolution and all required tax returns shall be timely filed in connection therewith.

Upon the dissolution of Corporation, Kirin and Amgen shall each appoint three (3) individuals who shall jointly act as liquidator to wind up Corporation (collectively "Liquidator"). The Liquidator shall have full power and authority to take full account of Corporation's assets and liabilities and to wind up and liquidate the affairs of Corporation in an orderly and business- like manner as is consistent with obtaining the fair value thereof upon dissolution. Corporation shall engage in no further business thereafter other than as necessary to operate on an interim basis, collect its receivables, pay its liabilities and liquidate its assets. All proceeds from liquidation shall be distributed in the following order of priority: (i) first, to the payment of all creditors of Corporation and the expenses of liquidation; (ii) second, to the establishing of a reserve which the Liquidator deems reasonably necessary for any contingent,

known or unforeseen liabilities or obligations of Corporation; and (iii) third, the balance:

(a) If prior to the occurrence of the Conversion Event, first to Kirin an amount of cash equal to the original price paid to Corporation for its shares upon initial issuance, i.e., ONE DOLLAR (US $1.00) per share, plus three-fourths (3/4ths) of the aggregate interest income earned by Corporation from the Closing Date to the date of such liquidation distribution. Kirin and Amgen agree that Corporation shall not spend more than FOUR MILLION DOLLARS (US $4,000,000.00) prior to the occurrence of the Conversion Event, unless otherwise mutually agreed to in writing.

(b) If after the occurrence of the Conversion Event, Corporation's net assets shall be valued in accordance with the appraisal mechanism set forth in Paragraph 14.03(ii) above. Thereafter, the net assets of Corporation shall be divided between Kirin and Amgen in approximately equal value at the direction of the Neutral Investment Banker.

Upon the completion of the distributions in liquidation of Corporation as provided in this Paragraph 21, Liquidator shall cause the cancellation of all share certificates and shall take such other actions as may be appropriate to finally dissolve and liquidate Corporation.

All notices, requests, demands and other communications required or permitted to be given under this Agreement shall be in writing and shall be mailed to the Party to whom notice is to be given, by telex or facsimile, and confirmed by first class mail, registered or certified, return receipt requested, postage prepaid, and properly addressed as follows (in which case such notice shall be deemed to have been duly given on the third (3rd) day following the date of such sending):

"Kirin"             Kirin Brewery Company, Limited
                    26-1, Jingumae 6-Chome
                    Shibuya-Ko, Tokyo 150
                    Japan
                    Telex No. 242-5401 Kirin B J
                    Attn: General Manager of R&D Department
With a copy to:     Musick, Peeler & Garrett
                    One Wilshire Boulevard
                    Suite 2000
                    Los Angeles, CA 90017
                    U.S.A.
                    Telex No. 701357 (MPG LAW UD)
                    Attn:  Joel S. Marcus, Esq.
"Amgen"             Amgen
                    1900 Oak Terrace Lane
                    Thousand Oaks, CA 91320
                    U.S.A.
                    Telex No. 4994440 (AMGEN)
                    Attn: Corporate Secretary

                                 -48-

With a copy to:          Cooley, Godward, Castro,
                           Huddleson & Tatum
                    One Maritime Plaza, 20th Floor
                    San Francisco, CA 94111
                    U.S.A.
                    Telex No. 910-372-7370 Cooley SFO
                    Attn: Alan C. Mendelson, Esq.
"Corporation"       Kirin-Amgen, Inc.
                    1900 Oak Terrace Lane
                    Thousand Oaks, CA 91320
                    U.S.A.
                    Telex No. 4994440 (AMGEN)
                    Attn: Corporate Secretary
With a copy to:     Musick, Peeler & Garrett
                    One Wilshire Boulevard
                    Suite 2000
                    Los Angeles, CA 90017
                    U.S.A.
                    Telex No. 701357 (MPG LAW UD)
                    Attn: Joel S. Marcus, Esq.

Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 22.01.

All notices to third parties and all other publicity concerning the transactions contemplated by this agreement shall be jointly planned and coordinated by and between the Parties hereto.

This Agreement (together with all Exhibits attached hereto and all documents and instruments delivered in connection

herewith) constitutes the full and complete agreement and understanding between the Parties hereto and shall supersede any and all prior written and oral agreements concerning the subject matter contained herein. This Agreement may not be modified, amended nor may any provision hereof be waived without a written instrument executed by Kirin, Amgen and Corporation.

No failure or delay by any Party to insist upon the strict performance of any term, condition, covenant or agreement of this Agreement, or to exercise any right, power or remedy hereunder or thereunder or consequent upon a breach hereof or thereof shall constitute a waiver of any such term, condition, covenant, agreement, right, power or remedy or of any such breach or preclude such Party from exercising any such right, power or remedy at any later time or times.

The shares of stock of Corporation are unique and cannot be readily purchased or sold in the open market. For this reason, among others, the Parties hereto will be irreparably damaged in the event that this Agreement is not deemed to be specifically enforceable, and the Parties hereby agree that this Agreement shall be specifically enforceable. Such remedy shall be cumulative and not exclusive and shall be in addition to any other remedy which the Parties may have.

No right, power or remedy herein conferred upon or reserved to any Party is intended to be exclusive of any other right, power or remedy or remedies, and each and every right, power and remedy of any Party pursuant to this Agreement or now or hereafter existing at law or in equity or by statute or otherwise shall to the extent permitted by law be cumulative and concurrent, and shall be in addition to every other right, power or remedy pursuant to this Agreement, or now or hereafter existing at law or in equity or by statute or otherwise and the exercise or beginning of the exercise by any Party of any one or more of such rights, powers or remedies shall not preclude the simultaneous or later exercise by any Party of any or all such other rights, powers or remedies.

Headings in this Agreement are included herein for the convenience of reference only and shall not constitute a part of this Agreement for any purpose.

Any provision of this Agreement which is prohibited or unenforceable in any jurisdiction shall as to such jurisdiction be ineffective to the extent of such prohibition or unenforceability without invalidating the remaining provisions hereof or effecting the validity or enforceability of such provision in any other jurisdiction.

In the event of any action at law or in equity between the Parties hereto to enforce any of the provisions hereof, the unsuccessful party or parties to such litigation shall pay to the successful party or parties all costs and expenses, including actual attorneys' fees, incurred therein by such successful party or parties; and if such successful party or parties shall recover judgment in any such action or proceeding, such costs, expenses and attorneys' fees may be included in and as part of such judgment. The successful party shall be the party who is entitled to recover his costs of suit, whether or not the suit proceeds to final judgment. A party not entitled to recover his costs shall not recover attorneys' fees.

This Agreement shall be construed in accordance with the internal laws, and not the law of conflicts, of the State of California applicable to agreements made and to be performed in such state.

This Agreement shall be binding upon and inure to the benefit of the Parties hereto, their successors and assigns.

All exhibits attached hereto and referred to herein are hereby incorporated herein as though fully set forth at length.

Words in the singular shall include the plural, and words in a particular gender shall include either or both additional genders, when the context in which such words are used indicates that such is the intent.

This Agreement may be executed in one or more counterparts by the Parties hereto. All counterparts shall be construed together and shall constitute one agreement.

Each Party agrees to perform any further acts and execute and deliver any and all further documents and/or instruments which may be reasonably necessary to carry out the provisions of this Agreement and to carry out the business purpose of Corporation.

Each of the Parties hereto acknowledges and agrees (i) that no representation or promise not expressly contained in this Agreement has been made by any other Party hereto or by any of his or its agents, employees, representatives or attorneys; (ii) that this Agreement is not being entered into on the basis of, or in reliance on, any promise or representation, expressed or implied, covering the subject matter hereof, other than those which are set forth expressly in this Agreement; and (iii) that each has had the opportunity to be represented by counsel of its own choice in this matter, including the negotiations which preceded the execution of this Agreement.

Any Party shall be excused for failures and delays in performance of its respective obligations under this Agreement caused by war, riots or insurrections, laws and regulations (including, without limitation, imposition of export restrictions or controls), strikes, floods, fires, explosions or other catastrophes beyond the control and without the fault of such Party. This provision shall not, however, release such Party from using its best efforts to avoid or remove such cause and such Party shall continue performance hereunder with the utmost dispatch whenever such causes are removed. Upon claiming any such excuse

or delay for non-performance, such Party shall give prompt written notice thereof to the other Party.

The Parties contemplate that there may be additional opportunities for mutual development of other products or areas of interest by Corporation. At any time either Amgen or Kirin may suggest that such other opportunities be further discussed.

IN WITNESS WHEREOF, the undersigned have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding upon them.

KIRIN BREWERY COMPANY, LIMITED, a
Japanese corporation

By /s/ Shinkichi Kubo
       Shinkichi Kubo
        Its Managing Director

AMGEN, a California corporation

By /s/ George B. Rathmann
       George B. Rathmann
        Its President

KIRIN-AMGEN, INC., a California corporation

By Its

                           EXHIBIT SCHEDULE
                           ----------------
EXHIBIT    DESCRIPTION                                                 PARAGRAPH

   A       Transferred Technology........................                 1.05

   B       Assignment and License Agreement..............                 1.05

   C       Development and
             Supply Agreement............................                 1.09

   D       Articles of Incorporation.....................                 2.04

   E       Bylaws of Corporation.........................                 2.05

   F       Legal Conflicts Letter........................                 2.09

   G       Arthur Young and Company

           Engagement Letter.............................                 2.10

   H       Kirin/Kirin-Amgen, Inc

             Services Agreement..........................                 8.03.6

   I       Amgen/Kirin-Amgen, Inc

             Services Agreement..........................                 8.03.6

   J       Kirin/Kirin-Amgen, Inc

             License Agreement...........................                 8.03.7

   K   --  Amgen/Kirin-Amgen, Inc

             License Agreement...........................                 8.03.8

The Transferred Technology is embodied in at least the following documents:

(1) The ASSIGNMENT relating to U.S. Patent Application Ser. No. 561.024, filed December 13, 1983, entitled "Recombinant Methods and Materials Applied to Microbial Expression of Erythropoietin", recorded in the Patent and Trademark Office on Reel 4217, Frame 916. [And related know-how]

(2) The ASSIGNMENT relating to U.S. Patent Application Ser. No. 463.724, filed February 4, 1983, entitled "ATCC HB8209 and Its Monoclonal Antibody to Erythropoietin", recorded in the Patent and Trademark office on Reel 4110, Frame 763. [And related know-how]

[Full Description]

EXHIBIT "A"

THIS ASSIGNMENT AND LICENSE AGREEMENT ("Agreement") is made this day of , 1984, by and between AMGEN, a California corporation ("Amgen"), in favor and for the benefit of, and with KIRIN-AMGEN, INC., a California corporation ("Company") pursuant to to terms and conditions of that certain Shareholders' Agreement, dated May 11, 1984, by and among Amgen, Company and Kirin Brewery Company, Ltd., a Japanese corporation ("Shareholders' Agreement").

WHEREAS, Amgen, Kirin and the Company have entered into the Shareholders' Agreement with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);

WHEREAS, in connection with the formation of the Company and the issuance of certain Common Stock of the Company to Amgen under Section 351 of the Internal Revenue Code of 1954, as amended, Amgen is willing to transfer certain technology (the "Transferred Technology", as hereinafter defined) to the Company and license certain other technology (the "Core Technology", as

EXHIBIT "B"

hereinafter defined) to the Company for use in the Field of Activity, as hereinafter defined, all in accordance with the Shareholders' Agreement;

NOW, THEREFORE, in partial consideration (along with cash payable by Amgen to the Company) of the sale and issuance to Amgen of twelve million (12,000,000) shares of Common Stock of the Company pursuant to the Shareholders' Agreement, Amgen and the Company hereby agree as follows:

defined below, solely with respect to its direct application to the Field of Activity.

to Amgen, retroactive to such termination, any sublicenses granted hereunder by the Company to any subsidiary of the Company. The Company shall include in all its sublicenses granted hereunder to any subsidiary of the Company provisions for such termination and assignment.

authorize, cause or aid anyone else to do so. Except as provided in Section 1.03 above, nothing in this Agreement shall be deemed to give the Company any right or license to use or to replicate or reproduce any of the Core Technology owned by Amgen, or to authorize, aid, or cause others so to do.

and effect until the earlier of (a) the liquidation or dissolution of the Company, or (b) termination pursuant to Section 7.02.

survive such termination and continue in full force and effect for an indefinite term. Upon termination of this Agreement for any reason, and without limitation of other remedies, the Company shall immediately return to Amgen (to the extent such return is technically feasible) all materials relating to the Core Technology in the possession of the Company or its subsidiaries, or of which the Company shall have the right to regain possession or, at the sole election of Amgen, shall destroy such material (to the extent technically feasible).

                  Kirin-Amgen, Inc.
                  1900 Oak Terrace Lane
                  Thousand Oaks, CA 91320
                  Attn: Corporate Secretary

With a copy to:   Musick, Peeler & Garrett
                  One Wilshire Boulevard, Suite 2000
                  Los Angeles, CA 90017
                  Attn: Joel S. Marcus, Esq.

10.02 Amgen Notice. All notices to Amgen under this Agreement shall be in writing and sent to:

                       Amgen
                       1900 Oak Terrace Lane
                       Thousand Oaks, CA 91320
                       Attn: Corporate Secretary

     With a copy to:   Alan C. Mendelson, Esq.
                       Cooley, Godward, Castro,
                       Huddleson & Tatum
                       5 Palo Alto Square
                       Suite 400
                       Palo Alto, CA 94306

          10.03  Changes. The addresses given above may be changed by notice as
specified above.

          10.04  Notice Deemed Given. Notices required or permitted hereunder
                 -------------------

and sent as specified above shall be deemed given (a) immediately upon personal delivery, (b) one (1) busi-

ness day after notice given by telegram or telex, and (c) ten (10) business days after the date of posting notice, sent by registered or certified mail.

frustrated by Force Majeure. The party so affected shall give notice to the other party in writing promptly and thereupon shall be excused from such of its obligations hereunder as it is unable to perform on account of the Force Majeure throughout the duration thereof plus a period of thirty (30) days.

other or further exercise thereof or the exercise of any other right, power or remedy hereunder or the remedies provided by law.

IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their duly authorized represent-

atives in the manner legally binding on them as of the date first above written.

AMGEN, a California corporation

By

Its

KIRIN-AMGEN, INC., a California corporation

By

Its

TRANSFERRED TECHNOLOGY

Schedule "A"

THIS DEVELOPMENT AND SUPPLY AGREEMENT ("Agreement") is made this - day of -, 1984, by and among AMGEN, a California corporation, ("Amgen"), KIRIN BREWERY COMPANY, LTD., a Japanese corporation, ("Kirin"), and KIRIN-AMGEN, INC., a California corporation ("Company").

WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984 ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).

WHEREAS, Amgen has assigned to the Company, perpetually and irrevocably, certain current proprietary technology possessed by Amgen relating specifically to EPO;

EXHIBIT "C"

WHEREAS, the Company desires to have Amgen and Kirin conduct further development work with respect to the improvement and commercial development of the EPO Technology, as hereinafter defined, and Amgen and Kirin desire to conduct such development work;

WHEREAS, Amgen's and Kirin's research and development work within and without the Development Program (as hereinafter defined) may provide certain EPO Technology as hereinafter defined, relating to and useful in the Field of Activity;

WHEREAS, Amgen, Kirin and the Company wish to provide for a means by which they can jointly utilize the fruits of their activities in the Field of Activity;

WHEREAS, the work to be conducted hereunder may require materials, including the EPO Organisms (as hereinafter defined), which may be developed or have previously been developed by Amgen, and Amgen is willing to furnish such materials to the Company, the Company is willing to furnish such materials to Kirin, and the Company and Kirin desire to receive such materials.

NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:

ARTICLE I

ARTICLE II

(a) Amgen and Kirin hereby agree to conduct on behalf of the Company, on an accelerated and coordinated basis, development, toxicology, dosage studies, pre-clinical studies, clinical trials and product registration for the purpose of securing all approvals (governmental or otherwise) necessary for the Parties to engage in the Field of Activity and manufacture and sell EPO in their respective Territories, as defined in the Shareholders' Agreement. During the Term of Support, Amgen and

Kirin shall each make reasonably available to the Company its technical personnel and facilities required to perform such scientific and development projects relating to the Field of Activity as the Company requests and as Amgen and Kirin may agree from time to time. Amgen and Kirin may each have others perform or assist in performing the work under the Development Program; provided, however, that Amgen and Kirin shall cause such other parties to be bound by all the provisions hereof as if they were parties hereto.

(b) Amgen hereby agrees to use its best efforts to complete, as part of the Development Program, the development of commercial manufacturing scale production of EPO in one Expression System; provided, however, that Amgen may conduct work as part of the Development Program on the development of more than one of such Expression Systems and shall be compensated by the Company for all such work hereunder.

(c) Compensation for development work to be performed by Amgen shall be paid in accordance with the provisions of-Section 2.03 hereof.

(d) Notwithstanding the foregoing, no research performed by Amgen in developing the EPO Organisms shall be considered to be part of, or be compensated under, the Development Program pursuant to this Agreement, unless otherwise mutually agreed by Amgen and Kirin.

agreed to. Amgen and Kirin shall each prepare and supply to the Company written progress reports at the end of each three (3) month period. Each Party shall consult with the other Parties from time to time on the progress of the development projects and shall permit any other Party to visit its laboratories to observe the development work, to the extent reasonably required to coordinate and effectively conduct related development work. The Development Program shall initially be conducted with respect to the Field of Activity; provided, however, that the Parties may mutually agree upon additional activities and projects to be carried out in the Development Program.

commencing January 1, 1985 not later than the 31st day of January of each such year. At the end of each calendar month Amgen and Kirin shall each submit a written statement to the Company setting forth the number of man hours of work performed by such Party during such calendar month. Upon receipt of such statement and after-a reasonable period to allow for review thereof, the Company shall promptly pay Amgen and Kirin an amount equal to the total costs incurred by such Party in conducting the development projects for such month. Amgen and Kirin shall keep correct and complete records containing all information required for deter mination of costs to be paid hereunder for periods of not less than three (3) years and shall permit such books and records to be inspected and audited during reasonable business hours by a certified public accountant selected by the Company, to the extent necessary to verify such report. The Parties hereby acknowledge that any such work under the Development Program to be performed by Amgen and Kirin, respectively, for the Company shall be as independent contractors, and the Company shall not incur any direct obligations for the remuneration or other expenses (and relevant reporting obligations) of any employee of Amgen or Kirin by virtue of such employee's participation in the Development Program.

(a) For purposes of advancing the Development Program, Amgen and Kirin shall disclose to each other and the Company such of their respective information, including that on

inventions, relative to the Field of Activity (whether or not previously assigned or licensed to the Company by any Party hereunder and therefore already included as part of the EPO Technology) and available prior to the undertaking hereunder of the Development Program, as the disclosing Party in its reasonable discretion believes will be useful in furtherance of the Development Program and which it has the right to disclose. To further promote the purposes of the Development Program, each Party shall actively collaborate with the other Parties by disclosing to all other Parties on a regular and periodic basis such technical and other information developed by such Party as may be included in the definition of EPO Technology hereunder and the Company authorizes such disclosure amongst the Parties hereunder without regard to the restrictions on such disclosure which may otherwise be imposed by the License Agreements and this Agreement. In order to further facilitate the effective commercial development, registration, manufacture and marketing of EPO within the Field of Activity, the Parties shall permit representatives of any other Party to inspect its facilities and all technical reports, memoranda and other documents directly relating to the Development Program, and to make copies of any and all such reports, memoranda and other documents; provided, however, that the rights hereunder shall not extend beyond the EPO Technology and shall be limited solely to such information that has been actually used by a Party for the production and further development of EPO. Each of Amgen and Kirin acknowledge

that any such technical and other information disclosed hereunder shall be included in the definition of EPO Technology and agree that any such technical and other information so received shall not otherwise be disclosed except as permitted by this Agreement or the aforementioned License Agreements.

(b) Upon commencement of the Development Program, Amgen agrees to supply Kirin and the Company with sufficient technical information and assistance to (i) assess the progress of its product and process development work during the course of the Development Program, and (ii) instruct and assist Kirin in utilizing its rights in the EPO Technology, and the Parties shall establish mutually agreeable development milestones which shall be reviewed no less frequently than annually during the term of the Development Program. Any technical information supplied by any Party to another hereunder shall remain confidential and shall thereafter be deemed EPO Technology for purposes hereof.

(a) Amgen shall furnish to Kirin at Kirin's request the services of personnel of Amgen or its agents, hereinafter in this Section 2.06 referred to Amgen's "personnel", to give technical assistance and information for the start-up of a manufacturing facility for EPO. Such facility shall be constructed and said EPO shall be manufactured by Kirin with the use of EPO Technology furnished to Kirin hereunder and the use of which is authorized hereunder. It will be Kirin's responsibility to provide Amgen's personnel with suitable working quarters and

adequate clerical and other assistance in order to facilitate the performance of their services.

(b) Such service shall be available to Kirin at reasonable locations and times and for reasonable intervals agreeable to Amgen.

(c) Amgen shall without charge and in addition to the provisions set forth above, provide training, relating to the subject hereof, at Amgen's plant to personnel of Kirin, at Kirin's request. Such training shall be available to Kirin, at reasonable times, and for reasonable intervals, agreeable to Amgen.

(d) Promptly after the date of this Agreement, Amgen and Kirin shall each appoint an employee to administer activities and performance under this Section 2.05 and will notify each other of the name, address and telephone number of such employee. All requests for services under this Section 2.05 and arrangements for providing services will be coordinated by such appointed employees.

(e) Amgen and Kirin shall at all times retain the administrative supervision of their respective personnel.

(f) Kirin shall pay to Amgen for the work performed pursuant to Sections 2.04 (b) and this Section 2.05, including travel time outside of the Continental United States, at the rate determined in accordance with the provisions of Section 2.03 hereof. Kirin shall also reimburse Amgen for actual

expenditures for travel, living and other expenses incurred by Amgen's personnel performing services under Section 2.04 (b) and this Section 2.05(f). Amgen shall render to Kirin invoices for all payments to be made under this Section 2.05, and Kirin shall make payment of all amounts so billed within thirty (30) days after date of invoice. Any information which may be disclosed to personnel of Kirin by Amgen's personnel in the course of their performance under this Section 2.05 shall be deemed to be EPO Technology furnished to Kirin.

(g) All of Amgen's obligations under this Section 2.05 shall terminate effective with any termination of the rights of Kirin pursuant to Article VI of this Agreement without affecting any of Amgen's obligations under any other Article.

ARTICLE III

connection with the Development Program. All such records shall be available to the Company at all reasonable times for examination and copying at the Company's expense.

(a) was known to the receiving Party at the time of its disclosure and not previously subject to any obligation of confidentiality;

(b) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;

(c) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through

any act or omission of the receiving Party in breach of this Agreement; or

(d) became known to the receiving Party after its disclosure (i) from a source other than the disclosing Party (including from independent development by the receiving Party),

(ii) other than from a third party who had an obligation to the disclosing Party not to disclose such information to others, and

(iii) other than under an obligation of confidentiality.

Each receiving Party may disclose any EPO Technology to the extent such disclosure is necessary to the receiving Party to comply with laws or regulations, or to make, use or sell under any license under such EPO Technology from the disclosing Party or to sublicense others to do so, provided that the Party intending to make any such disclosure shall give the other Parties reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the other parties in writing of the manner in which that was done.

it will use its best efforts to obtain (a) an agreement to disclose and assign to the Company, or its nominee or nominees, without expense to the Company, all inventions made by such employee or agent during the course of his employment or association with the Development Program, and (b) execution, acknowledgment and delivery by such employee or agent of all papers, including applications for patents, that may be necessary to obtain patents for said inventions in any and all countries and to vest title thereto in the Company (and an agreement by such employee or agent to do all acts possible to assist the Company in establishing and enforcing its aforementioned rights to such inventions).

ARTICLE IV

ARTICLE V

ARTICLE VI

within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.

ARTICLE VII

amounts of EPO for its respective use in carrying out the goals and purposes of the Development Program.

(a) The Company may, by letter, telex or other means, deliver to Amgen delivery specifications providing specific information regarding EPO which the Company is interested in obtaining. Each delivery specification shall specify: (1) quantity; (2) requested delivery schedule; (3) packaging and marking requirements; (4) method of shipment; (5) place of delivery and acceptance; and (6) any other information necessary to prepare the proposal.

(b) Amgen shall, and after delivery of each such delivery specification by the Company, furnish the Company with a written proposal providing specific information regarding items which the Company is interested in obtaining. Such proposal shall include: (i) unit and total price or fee for use for items; (ii) delivery schedule; (iii) duration of the proposal; (iv) terms and conditions regarding dissemination and use of the items; and (v) any other information, requested by the Company and deemed essential to the proposal by Amgen. Orders placed pursuant to a proposal are termed "Proposal Orders." Issuance of a Proposal Order by Amgen and receipt by Amgen of written notification of acceptance of the Proposal Order by the Company shall create a binding agreement for furnishing the items specified therein.

(c) On Proposal orders, the charges paid by the Company for items shall be those charges set forth in the proposal under which such order is being placed. Amgen shall exercise reasonable efforts to provide the Company with thirty (30) days advance notice of changes in prices and use fees for items.

(d) Charges quoted pursuant to this Article VII will be in United States dollars and invoices shall be payable in United States currency within thirty (30) days of delivery.

ARTICLE VIII

or tradenames of such Party, or of any of their respective Subsidiaries or affiliated companies.

"Kirin"                     Kirin Brewery Company, Limited
                            26-1, Jingumae 6-Chome
                            Shibuya-Ko, Tokyo 150
                            Japan
                            Telex No. 242-5401 Kirin B J
                            Attn: General Manager of R&D Department
With a copy to:             Musick, Peeler & Garrett
                            One Wilshire Boulevard
                            Suite 2000
                            Los Angeles, CA 90017
                            U.S.A.
                            Telex No. 701357 (MPG LAW UD)
                            Attn: Joel S. Marcus, Esq.

                               -21-

"Amgen"                     Amgen
                            1900 Oak Terrace Lane
                            Thousand Oaks, CA 91320
                            U.S.A.
                            Telex No. 499-9315 (AMGEN)
                            Attn: Corporate Secretary
With a copy to:             Cooley, Godward, Castro,
                               Huddleson & Tatum
                            One Maritime Plaza, 20th Floor
                            San Francisco, CA 94111 U.S.A.
                            Telex No. 910-372-7370 Cooley SFO
                            Attn: Alan C. Mendelson, Esq.
"Corporation"               Kirin-Amgen, Inc.
                            1900 Oak Terrace Lane
                            Thousand Oaks, CA 91320 U.S.A.
                            Telex No. 499-9315 (AMGEN)
                            Attn: Corporate Secretary
With a copy to:             Musick, Peeler & Garrett
                            One Wilshire Boulevard
                            Suite 2000
                            Los Angeles, CA 90017
                            U.S.A.
                            Telex No. 701357 (MPG LAW UD)
                            Attn: Joel S. Marcus, Esq.

Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 8.08.

be excused from such of its obligations hereunder as it is unable to perform on account of the Force Majeure throughout the duration there-of plus a period of thirty (30) days.

AMGEN

By
President

KIRIN BREWERY COMPANY, LTD.

By

KIRIN-AMGEN, INC.

By

1. A reliable RIA will be established to be used for, but not limited to, preclinical and clinical evaluation of EPO levels in patient's serum. Estimated cost is $200,000. Period 1984.

2. A sufficient quantity of EPO will be purified from urine. This EPO will be used as a standard for RIA, for iodination for the RIA and as reference material for comparison with EPO produced by recombinant DNA techniques. Estimated cost is $200,000. Period 1984.

3. Recombinant EPO will be prepared from mammalian cells, E.coli and yeast. The biological properties of these three preparations will be compared with urinary EPO to determine which system will be used to develop EPO as a therapeutic. Fermentation and purification costs for materials for evaluation will be paid for by the Corporation. Estimated cost is $300,000. Period 1984.

4. Properties of recombinant EPO will be compared with natural material to determine what criteria should be used for specifications of the recombinant therapeutic material. Part of this work will be paid for by the Corporation. Estimated cost is $100,000. Period 1984.

SCHEDULE "A"

5. Research to be carried out to determine feasibility of using antibody affinity columns for EPO purification. Amgen will supply antibody, Kirin will supply urinary EPO and serum, if necessary. Joint venture will pay for labor. Estimated cost is $100,000. Period 1984.

6. Process development for fermentation and purification to commercial levels will be carried out for recombinant EPO produced by E.coli. Estimated cost is $1,000,000. The estimated cost will be modified if yeast or mammalian cells are used as the production system. Period 1984-1985.

7. Studies to be carried out to determine the formulation of the final product. This will include studies on product stability, method of administration, etc. Estimated cost is $600,000. Period 1984-1985.

8. Pre-clinical tests including planning, production of samples, toxicological test and pharmacological tests. Estimated cost is $2,000,000. Period 1984-1986.

9. Clinical trials including planning, filing IND, production of samples, clinical trials, organization of clinical doctors and submission of New Drug Application. Estimated cost is $11,500,000. Period 1984-1987.

10. Phase IV study will be carried out. Cost of this study will be paid for from proceeds of commerical sales. No cost to joint venture.

ARTICLES OF INCORPORATION

OF

KIRIN-AMGEN, INC.

I.

The name of this corporation is KIRIN-AMGEN, INC.

II.

The purpose of this corporation is to engage in any lawful act or activity for which a corporation may be organized under the General Corporation Law of California other than the banking business, the trust company business or the practice of a profession permitted to be incorporated by the California Corporations Code.
III.

The name and address in the State of California of this corporation's initial agent for service of process is:

Joel S. Marcus, Esq.

Musick, Peeler & Garrett

One Wilshire Boulevard Suite 2000
Los Angeles, California 90017

IV.

The corporation is authorized to issue two classes of shares: no par value Class A Common Stock and no par value Class B Common Stock designated "Class A Common Stock" and "Class B Common Stock," respectively. The total number of shares of Class A Common Stock which this corporation is authorized to issue is twenty-four million (24,000,000) shares. The total number of shares of Class B Common Stock which this corporation is authorized to issue is twelve million (12,000,000) shares.

V.

The rights, preferences, privileges and restrictions of Class A Common Stock and Class B Common Stock shall be equal and identical in all respects except that:

EXHIBIT "D"

(a) In the event of any voluntary or involuntary liquidation, dissolution or winding up of this corporation, the holder of the issued and outstanding shares of Class B Common Stock shall be entitled to receive from the assets of the corporation, cash equal to one dollar (US $1.00) per share, plus three-quarters (3/4) of the aggregate interest earned by the corporation on such amount from the date of purchase of such shares to the date of liquidation.

(b) The shares of Class B Common Stock shall be converted into shares of Class A Common Stock on a share-forshare basis when the corporation produces biologically active EPO at such levels as are agreed upon by the holders of all of the shares of Class A Common Stock and Class B Common Stock.

VI.

(a) Any of the following actions shall require the prior approval of the holders of all of the shares of Class A Common Stock and Class B Common Stock, notwithstanding that applicable law would otherwise permit such action without such approval:

(i) The entry by the corporation into any business outside the areas of development, manufacture, production and worldwide commercial sale of EPO and EPO pharmaceuticals for human therapeutic use;

(ii) Any lending or borrowing of money by the corporation;

(iii) The acquisition, mortgage, pledge, sale, assignment, transfer, or other disposition of any property of the corporation having a fair market value in excess of one hundred thousand dollars ($100,000) by the corporation (other than in connection with the sale of products and services in the ordinary course of its business) or of any interest (regardless of value) in the legal or beneficial ownership of any other corporation or enterprise;

(iv) The adoption of a business plan, annual capital, operating and development plans, and budgets, including any material modification thereof;

(v) Any capital expenditure in excess of one hundred thousand dollars ($100,000).

(b) All actions of the Board of Directors shall require the affirmative vote of a majority of the authorized

number of Directors, notwithstanding that applicable law would otherwise permit such action without such approval.

Dated: May 11, 1984

                                                /s/ Joel S. Marcus
                                                Incorporator

                  I hereby declare that I am the person who executed the
foregoing Articles of Incorporation, which execution is my act and deed.

/s/ Joel S. Marcus

BYLAWS

OF

KIRIN-AMGEN, INC.

EXHIBIT "E"

BYLAWS OF KIRIN-AMGEN, INC.

Table of Contents

                                                                                                       Page
                                                                                                       ----
                                           ARTICLE I
                                            OFFICES

Section 1.  Principal Office...........................................................................   1
Section 2.  Other Offices..............................................................................   1

                                          ARTICLE II
                                        CORPORATE SEAL

Section 3.  Corporate Seal.............................................................................   2

                                          ARTICLE III
                            SHAREHOLDERS' MEETINGS AND VOTING RIGHTS

Section 4.  Place of Meetings..........................................................................   2
Section 5.  Annual Meetings............................................................................   2
Section 6.  Postponement of Annual Meeting.............................................................   3
Section 7.  Special Meetings...........................................................................   3
Section 8.  Notice of Meetings.........................................................................   4
Section 9.  Manner of Giving Notice....................................................................   7
Section 10. Quorum and Transaction of Business.........................................................   8
Section 11. Adjournment and Notice of
              Adjourned Meetings.......................................................................   9
Section 12. Waiver of Notice, Consent to
              Meeting or Approval of Minutes...........................................................  10
Section 13. Action by Written Consent
              Without a Meeting........................................................................  11
Section 14. Voting.....................................................................................  13
Section 15. Persons Entitled to Vote or Consent........................................................  14
Section 16. Proxies....................................................................................  16
Section 17. Inspectors of Election.....................................................................  16
                                                                                                         17

                                          ARTICLE IV
                                      BOARD OF DIRECTORS

Section 18. Powers ....................................................................................  18
Section 19. Number of Directors........................................................................  19
Section 20. Election of Directors, Term,
              Qualifications...........................................................................  19
Section 21. Resignation................................................................................  20
Section 22. Removal....................................................................................  20
Section 23. Vacancies..................................................................................  21

                                                                                                               Page
                                                                                                               ----
Section 24. Regular Meetings..................................................................................  22
Section 25. Participation by Telephone........................................................................  23
Section 26. Special Meetings..................................................................................  23
Section 27. Notice of Meetings................................................................................  23
Section 28. Place of Meetings.................................................................................  24
Section 29. Action by Written Consent
               Without a Meeting..............................................................................  24
Section 30. Quorum and Transaction of Business................................................................  25
Section 31. Adjournment.......................................................................................  25
Section 32. Organization......................................................................................  26
Section 33. Compensation......................................................................................  26
Section 34. Committees........................................................................................  26

                                              ARTICLE V
                                              OFFICERS

Section 35. Officers..........................................................................................  27
Section 36. Appointment.......................................................................................  27
Section 37. Inability to Act..................................................................................  27
Section 38. Resignations......................................................................................  28
Section 39. Removal...........................................................................................  28
Section 40. Vacancies.........................................................................................  29
Section 41. Chairman of the Board.............................................................................  29
Section 42. President.........................................................................................  29
Section 43. Vice Presidents...................................................................................  30
Section 44. Secretary.........................................................................................  31
Section 45. Chief Financial Officer...........................................................................  32
Section 46. Compensation......................................................................................  34

                                             ARTICLE VI
                                      CONTRACTS, BANK ACCOUNTS,
                                          CHECKS AND DRAFTS

Section 47. Execution of Contracts and Other
               Instruments....................................................................................  35
Section 48. Bank Accounts.....................................................................................  35
Section 49. Checks, Drafts, Etc...............................................................................  36

                                             ARTICLE VII
                             CERTIFICATES FOR SHARES AND THEIR TRANSFER

Section 50. Certificate for Shares............................................................................  37
Section 51. Transfer on the Books.............................................................................  37
Section 52. Lost, Destroyed and Stolen Certificates...........................................................  38
Section 53. Issuance, Transfer and
               Registration of Shares.........................................................................  39

                                                                                                               Page
                                                                                                               ----
                                            ARTICLE VIII
                                  INSPECTION OF CORPORATE RECORDS

Section 54. Inspection by Directors..........................................................................   40
Section 55. Inspection by Shareholders.......................................................................   40
Section 56. Written Form.....................................................................................   42

                                              ARTICLE IX
                                            MISCELLANEOUS

Section 57. Fiscal Year......................................................................................   43
Section 58. Annual Report....................................................................................   43
Section 59. Record Date......................................................................................   43
Section 60. Construction and Definition......................................................................   45

                                               ARTICLE X
                                            INDEMNIFICATION

Section 61. Indemnification of Directors, Officers,
               Employees and Other Agents....................................................................   45

                                              ARTICLE XI
                                              AMENDMENTS

Section 62. Amendments.......................................................................................   51

BYLAWS

OF

(A California Corporation)

ARTICLE I

ARTICLE II

ARTICLE III

o'clock a.m. California time, on the fourth Tuesday of March in each year if such date is not a legal holiday observed by the corporation at its principal executive office, and if it is such a legal holiday, then on the next succeeding full business day at the same time. At such annual meeting directors shall be elected and any other business may be transacted which may properly come before the meeting.

(a) Special meetings of the shareholders, for any purpose or purposes, may be called by the Board of Directors, the Chairman of the Board of Directors, the President, or the holders of shares entitled to cast not less than fifty percent (50%) of the votes at the meeting, or may be called as otherwise provided for in the Articles of Incorporation.

(b) Upon written request to the Chairman of the Board of Directors, the President, any vice president or the Secretary of the corporation by any person or persons (other than the Board

of Directors) entitled to call a special meeting of the shareholders, such officer forthwith shall cause notice to be given to the shareholders entitled to vote, that a meeting will be held at a time requested by the person or persons calling the meeting, such time to be not less than thirty-five (35) nor more than sixty (60) days after receipt of such request. If such notice is not given within twenty (20) days after receipt of such request, the person or persons calling the meeting may give notice thereof in the manner provided by law or in these bylaws. Nothing contained in this Section 7 shall be construed as limiting, fixing or affecting the time or date when a meeting of shareholders called by action of the Board of Directors may be held.

Notice of any meeting of shareholders shall state the date, place and hour of the meeting and,

(a) in the case of a special meeting, the general nature of the business to be transacted, and no other business may be transacted at such meeting;

(b) in the case of an annual meeting, the general nature of matters which the Board of Directors, at the time the notice is given, intends to present for action by the shareholders;

(c) in the case of any meeting at which directors are to be elected, the names of the nominees intended at the time of the notice to be presented by management for election; and

(d) in the case of any meeting, if action is to be taken on any of the following proposals, the general nature of such proposal:

(1) a proposal to approve a transaction within the provisions of California Corporations Code, Section 310 (relating to certain transactions in which a director has an interest);

(2) a proposal to approve a transaction within the provisions of California Corporations Code, Section 902

(relating to amending the Articles of Incorporation of the corporation);

(3) a proposal to approve a transaction within the provisions of California Corporations Code, Sections 181 and 1201 (relating to reorganization);

(4) a proposal to approve a transaction within the provisions of California Corporations Code, Section 1900 (winding up and dissolution);

(5) a proposal to approve a plan of distribution within the provisions of California Corporations Code, Section 2007 (relating to certain plans providing for distribution not in accordance with the liquidation rights of preferred shares, if any).

At a special meeting, notice of which has been given in accordance with this Section, action may not be taken with respect to business, the general nature of which has not been stated in such notice. At an annual meeting, action may be taken with respect to business stated in the notice of such meeting, given in accordance with this Section, and, subject to subsection 8(d) above,with respect to any other business as may properly come before the meeting.

If any notice addressed to a shareholder at the address of that shareholder appearing on the books of the corporation is returned to the corporation by the United States Postal Service marked to indicate that the United States Postal Service is unable to deliver the notice to the shareholder at that address, all future notices shall be deemed to have been duly given without further mailing if these shall be available to the shareholder on written demand by the shareholder at the principal

executive office of the corporation for a period of one year from the date of the giving of the notice.

(a) At any meeting of the shareholders, a majority of the shares entitled to vote, represented in person or by proxy, shall constitute a quorum. If a quorum is present, the affirmative vote of the majority of shares represented at the meeting and entitled to vote on any matter shall be the act of the shareholders, unless the vote of a greater number or voting by classes is required by law or by the Articles of Incorporation, and except as provided in subsection (b) below.

(b) The shareholders present at a duly called or held meeting of the shareholders at which a quorum is present may continue to do business until adjournment, notwithstanding the withdrawal of enough shareholders to leave less than a quorum, provided that any action taken (other than adjournment) is approved by at least a majority of the shares required to constitute a quorum.

(c) In the absence of a quorum, no business other than adjournment may be transacted, except as described in subsection (b) above.

In the event any meeting is adjourned, it shall not be necessary to give notice of the time and place of such adjourned meeting pursuant to Sections 8 and 9 of these bylaws; provided that if any of the following three events occur, such notice must be given:

(1) announcement of the adjourned, meeting's time and place is not made at the original meeting which it continues or

(2) such meeting is adjourned for more than forty-five (45) days from the date set for the original meeting or

(3) a new record date is fixed for the adjourned meeting.

At the adjourned meeting, the corporation may transact any business which might have been transacted at the original meeting.

(a) Subject to subsection (b) of this Section, the transactions of any meeting of shareholders, however called and noticed, and wherever held, shall be as valid as though made at a meeting duly held after regular call and notice, if a quorum is present either in person or by proxy, and if, either before or after the meeting, each of the persons entitled to vote but not present in person or by proxy signs a written waiver of notice or a consent to holding of the meeting or an approval of the minutes thereof.

(b) A waiver of notice, consent to the holding of a meeting or approval of the minutes thereof need not specify the business to be transacted or transacted at nor the purpose of the meeting; provided that in the case of proposals described in subsection (d) of Section 8 of these bylaws, the general nature of such proposals must be described in any such waiver of notice and such proposals can only be approved by waiver of notice, not by consent to holding of the meeting or approval of the minutes.

(c) All waivers, consents and approvals shall be filed with the corporate records or made a part of the minutes of the meeting.

(d) A person's attendance at a meeting shall constitute waiver of notice of and presence at such meeting, except when such person objects at the beginning of the meeting to transaction of any business because the meeting is not lawfully called or convened and except that attendance at a meeting is not a waiver of any right to object to the consideration of matters which are required by law or these bylaws to be in such notice (including those matters described in subsection (d) of Section 8 of these bylaws), but are not so included if such person expressly objects to consideration of such matter or matters at any time during the meeting.

Directors may not be elected by written consent except by unanimous written consent of all shares entitled to vote for the election of directors; provided that any vacancy on the Board of Directors (other than a vacancy created by removal) which has

not been filled by the board of directors may be filled by the written consent of a majority of outstanding shares entitled to vote for the election of directors.

Any written consent may be revoked pursuant to California Corporations Code Section 603 (c) prior to the time that written consents of the number of shares required to authorize the proposed action have been filed with the Secretary. Such revocation must be in writing and will be effective upon its receipt by the Secretary.

If the consents of all shareholders entitled to vote have not been solicited in writing, and if the unanimous written consent of all such shareholders shall not have been received, the Secretary shall give prompt notice of any corporate action approved by the shareholders without a meeting to those shareholders entitled to vote on such matters who have not consented thereto in writing. This notice shall be given in the manner specified in
Section 8 of these bylaws. In the case of approval of (i) a transaction within the provisions of California Corporations Code, Section 310 (relating to certain transactions in which a director has an interest), (ii) a transaction within the provisions of California Corporations Code, Section 317 (relating to indemnification of agents of the corporation), (iii) a transaction within the provisions of California Corporations Code,

Sections 181 and 1201 (relating to reorganization), and (iv) a plan of distribution within the provisions of California Corporations Code, Section 2007 (relating to certain plans providing for distribution not in accordance with the liquidation rights of preferred shares, if any), the notice shall be given at least ten (10) days before the consummation of any action authorized by that approval.

Every person entitled to vote at an election for directors may cumulate the votes to which such person is entitled, i.e., such person may cast a total number of votes equal to the number of directors to be elected multiplied by the number of votes to which such person's shares are entitled,and may cast said total number of votes for one or more candidates in such propertions as such person thinks fit; provided, however, no shareholder shall be entitled to so cumulate such shareholder's votes unless the candidates for which such shareholder is voting have been placed in nomination prior to the voting and a shareholder has given notice at the meeting, prior to the vote, of an intention to cumulate votes. In any election of directors, the

candidates receiving the highest number of votes, up to the number of directors to be elected, are elected.

Except as may be otherwise provided in the Articles of Incorporation or by law, and subject to the foregoing provisions regarding the cumulation of votes, each shareholder shall be entitled to one vote for each share held.

Any shareholder may vote part of such shareholder's shares in favor of a proposal and refrain from voting the remaining shares or vote them against the proposal, other than elections to office, but, if the shareholder fails to specify the number of shares such shareholder is voting affirmatively, it will be conclusively presumed that the shareholder's approving vote is with respect to all shares such shareholder is entitled to vote.

No shareholder approval, other than unanimous approval of those entitled to vote, will be valid as to proposals described in subsection 8(d) of these bylaws unless the general nature of such business was stated in the notice of meeting or in any written waiver of notice.

these bylaws to determine which shareholders are entitled to notice of and to vote at a meeting or consent to corporate actions, as provided in Sections 13 and 14 of these bylaws. Only persons in whose name shares otherwise entitled to vote stand on the stock records of the corporation on such date shall be entitled to vote or consent.

If no record date is fixed:

(1) The record date for determining shareholders entitled to notice of or to vote at a meeting of shareholders shall be at the close of business on the business day next preceding the day notice is given or, if notice is waived, at the close of business on the business day next preceding the day on which the meeting is held;

(2) The record date for determining shareholders entitled to give consent to corporate action in writing without a meeting, when no prior action by the Board of Directors has been taken, shall be the day on which the first written consent is given;

(3) The record date for determining shareholders for any other purpose shall be at the close of business on the day on which the Board of Directors adopts the resolution relating

thereto, or the sixtieth (60th) day prior to the date of such other action, whichever is later.

A determination of shareholders of record entitled to notice of or to vote at a meeting of shareholders shall apply to any adjournment of the meeting unless the Board of Directors fixes a new record date for the adjourned meeting; provided, however, that the Board of Directors shall fix a new record date if the meeting is adjourned for more than forty-five (45) days from the date set for the original meeting.

Shares of the corporation held by its subsidiary or subsidiaries (as defined in California Corporations Code, Section 189(b)) are not entitled to vote in any matter.

These inspectors shall:

(a) Determine the number of shares outstanding and the voting power of each, the shares represented at the meeting, the existence of a quorum, and the authenticity, validity, and effect of proxies;

(b) Receive votes, ballots, or consents;

(c) Hear and determine all challenges and questions in any way arising in connection with the right to vote;

(d) Count and tabulate all votes or consents;

(e) Determine when the polls shall close;

(f) Determine the result; and

(g) Do any other acts that may be proper to conduct the election or vote within fairness to all shareholders.

ARTICLE IV

shall be exercised under the ultimate direction of the Board of Directors.

So long as the authorized number of directors shall be six
(6), the Board of Directors shall be composed at all times of persons qualified as follows:

(a) Three (3) directors must be nominees of Kirin Brewery Co., Ltd., a Japanese corporation.

(b) Three (3) directors must be nominees of Amgen, a California corporation.

Except as otherwise provided by law or by the Articles of Incorporation, the entire Board of Directors or any individual

director may be removed from office without cause by the affirmative vote of a majority of the outstanding shares entitled to vote on such removal; provided, however, that unless the entire Board is removed, no individual director may be removed when the votes cast against such director's removal, or not consenting in writing to such removal, would be sufficient to elect that director if voted cumulatively at an election at which the same total number of votes cast were cast (or, if such action is taken by written consent, all shares entitled to vote were voted) and the entire number of directors authorized at the time of such director's most recent election were then being elected.

is present (which shares voting affirmatively also constitute at least a majority of the required quorum) or by the written consent of shareholders pursuant to Section 13 hereinabove. Except as otherwise provided by the Articles of Incorporation, the shareholders may elect a director at any time to fill any vacancy not filled by the directors. Any such election by written consent, other than to fill a vacancy created by removal, requires the consent of a majority of the outstanding shares entitled to vote. Any such election by written consent to fill a vacancy created by removal requires the consent of all of the outstanding shares entitled to vote.

If, after the filling of any vacancy by the directors, the directors then in office who have been elected by the shareholders constitute less than a majority of the directors then in office, any holder or holders of an aggregate of five percent (5%) or more of the shares outstanding at that time and having the right to vote for such directors may call a special meeting of shareholders to be held to elect the entire Board of Directors. The term of office of any director shall terminate upon such election of a successor.

the annual meeting, the Board of Directors shall hold a regular meeting for the purposes of organization, the appointment of officers and the transaction of other business. other regular meetings of the Board of Directors shall be held at such times, places and dates as fixed in these bylaws or by the Board of Directors; provided, however, that if the date for such a meeting falls on a legal holiday, then the meeting shall be held at the same time on the next succeeding full business day. Regular meetings of the Board of Directors held pursuant to this Section 24 may be held without notice.

regular meetings held pursuant to Section 24 above shall be delivered personally, orally or in writing, or by telephone or telegraph to each director, at least forty-eight (48) hours before the meeting, or sent in writing to each director by first-class mail, charges prepaid, at least four (4) days before the meeting. Such notice may be given by the Secretary of the corporation or by the person or persons who called a meeting. Such notice need not specify the purpose of the meeting. Notice of any meeting of the Board of Directors need not be given to any director who signs a waiver of notice of such meeting, or a consent to holding the meeting or an approval of the minutes thereof, either before or after the meeting, or who attends the meeting without protesting prior thereto or at its commencement such director's lack of notice. All such waivers, consents and approvals shall be filed with the corporate records or made a part of the minutes of the meeting.

Directors may be taken without a meeting, if all members of the Board of Directors individually or collectively consent in writing to such action. Such written consent or consents shall be filed with the minutes of the proceedings of the Board of Directors. Such action by written consent shall have the same force and effect as a unanimous vote of such directors.

of the directors present. If the meeting is adjourned for more than twenty-four
(24) hours, notice of such adjournment to another time or place shall be given prior to the time of the adjourned meeting to the directors who were not present at the time of the adjournment.

ARTICLE V

person authorized by these bylaws to act in such officer's place, the Board of Directors may from time to time delegate the powers or duties of such officer to any other officer, or any director or other person whom it may select, for such period of time as the Board of Directors deems necessary.

any other officer upon whom such power of removal may be conferred by the Board of Directors.

name of the corporation, any instrument authorized by the Board of Directors, except when the signing and execution thereof shall have been expressly delegated by the Board of Directors or by these bylaws to some other officer or agent of the corporation. The President shall have all the general powers and duties of management usually vested in the president of a corporation, and shall have such other powers and duties as may be prescribed from time to time by the Board of Directors or these bylaws. The President shall have discretion to prescribe the duties of other officers and employees of the corporation in a manner not inconsistent with the provisions of these bylaws and the directions of the Board of Directors.

be prescribed for them from time to time by the Board of Directors or pursuant to Sections 35 and 36 of these bylaws or otherwise pursuant to these bylaws.

(a) Keep, or cause to be kept, minutes of all meetings of the corporation's shareholders, Board of Directors, and committees of the Board of Directors, if any. Such minutes shall be kept in written form.

(b) Keep, or cause to be kept, at the principal executive office of the corporation, or at the office of its transfer agent or registrar, if any, a record of the corporation's shareholders, showing the names and addresses of all shareholders, and the number and classes of shares held by each. Such records shall be kept in written form or any other form capable of being converted into written form.

(c) Keep, or cause to be kept, at the principal executive office of the corporation, or if the principal executive office is not in California, at its principal business office in California, an original or copy of these bylaws, as amended.

(d) Give, or cause to be given, notice of all meetings of shareholders, directors and committees of the Board of Directors, as required by law or by these bylaws.

(e) Keep the seal of the corporation, if any, in safe custody.

(f) Exercise such powers and perform such duties as are usually vested in the office of secretary of a corporation, and exercise such other powers and perform such other duties as may be prescribed from time to time by the Board of Directors or these bylaws.

If any assistant secretaries are appointed, the assistant secretary, or one of the assistant secretaries in the order of their rank as fixed by the Board of Directors or, if they are not so ranked, the assistant secretary designated by the Board of Directors, in the absence or disability of the Secretary or in the event of such officer's refusal to act or if a vacancy exists in the office of Secretary, shall perform the duties and exercise the powers of the Secretary and discharge such duties as may be assigned from time to time pursuant to these bylaws or by the Board of Directors.

(a) Be responsible for all functions and duties of the treasurer of the corporation.

(b) Keep and maintain, or cause to be kept and maintained, adequate and correct books and records of account for the corporation.

(c) Receive or be responsible for receipt of all monies due and payable to the corporation from any source whatsoever; have charge and custody of, and be responsible for, all monies and other valuables of the corporation and be responsible for deposit of all such monies in the name and to the credit of the corporation with such depositaries as may be designated by the Board of Directors or a duly appointed and authorized committee of the Board of Directors.

(d) Disburse or be responsible for the disbursement of the funds of the corporation as may be ordered by the Board of Directors or a duly appointed and authorized committee of the Board of Directors.

(e) Render to the chief executive officer and the Board of Directors a statement of the financial condition of the corporation if called upon to do so.

(f) Exercise such powers and perform such duties as are usually vested in the office of chief financial officer of a corporation, and exercise such other powers and perform such other duties as may be prescribed by the Board of Directors or these bylaws.

If any assistant financial officer is appointed, the assistant financial officer, or one of the assistant financial officers, if there are more than one, in the order of their rank as fixed by the Board of Directors or, if they are not so ranked, the assistant financial officer designated by the Board of in the absence or disability of the Chief Directors, shall, or in the event of such officer's refusal to Financial Officer act, perform the duties and exercise the powers of the Chief Financial Officer, and shall have such powers and discharge such duties as may be assigned from time to time pursuant to these bylaws or by the Board of

ARTICLE VI

Contracts, Bank Accounts,

and authorized committee or by any officer or officers, agent or agents, of the corporation to whom such power may be delegated from time to time by the Board of Directors. The Board of Directors or its duly appointed and authorized committee may make such rules and regulations with respect to said bank accounts, not inconsistent with the provisions of these bylaws, as are deemed advisable.

ARTICLE VII

In the event that the corporation shall issue any shares as only partly paid, the certificate issued to represent such partly paid shares shall have stated thereon the total consideration to be paid for such shares and the amount paid thereon.

certificate for shares of the corporation duly endorsed, with reasonable assurance that the endorsement is genuine and effective, or accompanied by proper evidence of succession, assignment or authority to transfer and upon compliance with applicable federal and state securities laws and if the corporation has no statutory duty to inquire into adverse claims or has discharged any such duty and if any applicable law relating to the collection of taxes has been complied with, it shall be the duty of the corporation, by its Secretary or transfer agent, to cancel the old certificate, to issue a new certificate to the person entitled thereto and to record the transaction on the books of the corporation.

or stolen certificate, or such owner's legal representative, to give the corporation a bond or other adequate security sufficient to indemnify the corporation and its transfer agent and/or registrar, if any, against any claim that may be made against it or them on account of such allegedly lost, destroyed or stolen certificate or the replacement thereof. Said bond or other stolen security shall be in such amount, on such terms and conditions and, in the case of a bond, with such surety or sureties as may be acceptable to the Board of Directors or to its duly appointed and authorized committee or any officer or officers authorized by the Board of Directors to determine the sufficiency thereof. The requirement of a bond or other security may be waived in particular cases at the discretion of the Board of Directors or its duly appointed and authorized committee or any officer or officers authorized by the Board of Directors so to do.

ARTICLE VIII

(i) A shareholder or shareholders holding at least five percent in the aggregate of the outstanding voting shares of the corporation shall have an absolute right to do either or both of the following:

(A) Inspect and copy the record of shareholders' names and addresses and shareholdings during usual business hours upon five business days' prior written demand upon the corporation; or

(B) Obtain from the transfer agent, if any, for the corporation, upon five business days' prior written demand and upon the tender of its usual charges for such a list (the amount of which charges shall be stated to the shareholder by the transfer agent upon request), a list of the shareholders' names and addresses who are entitled to vote for the election of directors and their shareholdings, as of the most recent record date for which it has been compiled or as of a date specified by the shareholder subsequent to the date of demand.

(ii) The record of shareholders shall also be open to inspection and copying by any shareholder or holder of a voting trust certificate at any time during usual business hours upon written demand on the corporation, for a purpose reasonably related to such holder's interest as a shareholder or holder of a voting trust certificate.

(iii) The accounting books and records and minutes of proceedings of the shareholders and the Board of Directors and of any committees of the Board of Directors of the corporation and of each of its subsidiaries shall be open to inspection, copying and making extracts upon written demand on the corporation of any shareholder or holder of a voting trust certificate at any reasonable time during usual business hours, for a purpose

reasonably related to such holder's interests as a shareholder or as a holder of such voting trust certificate.

(iv) Any inspection, copying, and making of extracts under this subsection (a) may be done in person or by agent or attorney.

ARTICLE IX

entitled to receive payment of any dividend or other distribution or allotment of any rights or entitled to exercise any rights in respect of any change, conversion or exchange of shares or entitled to exercise any rights in respect of any other lawful action. The record date so fixed shall not be more than sixty (60) days nor less than ten (10) days prior to the date of the meeting nor more than sixty (60) days prior to any other action or event for the purpose of which it is fixed. If no record date is fixed, the provisions of Section 15 of these bylaws shall apply with respect to notice of meetings, votes, and consents and the record date for determining shareholders for any other purposes shall be at the close of business on the day on which the Board of Directors adopts the resolutions relating thereto, or the sixtieth (60th) day prior to the date of such other action or event, whichever is later.

Only shareholders of record at the close of business on the record date shall be entitled to notice and to vote or to receive the dividend, distribution or allotment of rights or to exercise the rights, as the case may be, notwithstanding any transfer of any shares on the books of the corporation after the record date, except as otherwise provided in the Articles of Incorporation, by agreement or by law.

Without limiting the foregoing, "shall" is mandatory and "may" is permissive.

ARTICLE X

trative, or investigative; and "expenses" includes, without limitation, attorneys' fees and any expenses of establishing a right to indemnification under subsection (d) or subsection e(iii) of this Section.

(i) In respect of any claim, issue or matter as to which such person shall have been adjudged to be liable to the corporation in the performance of such person's duty to the corporation, unless and only to the extent that the court in which such proceeding is or was pending shall determine upon application that, in view of all the circumstances of the case, such person is fairly and reasonably entitled to indemnity for the expenses which the court shall determine;

(ii) Of amounts paid in settling or otherwise disposing of a threatened or pending action, with or without court approval; or

(iii) Of expenses incurred in defending a threatened or pending action which is settled or otherwise disposed of without court approval.

(i) A majority vote of a quorum consisting of directors who are not parties to such proceeding;

(ii) Approval or ratification by the affirmative vote of a majority of the shares represented and voting at a duly held meeting at which quorum is present (which shares voting affirmatively also constitute at least a majority of the required quorum) or by the written consent of the shareholders, with the shares owned by the person to be indemnified not being entitled to vote thereon; or

(iii) The court in which such proceeding is or was pending, upon application made by the corporation or the agent or the attorney or other person rendering services in connection with the defense, whether or not such application by the agent, attorney, or other person is opposed by the corporation.

(i) That is would be inconsistent with a provision of the Articles of Incorporation, bylaws, a resolution of the shareholders, or an agreement in effect at the time of the accrual of the alleged cause of action asserted in the proceeding in which the expenses were incurred or other amounts were paid, which prohibits or otherwise limits indemnification; or

(ii) That is would be inconsistent with any condition expressly imposed by a court in approving a settlement.

ARTICLE XI

[LETTERHEAD OF MUSICK, PEELER & GARRETT]

June 13, 1984

Kirin Brewery Co., Ltd.                            Kirin-Amgen, Inc.
26-1 Jingumae                                      1900 Oak Terrace Lane
6 Chome                                            Thousand Oaks, CA 91320
Shibuya-ku                                         U.S.A.
Tokyo 150, JAPAN

Amgen
1900 Oak Terrace Lane
Thousand Oaks, CA 91320
U.S.A.

                  Re: Kirin-Amgen, Inc.

Gentlemen:

The California State Bar had adopted a set of Rules of Professional Conduct by which its members are governed. One such rule is Rule 5-102 (B) which reads as follows:

"(B) A member of the State Bar shall not represent conflicting interests, except with the written consent of all parties concerned."

Our office has been asked by each of you to act as legal counsel to Kirin-Amgen, Inc., a California corporation ("Corporation").

This is quite an array of responsibility, and with it goes the potential of a conflict of interest. Accordingly, we hereby declare to each of you that the following are conditions of our continued engagement by all of you:

(1) If any one or more of you shall ever be of the view that our continued representation of the several interests which have been referred to above is not agreeable to you for any reason, or

(2) If we shall reach that same view,

EXHIBIT "F"

MUSICK, PEELER & GARRETT
A LAW PARTNERSHIP INCLUDING PROFESSIONAL CORPORATIONS

Kirin Brewery Co., Ltd.
Amgen
Kirin-Amgen, Inc.
June 13, 1984
Page Two

(2) If we shall reach that same view, then the entity desiring to have representation of Corporation terminated should notify all others concerned. Upon such notice, we pledge to do everything reasonably necessary and appropriate to effect a termination of the representation as soon as practicable and in such a manner as befits the circumstances existing at that time.

In order that we might be in compliance with the above-cited Rule, we ask each of you to be good enough to sign a copy of this letter and return the same to us. The extra copy is for your files.

Kindest personal regards.

Very truly yours,

                                             /s/ Joel S. Marcus, P.C.
                                             of MUSICK, PEELER & GARRETT

JSM/jr
Enclosure

Each of the undersigned hereby acknowledges receipt of the foregoing letter, and with full knowledge of the contents thereof, hereby waives any conflict of interest that may exist by reason of the undertaking of Musick, Peeler & Garrett to provide a legal representation as described therein.

KIRIN BREWERY CO., LTD., a                KIRIN-AMGEN, INC., a
Japanese corporation                      California corporation

By: /s/ Noboru Miyadai                    By: /s/ Tatsuhiko Kaneka
    General Manager R & D Dept.                   Its Vice President - Kirin
        Date: June 13, 1984                       Date: June 13, 1984

AMGEN, a California corporation

By: /s/ Gordon M. Binder

      Its Vice President
      Date: June 13, 1984

A MEMBER OF ARTHUR YOUNG INTERNATIONAL

ARTHUR YOUNG

515 South Flower Street
Los Angeles, California 90071

June 13, 1984

KIRIN-AMGEN, Inc.
1892 Oak Terrace Lane
Newbury Park, California 91320

Attention: Mr. Gordon M. Binder

We are pleased to accept appointment as certified public accountants for KIRIN-AMGEN, Inc. to examine and report on your annual financial statements. In addition, our services will include the preparation of your federal and state income tax returns. We will also be prepared to be helpful to you on any problems within our competence that might arise during the year, and hope that you will call on us at any time you think we can be of assistance.

Gary Johnson and Joe Johns will be responsible for coordinating and managing all of the services we perform for you. Marty Melone will be the colleague partner who will consult with Messrs. Johnson and Johns on significant aspects of the engagement and substitute for them when they are unavailable.

It will be the responsibility of Mr. Johnson and Mr. Johns to make sure that your management receives good service. They will, as- desirable, call upon other individuals with specialized knowledge and skills, either in this office or elsewhere in the firm. An audit manager and a tax manager will be assigned to your work, and we expect that they will soon establish direct working relationships with personnel in your Company.

Our examination of your annual financial statements will be made in accordance with generally accepted auditing standards and accordingly will include such tests as we consider necessary in the circumstances. Unless unusual conditions not now foreseen make it impracticable for us to do so, we will submit a report on our examination of these financial statements which will express an opinion as to the fairness of their presentation in conformity with generally accepted accounting principles.

EXHIBIT "G"

Mr. Gordon M. Binder
June 13, 1984

Under generally accepted auditing standards the independent auditor has the responsibility, within the inherent limitations of the auditing process, to plan the examination to search for errors or irregularities (as defined in authoritative professional literature) that would have a material effect on the financial statements. Our search for material errors or irregularities ordinarily is accomplished by performing those auditing procedures that in our judgment are appropriate in the circumstances to form an opinion on the financial statements as a whole. Our examination, which is based on the concept of selective testing of the data being examined, is subject to the inherent risk that material errors or irregularities, if they exist, will not be detected.

In conducting our examination, we will be aware of the possibility that illegal acts (as defined in authoritative professional literature) may have occurred that may have a material effect on the financial statements. Examinations conducted in accordance with generally accepted auditing standards are of limited effectiveness in discovering possible illegal acts and cannot be expected to provide assurance that illegal acts will be detected, although procedures that are performed primarily for the purpose of forming an opinion on the financial statements as a whole may also bring possible illegal acts to the auditor's attention.

During the course of our examination, we may observe opportunities for economies in or improved controls over your operations. It is our practice to bring such opportunities to the attention of an executive at the appropriate level of management, either orally or in writing. Should you desire any further information concerning our responsibilities and functions as an independent auditor in making the examination, we shall be pleased to furnish information to you upon request.

Our charges are based on hours worked by the various grades of personnel, at our standard rates applicable to each. We will bill you monthly on the basis of such charges plus out-of-pocket expenses. We will submit annually, for your approval, budgets outlining our estimated fees and expenses.

Mr. Gordon M. Binder
June 13, 1984

If this letter meets with your approval, please sign one copy and return it to us.

We very much appreciate the opportunity to act as your independent auditors and trust that our association will be a long and pleasant one.

Yours very truly,

/s/ Arthur Young & Company

KIRIN-AMGEN, Inc.

By: /s/ Robert D. Weist                                  Date: June 13, 1984

THIS KIRIN BREWERY CO., LTD./KIRIN-AMGEN, INC. SERVICES AGREEMENT ("Agreement") is made as of this day of, 1984, by and between KIRIN BREWERY CO., LTD., a Japanese corporation, ("Kirin"), and KIRIN-AMGEN, INC., a California corporation ("Company").

R E C I T A L S

WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);

WHEREAS, Kirin is willing to provide or cause to be provided certain services to the Company as described below and in accordance with the terms set forth below;

NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:

EXHIBIT "H"

ARTICLE I

1.02 EPO: As defined in the Shareholders' Agreement (the "Shareholders' Agreement") among Kirin, Amgen, a corporation organized and existing under the laws of California ("Amgen"), and the Company, of even date herewith.

1.03 Field of Activity: As defined in the Shareholders' Agreement.

1.04 Management Support Services: Those services more fully described in Article II hereof, including without limitation the marketing support and commercial development services to be supplied by the personnel referred to in Article II.

ARTICLE II

services in connection with the Field of Activity as the Company requests:

(a) general management support in connection with the day-to-day operation of the Company's business, including operating and sales services; and

(b) commercial development and marketing research services concerning the Field-of Activity.

ARTICLE III

equivalents thereof, and other miscellaneous administrative staff groups, or the equivalents thereof, to advise and assist the Company with respect to matters falling within the areas of expertise of these various departments as the Company requests.

ARTICLE IV

The Company will be charged for each hour of service supplied hereunder an amount equal to the product of two and one-half (2 1/2,' and the annual base salary of the person supplying a particular service to the Company, divided by two thousand (2000). Base salary for the purposes of this section

shall mean the base salary paid to such person by Kirin or a Subsidiary for the twelve (12) month period terminating at the end of the fiscal quarterimmediately preceding (or for persons who were not employed by Kirin or a Subsidiary for such period an annualized equivalent computation thereof) the time the services were rendered and shall not include bonuses or an amount for fringe or other benefits.

ARTICLE V

between the Company and employees or consultants of Kirin, its subsidiaries or associated companies; (d) an assumption by Kirin of any responsibility for the work performed by outside suppliers employed by the Company at the suggestion or recommendation of Kirin; or (e) the delegation of any function or authorityof the Company to Kirin; it being understood that Kirin will make recommendations and offer advice pursuant to this Agreement but that all decisions with respect thereto and otherwise shall be and remain dependent upon appropriate action of the Board of Directors or the authorized officers of the Company.

ARTICLE VI

ARTICLE VII

class mail, or by telex confirmed by registered-first-class mail, and addressed as follows:

If to Kirin:                      Senior Vice President
                                  KIRIN BREWERY CO., LTD.
                                  26-1, Jingumae 6 Chome
                                  Shibuya-Ku, Tokyo 150
                                  JAPAN
                                  Telex No.: 242-5401 KIRIN J

If to the Company:                President
                                  KIRIN-AMGEN, INC.
                                  c/o 1900 Oak Terrace Lane
                                  Thousand Oaks, CA 91320 USA
                                  Telex No.:

With a copy to:                   Joel S. Marcus, P.C.
                                  Musick, Peeler & Garrett
                                  One Wilshire Boulevard
                                  Los Angeles, CA 90017

Either party may give written notice for a change of address in accordance with the provisions of this Article VII and, there after, any notice or request to be given hereunder shall be forwarded to the new address so provided. All notices given hereunder shall be deemed to have been received by the party addressed (a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, or (c) ten (10) business days after the date of posting of notice sent by

ARTICLE VIII

ARTICLE IX

ARTICLE X

by a writing duly signed by the authorized representatives of the parties hereto. Any condition or provision of or in any document or communication whatsoever, other than a writing amending or modifying this Agreement- in accordance with the second sentence of this Section 10.01, shall be deemed inapplicable to the obligations between the parties hereto.

ARTICLE XI

IN WITNESS WHEREOF, Kirin and the Company have caused this Agreement to be executed by their respective duly authorized

representatives in the manner legally binding upon them as of the date first above written.

KIRIN BREWERY CO., LTD.

By
Its

KIRIN-AMGEN, INC.

BY
Its

THIS AMGEN/KIRIN-AMGEN, INC. SERVICES AGREEMENT ("Agreement") is made as of this day of , 1984, by and between AMGEN, a California corporation ("Amgen") and KIRIN AMGEN, INC., a California corporation ("Company").

R E C I T A L S

WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement);

WHEREAS, Amgen is willing to provide or cause to be provided certain services to -the Company as described below and in accordance with the terms set forth below;

EXHIBIT "I"

NOW, THEREFORE, in consideration of the mutual promises and covenants hereinafter set forth, IT IS HEREBY AGREED AS FOLLOWS:

ARTICLE I

1.02 EPO: As defined in the Shareholders' Agreement (the "Shareholders' Agreement") among Amgen, Kirin Brewery Co., Ltd., a corporation organized and existing under the laws of Japan ("Kirin"), and the Company, of even date herewith.

1.04 Management Support Services: Those services more fully described in Article II hereof, including without limitation the marketing support and commercial development services to be supplied by the personnel referred to in Article II.

ARTICLE II

(a) general management support in connection with the day-to-day operation of the Company's business, including operating and sales services; and

(b) commercial development and marketing research services concerning the Field of Activity.

ARTICLE III

ARTICLE IV

The Company will be charged for each hour of service supplied hereunder an amount equal to the product of two and one-half (2 1/2) and the annual base salary of the person supplying a particular service to the Company, divided by two thousand (2000). Base salary for the purposes of this section shall mean the base salary paid to such person by Amgen or a Subsidiary for the twelve (12) month period termination at the end of the fiscal quarter immediately preceding (or for persons who were not employed by Amgen or a Subsidiary for such period an annualized equivalent computation thereof) the time the services were rendered and shall not include bonuses or an amount for fringe or other benefits.

ARTICLE V

ARTICLE VI

If to Amgen:                         Chief Financial Officer
                                     Amgen
                                     1900 Oak Terrace Lane
                                     Thousand Oaks, CA 91320 USA
                                     Telex No.:
With a copy to:                      Alan C. Mendelson, Esq.
                                     Cooley, Godward, Castro,
                                     Huddleson & Tatum
                                     5 Palo Alto Square
                                     Suite 400
                                     Palo Alto, CA 94306
If to the Company:                   Chief Financial Officer
                                     Kirin-Amgen, Inc.
                                     1900 Oak Terrace Lane
                                     Thousand Oaks, CA 91320 USA
                                     Telex No.:

With a copy to:                      Joel S. Marcus, P.C.
                                     Musick, Peeler & Garrett
                                     One Wilshire Boulevard
                                     Los Angeles, CA 90017

Either party may give written notice for a change of address in accordance with the provisions of this Article VII and, there after, any notice or request to be given hereunder shall be forwarded to the new address so provided. All notices given hereunder shall be deemed to have been received by the party

addressed-(a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, or (c) ten (10) business days after the date of posting of notice sent by registered or certified mail.

ARTICLE VIII

ARTICLE IX

ARTICLE X

ARTICLE XI

IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their respective duly authorized representatives in the manner legally binding upon them as of the date first above written.

AMGEN
By
Its

KIRIN-ANGEN, INC.

By
Its

THIS KIRIN BREWERY CO., LTD./KIRIN-AMGEN, INC. LICENSE AGREEMENT ("Agreement") is made this day of , 1984, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin").

R E C I T A L S

WHEREAS, Amgen, a corporation organized and existing under the laws of the State of California ("Amgen"), has assigned to the Company, perpetually and irrevocably, certain proprietary technology relating to and useful in the production and worldwide commercial sale of erythropoietin;

WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).

EXHIBIT "J"

WHEREAS, Kirin, Amgen and the Company have entered into a Development and Supply Agreement of even date herewith (the "Development Agreement"), pursuant to which Kirin and Amgen will conduct development work for the Company with regard to certain elements of the Transferred Technology (as hereinafter defined), and the Company will own the entire right, title and interest in such technology, patent rights and organisms (including the right to grant the license to Kirin hereunder);

WHEREAS, Kirin desires to obtain from the Company the EPO Technology and to acquire a license to such technology, patent rights and organisms in order to develop, manufacture, market and sell EPO (as hereinafter defined) in the Field of Activity (as hereinafter defined) in its Territory (as hereinafter defined) employing such technology; and in view of the Shareholders' Agreement and the parties further development activities pursuant to the Development Agreement, the Company is willing to grant such a license to Kirin; and

WHEREAS, the Company has granted a similar license to Amgen, of-even date herewith (the "Amgen License"), with respect to the exploitation of the EPO Technology in the United States of America, its territories and possessions, on substantially the same terms and conditions contained herein and for the same purposes described herein.

NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:

ARTICLE I

1.01 EPO: "EPO" shall have the meaning set forth in the Shareholders' Agreement.

1.10 Sales Value: "Sales Value" means the gross amount billed by Kirin and its Subsidiaries, as the case may be, to customers with respect to the sale or use of EPO Products less: (1) trade and/or quantity discounts, to the extent permitted by law; (2) returns and allowances; and (3) retroactive price reductions.

ARTICLE II

ARTICLE III

(a) The Company shall, in accordance with the Shareholders' Agreement and the Development Agreement during the Term of Support, reasonably disclose and deliver to Kirin all EPO Technology in sufficient detail to permit Kirin to employ such data for the purposes provided herein.

(b) Kirin shall, during the Term of Support, have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the EPO Technology.

(a) Any secret or confidential EPO Technology which is disclosed to Kirin pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:

(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and

(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Kirin within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.

(b) Except to the extent expressly authorized by Agreement, the Shareholders' Agreement, the Development Agreement or by other prior written consent of the Company for the term of this Agreement and thereafter, Kirin shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential EPO Technology disclosed or provided to Kirin by the Company. For the purposes of this Agreement, EPO Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:

(i) was known to Kirin at the time of its disclosure and not otherwise subject to an obligation of Kirin to keep such information confidential;

(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;

(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Kirin in breach of this Agreement; or

(iv) became known to Kirin after its disclosure (A) from a source other than the Company (including from independent development by Kirin), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Kirin may disclose any EPO Technology to the extent such disclosure or delivery is necessary for Kirin to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Kirin shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.

(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.

(a) The Company shall during the Term of Support provide to Kirin such EPO Organisms as Kirin requests and as are required for Kirin's business within the Field of Activity, solely for use by Kirin during the period of and under the terms of the right to use such EPO Organisms granted by the Company to Kirin in Sections 2.01 and 2.02, above.

(b) The license granted herein to Kirin with respect to the EPO Organisms shall be limited solely to the use by Kirin of such EPO Organisms in the Field of Activity. Except as expressly authorized by this Agreement or by other prior written consent of the Company, for the term of this Agreement and thereafter, Kirin shall not deliver, transmit or provide to any person other than to a sublicensee under a license granted in accord in Section 2.02, and shall not use, any of the EPO Organisms owned by the Company, or authorize, cause or aid anyone else to do so. Except for Sections 2.01 and 2.02, above, nothing in this Agreement shall be deemed to give Kirin any right or license to use, manufacture, replicate or reproduce any of the EPO Organisms owned by the Company, or to authorize, aid, or cause others so to do.

ARTICLE IV

it under this Agreement. Prompt adjustment shall be made by the proper partyto compensate for any errors or omissions disclosed by such examination or audit. Neither such right to examine and audit nor the right to receive such adjustment shall be affected by any statement to the contrary, appearing on checks or otherwise, unless such statement appears in a letter, signed by the party having such right and delivered to the other party, expressly waiving such rights.

(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual period after the first sale of EPO by Kirin, Kirin shall. furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Kirin showing,all EPO sold during such semiannual period, the Sales Value of .such EPO and the amount of royalty payable thereon (or if no EPO has been so sold, showing this fact).

(b) Within such sixty (60) days Kirin shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.

(c) Kirin shall furnish whatever additional information the Company may reasonably prescribe from time to time to enable the Company to ascertain which EPO sold by Kirin or any of its Subsidiaries are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.

ARTICLE V

ARTICLE VI

and maintain any appropriate suit or action involving infringement in the Field of Activity of any patent of the EPO Technology covering only the making, use or sale or products or the use of processes in the Field of Activity. If Kirin finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Kirin shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Kirin lack standing to bring any such action then Kirin may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Kirin.

proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the EPO Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Kirin in such suit or action, Kirin shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option be represented by counsel of its choice unless the Company and Kirin otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Kirin. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Kirin shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement in the Field of Activity. If Kirin finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Kirin shall pay to the Company the reasonable expenses of the Company (excluding its attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgement or

settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Kirin.

be adjudged bankruptcy, (c) go or be placed in a process of complete liquidation other than for an amalgamation or reconstruction, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.

                     Kirin-Amgen, Inc.
                     1900 Oak Terrace Lane
                     Thousand Oaks, CA 91320
                     Attn: Corporate Secretary

With a copy to:      Joel S. Marcus, P.C.
                     Musick, Peeler & Garrett
                     One Wilshire Boulevard
                     Los Angeles, CA 90017

Senior Vice President
KIRIN BREWERY CO., LTD.
26-1, Jingumae 6 Chome
Shiguya-Ku, Tokyo 150
Japan
Telex No.: 242-5401 KIRINBJ

given (a) immediately upon personal delivery, (b) one (1) business day after notice given by telegram or telex, and (c) ten (10) business days after the date of posting notice, sent by registered or certified mail.

required hereunder as may be prevented by or whose purpose is frustrated by Force Majeure. The Party so affected shall give notice to the other Party in writing promptly and thereupon shall be excused from such of its obligations hereunder as it is unable to perform on account of the Force Majeure throughout the duration thereof plus a period of thirty (30) days. Notwithstanding the foregoing, should an event of Force Majeure remain in effect for a period of six
(6) months, then in such event, the Company and Kirin hereby agree to promptly renegotiate the terms of this Agreement, and if no such agreement can be reached within sixty (60) days of such six (6) month period, the party not so effected by the Force Majeure shall have the option to terminate this Agreement and if such party so elects then this Agreement shall automatically terminate and be of no further force or effect.

connection with any product made, used or sold by Kirin or the use by Kirin of the EPO Technology furnished pursuant to any provision hereunder, or otherwise arising out of or related to the performance of this Agreement.

IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

KIRIN-AMGEN, INC.

By

Its

KIRIN BREWERY CO., LTD.

By

Its

THIS AMGEN/KIRIN-AMGEN, INC. LICENSE AGREEMENT is made this day of , 1984, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN, a California corporation ("Amgen").

R E C I T A L S

WHEREAS, Amgen has assigned to the Company, perpetually and irrevocably, certain proprietary technology relating to and useful in the production and worldwide commercial sale of erythropoietin;

WHEREAS, Amgen, Kirin and the Company have entered into that certain Shareholders' Agreement, dated May 11, 1984, ("Shareholders' Agreement"), with respect to the formation of the Company to engage in the development, manufacture, production and sale of EPO products (as defined in the Shareholders' Agreement) for human therapeutic use in the Field of Activity (as defined in the Shareholders' Agreement).

EXHIBIT "K"

WHEREAS, Amgen, Kirin and the Company have entered into a Development and Supply Agreement of even date herewith (the "Development Agreement"), pursuant to which Amgen and Kirin will conduct development work for the Company with regard to certain elements of the Transferred Technology (as hereinafter defined) and the Company will own the entire right, title and interest in such technology, patent rights and organisms (including the right to grant the license to Amgen hereunder);

WHEREAS, Amgen desires to obtain from the Company the EPO Technology and to acquire a license to such technology, patent rights and organisms in order to develop, manufacture, market and sell EPO (as hereinafter defined) in the Field of Activity (as hereinafter defined) in its Territory (as hereinafter defined) employing such technology; and in view of the Shareholders' Agreement and the parties' further development activities pursuant to the Development Agreement, the Company is willing to grant such a license to Amgen; and

WHEREAS, the Company has granted a similar license to Kirin, of even date herewith (the "Kirin License"), with respect to the exploitation of the EPO Technology in the country of Japan on substantially the same terms and conditions contained herein and for the same purposes described herein.

NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:

ARTICLE I

1.01 EPO. "EPO" shall have the meaning set forth in the Shareholders' Agreement.

1.10 Sales Value. "Sales Value" means the gross amount billed by Amgen and its Subsidiaries, as the case may be, to customers with respect to the sale or use of EPO Products less: (1) trade and/or quantity discounts to the extent permitted by law; (2) returns and allowances; and (3) retroactive price reductions.

ARTICLE II

manufacture and marketing of EPO in the Territory. Said license shall be exclusive except as provided in Section 2.03 hereof.

Amgen. Amgen shall include, in all its sublicenses granted hereunder to any Subsidiary of Amgen, provisions for such termination and assignment.

ARTICLE III

(a) The Company shall, in accordance with the Shareholders' Agreement and the Development Agreement during the Term of Support, reasonably disclose and deliver to Amgen all EPO Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.

(b) Amgen shall, during the Term of Support, have the right to attend and participate in the Company's technical

meetings, conduct plant visits at reasonable intervals and receive information concerning the EPO Technology.

(a) Any secret or confidential EPO Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:

(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and

(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Amgen within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.

(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, the Development Agreement or by other prior written consent of the Company for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential EPO Technology disclosed or provided to Amgen by the Company. For the purposes of this Agreement, EPO Technology shall be

deemed not secret or confidential to the extent, and only to the extent, that it:

(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;

(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;

(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission or Amgen in breach of this Agreement; or

(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Amgen may disclose any EPO Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its

best efforts to secure confidential treatment of the EPO Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.

(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.

(a) The Company shall during the Term of Support provide to Amgen such EPO Organisms as Amgen requests and as are reasonably required for Amgen's business within the Field of Activity, solely for use by Amgen during the period of and under the terms of the right to use such EPO Organisms granted by the Company to Amgen in Sections 2.01 and 2.02, above.

(b) The license granted herein to Amgen with respect to the EPO Organisms shall be limited solely to the use by Amgen of such EPO Organisms in the Field of Activity. Except as expressly authorized by this Agreement or by other prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall not deliver, transmit or provide to any person other than to a sublicensee under a license granted in accord in Section 2.02, and shall not use, any of the Licensed Organisms owned by the Company, or authorize, cause or aid anyone else to do so. Except for Sections 2.01 and 2.02, above, nothing in this Agreement shall be deemed to give Amgen any right or license to use, manufacture, replicate or reproduce any of the

Licensed Organisms owned by the Company, or to authorize, aid, or cause others so to do (although the Company may grant such rights to Amgen pursuant to
Section 1.04 of the Amgen Assignment).

ARTICLE IV

examination and audit, during normal business hours, not more frequently than annually, of all such records and such other records and accounts as may under recognized accounting practices contain information bearing upon the amount of royalty payable to it under this Agreement. Prompt adjustment shall be made by the proper party to compensate for any errors or omissions disclosed by such examination or audit. Neither such right to examine and audit nor the right to receive such adjustment shall be affected by any statement to the contrary, appearing on checks or other-wise, unless such statement appears in a letter, signed by the party having such right and delivered to the other party, expressly waiving such right.

(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual after the first sale of EPO by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all EPO sold during such semiannual period, the Sales Value of-such EPO and the amount of royalty payable thereon (or if no EPO has been so sold, showing that fact).

(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.

(c) Amgen shall furnish whatever additional information the Company may reasonably prescribe from time to time to enable the Company to ascertain which EPO sold by Amgen or any of its Subsidiaries are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.

ARTICLE V

PATENT APPLICATIONS AND COPYRIGHT REGISTRATIONS

ARTICLE VI

PATENT, COPYRIGHT AND TRADE SECRET ENFORCEMENT

and maintain any appropriate suit or action involving infringement in the Field of Activity of any patent of the EPO Technology covering only the making, use or sale of products or the use of processes in the Field of Activity. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Amgen lack standing to bring any such action then Amgen may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Amgen.

proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the EPO Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Amgen in such suit or action, Amgen shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option be represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement in the Field of Activity. If Amgen finds it necessary to join the Company in such suit- or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding it attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement,

after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.

ARTICLE VII

be adjudged bankruptcy, (c) go or be placed in a process of complete liquidation other than for an amalgamation or reconstruction, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice t the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.

ARTICLE VIII

ARTICLE IX

                         Kirin-Amgen, Inc.
                         1900 Oak Terrace Lane
                         Thousand Oaks, CA 91320
                         Attn: Corporate Secretary

With a copy to:          Joel S. Marcus, P.C.
                         Musick, Peeler & Garrett
                         One Wilshire Boulevard
                         Los Angeles, CA 90017

10.02 Amgen Notice. All notices to Amgen under this Agreement shall be in writing and sent to:

                         Amgen
                         1900 Oak Terrace Lane
                         Thousand Oaks, CA 91320
                         Attn: Secretary

With a copy to:          Alan C. Mendelson
                         Cooley, Godward, Castro,
                            Huddleson & Tatum
                         5 Palo Alto Square
                         Suite 400
                         Palo Alto, CA 94306

10.03 Changes. The addresses given above may be changed by notice as specified above.

ARTICLE XI

duration thereof plus a period of thirty (30) days. Notwithstanding the foregoing, should an event of Force Majeure remain in effect for a period of six
(6) months, then in such event, the Company and Amgen hereby agree to promptly renegotiate the terms of this Agreement, and if no such agreement can be reached within sixty (60) days of such six (6) month period, the party not so effected by the Force Majeure shall have the option to terminate this Agreement and if such party so elects then this Agreement shall automatically terminate and be of no further force or effect.

such event, such invalid provision or provisions shall be validly reformed to as nearly approximate the intent of the Parties as possible and if unreformable, shall be severed and deleted from this Agreement.

IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

KIRIN-AMGEN, INC.

By
Its

AMGEN

By
Its

THIS AMENDMENT NO. 1 ("Amendment No. 1") TO THAT CERTAIN KIRIN-AMGEN INC./AMGEN EPO LICENSE AGREEMENT ("License Agreement"), is made and entered into this 20th day of October, 1989, by and between AMGEN, INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("corporation").

R E C I T A L S

A. Amgen and Corporation have previously executed that certain License Agreement regarding EPO.

B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 1.

NOW, THEREFORE, it is agreed as follows:

1. Article I, Section 1.06 at page 3 of the License Agreement is hereby deleted and the following substituted in lieu thereof:

allowances actually granted upon claims or returns regardless of the party requesting the return, (iii) freight charges paid for delivery, and (iv) taxes or other government charges levied on or measured by the billed amount whether absorbed by the billing or the billed party."

2. Except to the extent as provided herein, the provisions of the License Agreement are hereby ratified and confirmed in all respects.

IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 1 to be executed as of the first day written above.

AMGEN, INC., a Delaware corporation,

By:  /s/ Gordon M. Binder
         Gordon Binder
       its Chief Executive Officer

"Amgen"

KIRIN-AMGEN, INC.
a California corporation,

By: /s/ Yasushi Yamamoto
    Yasushi Yamamoto, Chairman

                     "Corporation"

THIS AMENDMENT NO. 4 ("Amendment No. 4") TO THAT CERTAIN SHAREHOLDERS' AGREEMENT OF KIRIN-AMGEN, INC., DATED MAY 11, 1984, as previously amended ("Shareholders' Agreement"), is made and entered into this 16/th/ day of October, 1986, and is made effective as of the 1st day of July, 1986, by and among KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), AMGEN, a California corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").

R E C I T A L S

A. The parties have acknowledged that the commercial production system for G-CSF (PPO) has been established by Amgen.

B. Pursuant to Amendment No. 3 to the Shareholders' Agreement, the parties previously agreed, inter alia, to transfer to Corporation all right, title and interest in and to the G-CSF (PPO) Technology as of the effective date of this Agreement.

C. The parties have previously agreed that upon establishment of the commercial production system, Amgen shall receive two-thirds (2/3) of the unexpended proposed second year R & D funding.

NOW, THEREFORE, it is agreed as follows:

1.01 Amgen shall assign all of its right, title and interest in and to its G-CSF (PPO) Transferred Technology to Corporation effective as of the date hereof pursuant to that certain Assignment and License Agreement attached hereto as Exhibit "A".

1.02 Amgen shall license its Core Technology in the Field of Activity relating to G-CSF (PPO) to Corporation effective as of the date hereof pursuant to that certain Assignment and License Agreement attached hereto as Exhibit "A".

1.03 Concurrently with the execution of this Amendment No. 4, that certain U.S. Patent Application Ser. No. 768959, filed August 23, 1985, entitled Production of Pluripotent Granulocyte Colony-Stimulating Factor, recorded in the Patent

and Trademark Office on Reel 4475, Frame 913, shall be assigned by Amgen to Corporation pursuant to that certain Assignment attached hereto as Exhibit "B".

Kirin shall assign all of its right, title and interest in and to its G-CSF (PPO) Technology to Corporation effective as of the date hereof pursuant to that certain Assignment Agreement attached hereto as Exhibit "C."

Amgen hereby sublicenses Corporation effective as of the date hereof under any and all rights conferred upon Amgen pursuant to that certain Agreement by and between Amgen and Sloan-Kettering.

A One Million Dollar (U.S. $1,000,000) lump sum payment shall be made to each Kirin and Amgen concurrently with the execution of this Agreement and the Exhibits attached hereto.

During the period February 1, 1987 - March 31, 1987, Kirin and Amgen shall each contribute to the capital of Corporation One Million Dollars (U.S. $1,000,000) in exchange for One Million (1,000,000) additional shares each of Corporation's no par value voting common stock in a tax-free transaction. The Articles of Incorporation of Corporation shall be amended to authorize this additional stock issuance.

Amgen shall (i) supply Corporation (and Kirin) with adequate pre-clinical G- CSF (PPO) materials, (ii) continue its G-CSF (PPO) Technology transfer to Corporation (and Kirin), and (iii) promptly make available to Corporation (and Kirin) its standard operating procedures ("SOP"), strain and standard samples, all relating to the G-CSF (PPO) Technology. Further, Amgen shall use its best efforts to assist Kirin in verifying the SOPS.

All notices, requests, demands and other communications required or permitted to be given under this Agreement shall be

in writing and shall be mailed to the Party to whom notice is to be given, by telex or facsimile, and confirmed by first class mail, registered or certified, return receipt requested, postage prepaid, and properly addressed as follows (in which case such notice shall be deemed to have been duly given on the third
(3rd) day following the date of such sending):

 "Kirin"            Kirin Brewery Co., Ltd.
                    26-1, Jingumae 6-Chome
                    Shibuya-Ku, Tokyo 150
                    Japan
                    Telex No. 242-5401 KIRINBJ
                    Attn:  General Manager of
                           Pharmaceuticals Department

 With a copy to:    Pettit & Martin
                    355 S. Grand Avenue, 33d Floor
                    Los Angeles, California 90071
                    U.S.A.
                    Telex No. 181025 PEMLAW LSA
                    Attn: Joel S. Marcus; Esq.

"Amgen"             Amgen
                    1900 Oak Terrace Lane
                    Thousand Oaks, California 91320
                    Telex No. 4994440 (AMGEN)
                    Attn: Corporate Secretary

With a copy to:     Cooley, Godward, Castro,
                      Huddlesbn & Tatum
                    One Maritime Plaza, 20th Floor
                    San Francisco, California 94111
                    U.S.A.
                    Telex No. 910-372-7370 Cooley SFO
                    Attn: Alan C. Mendelson, Esq.

"Corporation"       Kirin-Amgen, Inc.
                    1900 Oak Terrace Lane
                    Thousand Oaks, CA 91320
                    U.S.A.
                    Telex No. 4994440 (AMGEN)
                    Attn: Corporate Secretary

With a copy to:     Pettit & Martin
                    355 S. Grand Avenue, 33d Floor
                    Los Angeles, California 90071
                    U.S.A.
                    Telex No. 181025 PEMLAW LSA
                    Attn: Joel S. Marcus, Esq.

Any party, by giving notice to the others in the manner provided above, may change such party's address for purposes of this Paragraph 6.

IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 4 to be executed as of the first day written above by their duly authorized representatives in a manner legally binding upon them.

KIRIN BREWERY CO., LTD., a
Japanese corporation

BY /s/ Yasushi Yamamoto
   Yasushi Yamamoto,
   Managing Director

"Kirin"

AMGEN, a California corporation

By /s/ George B. Rathmann
   George B. Rathmann,
   President
                    "Amgen"

KIRIN-AMGEN, Inc., a
California corporation

By /s/ Y. Yamamoto
   Yasushi Yamamoto its Chairman

                    "Corporation"

WHEREAS Amgen, a California corporation, having a place of business at 1900 Oak Terrace Lane, Thousand Oaks, Calfornia 91320 is, by virtue of an Assignment dated September 13, 1985 and recorded in the United States Patent and Trademark Office on November 6, 1985 at Reel 4475, Frame 913, the owner of the entire right, title and interest in and to the invention and improvements of Lawrence M. Souza disclosed in application Serial No. 768,959 executed by Lawrence M. Souza on September 13, 1985 and filed August 23, 1985 for Letters Patent of the United States and in said application and any and all other applications, both United States and foreign, which Lawrence M. Souza may file, either solely or jointly with others, on said invention or improvements, and in any and all Letters Patent of the United States and foreign countries which may be obtained of any of said applications, and in any reissue or extension thereof.

WHEREAS Amgen is, by virtue of an Assignment dated March 10, 1986 and recorded in the United States Patent and Trademark Office on June 16, 1986 at Reel 4560, Frame 409, the owner of the entire right, title and interest in and to the invention and improvements of Lawrence M. Souza disclosed in application Serial No. 835,548 executed by Lawrence M. Souza on March 10, 1986 and filed March 3, 1986 for Letters Patent of the United States and in said application and any and all other applications, both United States and foreign, which Lawrence M. Souza may file, either solely or jointly with others, on said invention or improvements, and in any and all Letters Patent of the United States and foreign countries which may be obtained on any of said applications, and in any reissue or extension thereof.

WHEREAS, Lawrence M. Souza in the aforesaid Assignments did thereby agree, upon the request and at the expense of Amgen, its successors and assigns, to execute any and all divisional, continuation, continuation-in-part applications for said inventions or improvements, and any necessary oath or affidavit relating thereto, and any application for reissue or extension of any Letters Patent that may be granted upon said applications, and any and all applications and other documents for Letters Patent in foreign countries on said inventions or improvements that Amgen, its successors or assigns, may deem necessary or expedient, and Lawrence M. Souza did further thereby agree upon the request of Amgen, its successors or assigns, in the event of any application or Letters Patent assigned thereunder becoming involved in Interference, to cooperate to the best of his ability with Amgen, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, and Lawrence M. Souza did also thereby agree to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein in Amgen, its successors or assigns, whereby said Letters Patent will be held and enjoyed by Amgen, its successors or assigns, to the full end of the term for which said Letters patent may be granted as fully and entirely as the same would have been held and enjoyed by Lawrence M. Souza if his assignment and sale had not been made.

WHEREAS, Amgen warrants itself to be the owner of the interest herein assigned and to have the right to make this assignment and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.

WHEREAS, Kirin-Amgen, Inc., a California corporation, having a place of business at 1900 Oak Terrace Lane, Thousand Oaks, California 91320 is desirous of acquiring from Amgen of the entire right, title and interest in and to the aforesaid patent applications and the inventions and improvements therein described and claimed.

NOW, THEREFORE, in consideration of the sum of One Dollar ($1.00) and other good and valuable consideration, the receipt and sufficiency whereof are hereby acknowledged by Amgen, Amgen hereby assigns, sells, transfers and conveys to Kirin-Amgen, Inc., its successors and assigns, its entire right, title and interest in and to the aforesaid applications, inventions and improvements and any Letters Patent of the United States or foreign countries, or reissues or extensions thereof.

Specifically assigned, sold, transferred and conveyed hereunder by Amgen to Kirin-Amgen, Inc., its successors and assigns, is the right, heretofore owned in its entirety by Amgen, to initiate and maintain, without joinder of any other party, any infringement suits based on any Letters Patent of the United States or foreign countries, or reissues or extensions thereof, and the right, heretofore owned in its entirety by Amgen, to enforce against Lawrence M. Souza all agreements and obligations undertaken by him in the aforesaid Assignments to the extent that such agreements and obligations pertain to applications, inventions, improvements, Letters Patent of the United States and foreign countries, or reissues or extensions thereof, and Interferences involving same, whereby all rights under said Letters Patent will be held and enjoyed by Kirin- Amgen, Inc., its successors and assigns, to the full end of the term for which said Letters patent may be granted

as fully and entirely as the same would have been held and enjoyed by Amgen if this assignment had not been made.

Amgen

                                         By  /s/ Gordon M. Binder
                                             --------------------------
                                             Sr. Vice President

Dated: August 11, 1986

                   ) SS
COUNTY of VENTURA  )
                              .

[SEAL]     OFFICIAL SEAL
           BARBARA L TIPTON
       NOTARY PUBLIC - CALIFORNIA
            LOS ANGELES COUNTY

Sole Inventor

ASSIGNMENT

March 3, 1986

Filed
"PRODUCTION OF PLURIPOTENT GRANULOCYTE

Title: COLONY-STIMULATING FACTOR

The undersigned hereby authorizes and requests the attorneys of record in said application to insert in this assignment the date and serial number of said application when officially known.

The undersigned warrants himself to be the owner of the interest herein assigned and to have the right to make this assignment; and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.

For said consideration the undersigned hereby agrees, upon the request and at the expense of said assignee, its successors and assigns, to execute any and all divisional, continuation, continuation-in-part and substitute applications for said invention or improvements, and any necessary oath or affidavit relating thereto, and any application for the reissue or extension of any Letters Patent that may be granted upon said application, and any and all applications and other documents for Letters Patent in foreign countries on said invention or improvements, that said assignee, its successors or assigns, may deem necessary or expedient, and for the said consideration the undersigned further agrees upon the request of said assignee, its successors or assigns, in the event of any application or Letters Patent assigned herein becoming involved in Interference, to co-operate to the best of the ability of the undersigned with said assignee, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, the undersigned hereby agreeing to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein hereby conveyed in the said assignee, its successors and assigns, whereby said Letters Patent will be held and enjoyed by the said assignee, its successors and assigns, to the full end of the term for which said Letters Patent may be granted as fully and entirely as the same would have been held and enjoyed by the undersigned if this assignment and sale had not been made.

WITNESS my hand and seal, this 10 day of March Nineteen Hundred and 86.

State of California

                                          /s/ Lawrence M. Souza
                                             ------------------
County of Ventura
                                              LAWRENCE M. SOUZA

On this    10/th/ day of March, 1986       1986 - before me, a Notary Public in
                                                  and

 for the County and State aforesaid, appeared    Lawrence M. Souza
                                                 -----------------

                                                         /s/ Lawrence M. Souza
                                                             JUN 16 186

to me personally known to be the same person whose name is subscribed to the foregoing instrument, and acknowledged that he executed said instrument as his free and voluntary act and for the uses and purposes therein expressed. WITNESS my hand and seal the day and year last above given.

My commission Expires  12/17/86

                                                  Notary Public
                                                  Barbara L. Tipton

Filed     August 23, 1985

Title     "Production of Pluripotent Granulocyte Colony-Stimulating
          Factor"

The undersigned warrants himself to be the owner of the interest herein assigned and to have the right to make this assignment; and further warrants that there are no outstanding prior assignments, licenses, or other rights in the interest herein assigned.

its successors and assigns, __________________________________________ to execute any and all divisional, continuation, continuation-in-part and substitute applications for said invention or improvements, and any necessary oath or affidavit relating thereto, and any application for the reissue or extension of any Letters Patent that may be granted upon said application, and any and all applications and other documents for Letters Patent in foreign countries on said invention or improvements, that said assignee, its successors or assigns, may deem necessary or expedient, and for the said consideration the undersigned further agrees upon the request of said assignee, its successors or assigns, in the event of any application or Letters Patent assigned herein becoming involved in Interference, to co-operate to the best of the ability of the undersigned with said assignee, its successors or assigns, in the matters of preparing and executing the preliminary statement and giving and producing evidence in support thereof, the undersigned hereby agreeing to perform, upon request, any and all affirmative acts to obtain said Letters Patent, both United States and foreign, and vest all rights therein hereby conveyed in the said assignee, its successors and assigns, whereby said Letters Patent will be held and enjoyed by the said assignee, its successors and assigns, to the full end of the term for which said Letters Patent may be granted as fully and entirely as the same would have been held and enjoyed by the undersigned if this assignment and sale had not been made.

WITNESS my hand and seal, this       13         day of  September Nineteen
                               -----------------        ----------
Hundred and Eighty-Five.


State of California                  RECORDED
         -----------
County of Ventura

                                                        Lawrence M. Souza

On this 13/th/ day of September, 1985, before me, a Notary Public in and

for the County and State aforesaid, appeared Lawrence M. Souza

to me personally known to be the same person whose name is subscribed to the foregoing instrument, and acknowledged that he executed said instrument as his free and voluntary act and for the uses and purposes therein expressed. WITNESS my hand and seal the day and year last above given.

BY AND BETWEEN

KIRIN BREWERY CO., LTD.,

a Japanese corporation,

and

KIRIN-AMGEN, INC.,

a California corporation

Dated: July 1, 1986

EXHIBIT "C"

TABLE OF CONTENTS (cont'd.)

                                                                           PAGE
                                                                           ----
RECITALS................................................................      1
I.         TRANSFER OF TECHNOLOGY.......................................      1

           1.01    Assignment of G-CSF Transferred Technology...........      1
           1.02    Limitations..........................................      1

II.        DEFINITIONS..................................................      1

           2.01    Incorporation by Reference...........................      1

           2.02    G-CSF (PPO) Technology...............................      2

III.       DISCLAIMER OF INDEMNIFICATION................................      2

           3.01    Disclaimer of Warranties.............................      2

IV.        TERM AND TERMINATION.........................................      2

           4.01    Term.................................................      2

V.         CONSISTENCY WITH SHARHOLDERS' AGREEMENT......................      2

           5.01  Shareholders' Agreement................................      2

VI.        CONSENTS AND APPROVALS.......................................      2

           6.01    Best Efforts.........................................      2

VII.       NOTICE.......................................................      3

           7.01    Notices..............................................      3

VIII.      MISCELLANEOUS................................................      3

           8.01    Entire Agreement.....................................      3

           8.02    Headings.............................................      4

           8.03  Execution in Counterparts..............................      4
           8.04    Force Majeure........................................      4
           8.05    Applicable Law.......................................      4
           8.06    Assignment on Written Consent........................      4
           8.07    Severability.........................................      4
           8.08    No Waiver............................................      4
           8.09    Trademarks and Tradenames............................      4
           8.10    Indemnity............................................      5
           8.11    Other Agreements.....................................      5
           8.12    Attorney's Fees and Costs............................      5
           8.13    Remedies.............................................      5
           8.14    Binding Effect.......................................      5

        8.15   Exhibits.......................................    5
        8.16   Number and Gender..............................    6
        8.17   Representations................................    6
        8.18   Agreement to-Perform Necessary Acts............    6

SIGNATURE PAGE................................................    6

SCHEDULE "A"-TRANSFERRED TECHNOLOGY

ASSIGNMENT AGREEMENT

THIS ASSIGNMENT AGREEMENT ("Agreement") is made and entered into this 16th day of October, 1986, and is made effective as of the lst day of July, 1986, by and between KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), in favor and for the benefit of and with KIRIN-AMGEN, INC., a California corporation ("Company"), pursuant to terms and conditions of that certain Amendment No. 4 to the Shareholders' Agreement, dated May 11, 1984 (collectively "Shareholders' Agreement"), by and among Kirin, Company and Amgen, a California corporation ("Amgen").

R E C I T A L S

WHEREAS, Kirin, Amgen and Company have heretofore executed Amendment No. 4 to the Shareholders' Agreement regarding the simultaneous transfer of Kirin's G-CSF (PPO) Transferred Technology (as defined in Section 2.02 hereof) and Amgen's G-CSF (PPO) Transferred Technology to Company, together with a license of Amgen's Core Technology in the Field of Activity with respect to G-CSF to Company, and

WHEREAS, the parties desire to formalize Kirin's transfer as described in the immediately preceding Recital,

NOW, THEREFORE, it is agreed as follows:

1.02 Limitations. No right or license is granted to the Company hereunder except as expressly specified in
Section 1.01 hereof.

obtained from any governmental authority with respect to the provisions hereof.

"Kirin"              Kirin Brewery Co., Ltd.
                     26-1, Jingumae 6-chome
                     Shibuy-ku, Tokyo 150
                     Japan
                     Telex No. 242-5401 KIRINB J
                     Attn:  General Manager of
                            Pharmaceuticals Department

"Company"            Kirin-Amgen, Inc.
                     1900 Oak Terrace Lane
                     Thousand Oaks, CA 91320
                     U.S.A.
                     Telex No. 499440 (AMGEN)
                     Attn:  Corporate Secretary

With a copy to:      PETTIT & MARTIN
                     355 South Grand Avenue
                     Thirty-Third Floor
                     Los Angeles, California 90071
                     U.S.A.
                     Telex No. 181025 Pemlaw LSA
                     Attn:  Joel S. Marcus, Esq.

Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 7.01.

hereof and may not be modified except by a writing signed by authorized representatives of the parties hereto.

IN WITNESS WHEREOF, Kirin and the Company have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

KIRIN BREWERY CO., LTD.,
a Japanese corporation

By:  /s/ Yasushi Yamamoto,
     Yasushi Yamamoto,
     Managing Director

KIRIN-AMGEN, INC., a California corporation

By:  /s/ George B. Rathmann
     George B. Rathmann, President

U.S. Patent Application Ser. No. 768959, Filed August 23, 1985, entitled Production of Pluripotent Granolocyte Colony-Stimulating Factor, recorded in the Patent and Trademark Office on Reel 4476, Frame 913.

SCHEDULE A

Pursuant to the Minutes of Corporation dated July 1, 1986, the parties have made certain business agreements regarding non-dialysis indications for EPO and wish to formalize said agreements.

NOW, THEREFORE, it is agreed as follows:

Corporation shall not reimburse either Kirin or Amgen for non-dialysis expenses relating to the EPO project.

Neither Kirin nor Amgen shall have the obligation to pay to Corporation any royalties with respect to sales of EPO for non-dialysis indications.

IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 5 to be executed as of the first day written above

by their duly authorized representatives in a manner legally binding upon them.

KIRIN BREWERY CO., LTD., a
Japanese corporation

By /s/ Yashushi Yamamoto
   Yashushi Yamamoto
   Managing Director
                      "Kirin"

AMGEN, a California corporation

By /s/ George B. Rathmann
   George B. Rathmann,
   President
                      "Amgen"

KIRIN-AMGEN, Inc., a
California corporation

By /s/ Yasushi Yamamoto
Yashushi Yamamoto its Chairman
                      "Corporation"

BY AND BETWEEN

AMGEN,

a California corporation,

and

KIRIN-AMGEN, INC.,

a California corporation

Dated July 1, 1986

TABLE OF CONTENTS

                                                                                    PAGE
                                                                                    ----
RECITALS.......................................................                       1
I.     TRANSFER AND LICENSE OF TECHNOLOGY......................                       1
       1.01 Assignment of Transferred G-CSF Technology.........                       1
       1.02 License of Core Technology.........................                       1
       1.03 Right to Sublicense the Core Technology............                       2
       1.04 Limitations........................................                       2

II.    DEFINITIONS.............................................                       2

       2.01 Incorporation by Reference.........................                       2
       2.02 G-CSF (PPO) Technology.............................                       2

III.   DISCLOSURE OF CORE TECHNOLOGY...........................                       3

       3.01 Limitation on Usage................................                       3
       3.02 Survival...........................................                       3

IV.    PATENT, COPYRIGHT AND TRADE SECRET ENFORCEMENT..........                       3

       4.01 Enforcement........................................                       3
       4.02 Notice of Infringements............................                       4

V.     PATENT APPLICATIONS AND COPYRIGHT REGISTRATIONS.........                       4

       5.01 Applications.......................................                       4

VI.    DISCLAIMER OF INDEMNIFICATION...........................                       4

       6.01 Disclaimer of Warranties...........................                       4

VII.   TERM AND TERMINATION....................................                       4

       7.01 Term...............................................                       4
       7.02 Default............................................                       4
       7.03 Continuing Obligations.............................                       5

TABLE OF CONTENTS (Cont'd)

                                                                                    PAGE
                                                                                    ----

VIII. CONSISTENCY WITH SHARHOLDERS' AGREEMENT

      8.01   Shareholders' ...............................................            5

IX.   CONSENTS AND APPROVALS .............................................            5

      9.01   Best Efforts.................................................            6

X.    NOTICE

      10.01  Notices .....................................................            6

XI.   MISCELLANEOUS ......................................................            7

      11.01   Entire Agreement............................................            7
      11.02   Headings....................................................            7
      11.03   Execution in Counterparts...................................            7
      11.04   Force Majeure...............................................            7
      11.05   Applicable Law..............................................            7
      11.06   Assignment on Written Consent...............................            7
      11.07   Severability................................................            7
      11.08   No Waiver...................................................            7
      11.09   Trademarks and Tradenames...................................            8
      11.10   Indemnity...................................................            8
      11.11   Other Agreements............................................            8
      11.12   Attorney's Fees and Costs...................................            8
      11.13   Remedies....................................................            8
      11.14   Binding Effect..............................................            9
      11.15   Exhibits....................................................            9
      11.16   Number and Gender...........................................            9
      11.17   Representations.............................................            9
      11.18   Agreement to Perform Necessary Act..........................            9

SCHEDULE "A"

      TRANSFERRED TECHNOLOGY..............................................          10

ASSIGNMENT AND LICENSE AGREEMENT

THIS ASSIGNMENT AND LICENSE AGREEMENT ("Agreement") is made and entered into this 16th day of October, 1986, and is made effective as of the 1st day of July, 1986, by and between AMGEN, a California corporation ("Amgen"), in favor and for the benefit of and with KIRIN-AMGEN, INC., a California corporation ("Company"), pursuant to terms and conditions of that Amendment No. 4 to the Shareholders' Agreement, dated May 11, 1984 (collectively "Shareholders' Agreement"), by and among Amgen, Company and Kirin Brewery Co., Ltd., a Japanese corporation ("Kirin").

R E C I T A L S

WHEREAS, Kirin, Amgen and Company have heretofore executed Amendment No. 4 to the Shareholders' Agreement regarding the simultaneous transfer of Kirin's G- CSF (PPO) Transferred Technology (as defined in Section 2.02 hereof) and Amgen's G-CSF (PPO) Transferred Technology to Company, together with a license of Amgen's Core Technology in the Field of Activity with respect to G-CSF to Company, and

WHEREAS, the parties desire to formalize Amgen's transfer and license as described in the immediately preceding Recital,

NOW, THEREFORE, it is agreed as follows:

creditors or otherwise acknowledge insolvency, or be adjudged bankrupt, (c) go or be placed in a process of complete liquidation other than in connection with a continuation of the business of the Company in some other legal form, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment; then, and in any such event, the non-breaching party, at its option, may terminate its obligations to and the rights of the Defaulting Party under the license to the Core Technology granted under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.

"Amgen"              Amgen
                     1900 Oak Terrace Lane
                     Thousand Oaks, CA 91320
                     U.S.A.
                     Telex No. 4994440 (AMGEN)
                     Attn:  Corporate Secretary

With a copy to:      Cooley, Godward, Castro,
                          Huddleson & Tatum
                     One Maritime Plaza, 20th Floor
                     San Francisco, CA 94111
                     U.S.A.
                     Telex No. 910-372-7370 Cooley SFO
                     Attn:  Alan C. Mendelson, Esq.

"Company"            Kirin-Amgen, Inc.
                     1900 Oak Terrace-Lane
                     Thousand Oaks, CA 91320
                     U.S.A.
                     Telex No. 4994440 (AMGEN)
                     Attn:  Corporate Secretary

With a copy to:      PETTIT & MARTIN
                     355 South Grand Avenue
                     Thirty-Third Floor
                     Los Angeles, California 90071
                     U.S.A.
                     Telex No. 181025 Pemlaw LSA
                     Attn:  Joel S. Marcus, Esq.

Any Party by giving notice to the others in the manner provided above may change such Party's address for purposes of this Paragraph 10.01.

other or further exercise thereof or the exercise of any other right, power or remedy hereunder or the remedies provided by law.

IN WITNESS WHEREOF, Amgen and the Company have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

AMGEN, a California corporation

By:  /s/ George B. Rathmann
    George B. Rathmann Its President

KIRIN-AMGEN, INC., a California corporation

By:  /s/ Y. Yamamoto
     Yasushi Yamamoto Its Chairman

U.S. Patent Application Ser. No. 768959, Filed August 23, 1985, entitled Production of Pluripotent Granolocyte Colony-Stimulating Factor, recorded in the Patent and Trademark Office on Reel 4475 Frame 913.

SCHEDULE A

G-CSF EUROPEAN LICENSE AGREEMENT

by and between

KIRIN-AMGEN, INC.,

a California corporation

and

AMGEN,

a California corporation

Dated: December 30, 1986

                                                                         Page
                                                                         ----
RECITALS................................................................    1

I.   DEFINITIONS........................................................    2
     1.01   Incorporation by Reference..................................    2
     1.02   Territory...................................................    2
     1.03   Party.......................................................    2
     1.04   G-CSF Products..............................................    2
     1.05   Subsidiary..................................................    2
     1.06   Net Sales...................................................    3
     1.07   Sales value.................................................    3

II.  GRANT OF LICENSE...................................................    3

     2.01   Grant of License............................................    3
     2.02   Rights to Sublicense........................................    3
     2.03   License Fee.................................................    5

III. DISCLOSURE.........................................................    6

     3.01   Disclosure..................................................    6
     3.02   Confidentiality.............................................    6

IV.  ROYALTY............................................................    8

     4.01   Royalty.....................................................    8
     4.02   Sales to Subsidiaries.......................................    8
     4.03   Payment of Royalties to Sloan Kettering Cancer Center.......    8
     4.04   Records.....................................................    9
     4.05   Terms of Accounting.........................................    9
     4.06   Late Payments...............................................   10
     4.07   Payments....................................................   11
     4.08   Taxes.......................................................   11

V.   CLINICAL TRIAL EXPENSE REIMBURSEMENT, TERMINATION OF COMPANY
     FUNDING AND NO FURTHER DATA TRANSFER...............................   11

     5.01   Reimbursement of European Clinical Trial Expenses...........   11

     5.02   Termination of Company Funding..............................   11

VI.  PATENT APPLICATIONS................................................   12

     6.01   Patent Applications.........................................   12

                                                                         Page
                                                                         ----
VII.    PATENT AND TRADE SECRET ENFORCEMENT.............................   12

        7.01 Enforcement................................................   12
        7.02 Infringements..............................................   13
        7.03 Maintenance of Action......................................   13

VIII.   TERM AND TERMINATION............................................   15

        8.01 Term.......................................................   15
        8.02 Effective Date.............................................   15
        8.03 Default....................................................   15
        8.04 Survival...................................................   16

IX.     INFRINGEMENTS...................................................   16

        9.01 Infringements..............................................   16

X.      CONSENTS AND APPROVALS..........................................   17

        10.01 Best Efforts..............................................   17

XI.     NOTICE..........................................................   17

        11.01 Notices...................................................   17

XII.    MISCELLANEOUS...................................................   18

        12.01 Entire Agreement..........................................   18
        12.02 Headings..................................................   19
        12.03 Execution in Counterparts.................................   19
        12.04 Force Majeure.............................................   19
        12.05 Applicable Law............................................   19
        12.06 Assignment on Written Consent.............................   20
        12.07 Severability..............................................   20
        12.08 No Waiver.................................................   20
        12.09 Trademarks and Tradenames.................................   20
        12.10 Indemnity.................................................   21
        12.11 Other Agreements..........................................   21
        12.12 Remedies..................................................   21
        12.13 Attorneys' Fees and Costs.................................   22
        12.14 Number and Gender.........................................   22
        12.15 Agreement to Perform Necessary Acts.......................   22
        12.16 Representations...........................................   23

SIGNATURE PAGE..........................................................   23

EXHIBIT "A" - TERRITORY OF EUROPE

THIS AMGEN/KIRIN-AMGEN, INC. G-CSF EUROPEAN LICENSE AGREEMENT ("Agreement") is made and entered into and is made effective as of this 30th day of December, 1986, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN, a California corporation, in the process of reincorporating in Delaware ("Amgen").

R E C I T A L S

WHEREAS, effective July 1, 1986, KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), and Amgen assigned all of their right, title and interest in and to the G-CSF Technology (as defined herein) to Company,

WHEREAS, Kirin and Amgen have each been granted a license by Company for the development, manufacture and sale of G-CSF Products (as defined herein), in Japan with respect to Kirin, and in the United States with respect to Amgen, and

WHEREAS, Company now desires to grant to Amgen an exclusive license to further develop, manufacture, and sell G-CSF Products for the territory of Europe (as defined herein),

NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:

ARTICLE I

expression system which will enable the achievement of a high level of expression and purification to produce sufficient materials for commercial development and marketing) for the manufacture of G-CSF Products (as defined herein).

ARTICLE II

(a) Amgen shall have no right to grant sublicenses for the marketing of G-CSF Products in the United Kingdom, France or Germany.

(b) The Company grants to Amgen the right to grant sublicenses for the manufacturing and marketing of G-CSF

Products only to an Amgen subsidiary in Italy, Belgium, The Netherlands, Luxembourg and Spain; provided, however, that Amgen shall have the right to grant sublicenses to a third party in any of the countries set forth in the preceding part of this sentence if local governmental laws, regulations, rules or policies militate that Amgen contract with a local third party in such country in order to effectively market G-CSF Products in such countries.

(C) The Company grants to Amgen the right to grant sublicenses for the marketing of G-CSF products in countries other than those listed in Subparagraphs (a) and (b) of this Paragraph 2.02 within the limit and the scope of the right and license granted by the Company to Amgen in Paragraph 2.01 hereof.

No sublicenses shall be granted under subparagraphs (b) and (c) hereof without the prior written consent (which consent is not to be unreasonably withheld) of the Company. Any sublicensees of Amgen shall undertake in writing to be bound by the provisions of Section 3.02 hereof to the same extent Amgen is bound. Amgen shall notify the Company of the identity of each sublicensee to whom a sublicense is granted and provide the Company a true copy of such sublicense. In the event that the license granted to Amgen hereunder is terminated at any time in accordance with Article VIII, and the Company shall not be in default under Section 8.03, the Company shall have the option to terminate or to have Amgen assign to

the Company, retroactive to the date of such termination, any sublicenses granted hereunder by Amgen to any Subsidiary of Amgen. Amgen shall include, in all its sublicenses granted hereunder to any Subsidiary of Amgen, provisions for such termination and assignment.

(a) $1,000,000 (U.S.) - Execution of this Agreement;

(b) $500,000 (U.S.) - Publication of the Company's PCT Patent Application 86/01708, but in no event later than March 31, 1987;

(c) $1,500,000 (U.S.) - Filing Registration in any country in the Territory;

(d) $1,500,000 (U.S.) - Approval of Registration in any major country in the Territory; and

(e) $1,500,000 (U.S.) - Commencement of Marketing in any country in the Territory.

ARTICLE III

(a) The Company shall, in accordance with the Shareholders' Agreement, reasonably disclose and deliver to Amgen all G-CSF Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.

(b) Amgen shall have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the G-CSF Technology. Amgen shall be provided with reasonable notice of the time and place of such meetings.

(a) Any secret or confidential G-CSF Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:

(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and

(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Amgen within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.

(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, or by another prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential G-CSF Technology disclosed or provided to Amgen by the Company. For the purposes of this Agreement, G-CSF Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:

(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;

(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure;

(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Amgen in breach of this Agreement; or

(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality.

Amgen may disclose any G-CSF Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the G-CSF Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.

(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.

ARTICLE IV

and Sloan-Kettering Cancer Center ("S-K") dated February 12, 1986, certain royalties are to be paid to S-K with respect to sales of G-CSF Products. The parties hereto agree that Company and Amgen shall equally bear and assume responsibility for the payments of any and all royalties due S-K for sales of G- CSF Products in Europe pursuant to the S-K/Amgen Agreement.

(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st,

commencing with the semiannual period within which is made the first sale of G- CSF Products by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all G-CSF Products sold during such semiannual period, the Sales Value of such G-CSF Products and the amount of royalty payable thereon (or if no G-CSF Products have been so sold, showing that fact).

(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.

(c) Amgen shall furnish whatever additional information the Company may reasonable prescribe from time to time to enable the Company to ascertain which G-CSF Products sold by Amgen or any of its Subsidiaries or sublicensees permitted under this Agreement are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.

ARTICLE V

CLINICAL TRIAL EXPENSE REIMBURSEMENT,

TERMINATION OF COMPANY FUNDING AND NO

cessation of such Company funding, Amgen shall no longer have any obligation to transfer any data to Company regarding that country with respect to G-CSF Technology. Notwithstanding the foregoing, Company shall have the continuing obligation with respect to the filing of patent applications as set forth in
Section 6.01 hereof.

ARTICLE VI

ARTICLE VII

property right relating to the G-CSF Technology that Amgen shall have obtained pursuant to this Agreement.

proceed. The Company shall have the first right, but no obligation, to bring or defend any suit or action on any claim involving such infringement of any such patent of the G-CSF Technology on such terms relating to reimbursement of associated costs and expenses as shall be agreed to. If the Company finds it necessary or desirable to join Amgen in such suit or action, Amgen shall execute all papers and perform such other acts as may be reasonably required to do so and may, at its option, be represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement, after payment to the Company of such reasonable

costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.

ARTICLE VIII

continuation of the business of the Company in some other legal form, or (d) suffer the appointment of a receiver for any substantial portion of its business who shall not be discharged within sixty (60) days after his appointment, then, and in any such event, any other Party, at its option, may terminate its obligations to and the rights of the Defaulting Party under this Agreement upon ten (10) days' written notice to the Defaulting Party, which termination shall be effective as of the occurrence of the event giving rise to the option to terminate.

ARTICLE IX

patent rights or proprietary rights of others by reason of the exploitation by Amgen of G-CSF Technology or any component thereof, then the Company shall indemnify and hold Amgen harmless from such claim to the full extent of any damage recovery with respect to such claim and legal costs incurred in Amgen's defense.

ARTICLE X

ARTICLE XI

"Amgen"                  Amgen
                         1900 Oak Terrace Lane
                         Thousand Oaks, CA 91320
                         U.S.A.
                         Telex No. 499-9315 (AMGEN)
                         Attn: Corporate Secretary

With a copy to:          Cooley, Godward, Castro,
                          Huddleson & Tatum
                         One Maritime Plaza, 20th Floor
                         San Francisco, CA 94111
                         U.S.A.
                         Telex No. 910-372-7370 Cooley SFO
                         Attn: Alan C. Mendelson, Esq.

"Company"                Kirin-Amgen, Inc
                         1900 Oak Terrace Lane
                         Thousand Oaks, CA 91320
                         U.S.A.
                         Telex No. 4994440 (AMGEN)
                         Attn: Corporate Secretary

With a copy to:          Pettit & Martin
                         355 South Grand Avenue
                         Thirty-Third Floor
                         Los Angeles, CA 90071
                         Telex No. 181025 PEMLAW LSA
                         Attn: Joel S. Marcus, Esq.

Any party by giving notice to the others in the manner provided above may change such party's address for purposes of this Section 11.01.

ARTICLE XII

by authorized representatives of the parties hereto. To the extent that there may be conflicts or inconsistencies between the provisions of this Agreement and those contained in the Shareholders' Agreement, the provisions of the Shareholders' Agreement shall prevail and govern interpretation.

or hereafter existing at law or in equity or by statute or otherwise and the exercise or beginning of the exercise by any party of any one or more of such rights, powers or remedies shall not preclude the simultaneous or later exercise by any party of any or all such other rights, powers or remedies.

IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

KIRIN-AMGEN, INC., a
California corporation

By   /s/ George B. Rathmann
              Its President
                  ---------
                      "Company"

AMGEN, a California corporation, in the process of reincorporating in Delaware

By  /s/ Robert D. Weist
              Its Sr. Vice President
                  ------------------
                      "Amgen"

EXHIBIT 10.12

AMGEN RETIREMENT
AND SAVINGS PLAN
(As Amended and Restated Effective October 23, 2000)

(As Amended and Restated Effective October 23, 2000)

The Plan was adopted effective as of April 1, 1985. The Plan was last amended and restated as of April 1, 1996, to reflect previously adopted amendments and to make other changes. Certain provisions may be effective at other times, as specified. The Plan is intended to qualify under Sections 401(a) and 401(k) and related sections of the Code, and under Section 407(d)(3)(A) of ERISA. The Plan is subject to amendment or termination at any time, including (without limitation) amendments required to meet regulations and rules issued by the Secretary of the Treasury or his or her delegate or the Secretary of Labor. Certain capitalized terms used in the text of the Plan are defined in Article 2 in alphabetical order.

2.6   "Annual Additions" which is a term used in specifying certain limitations
       ----------------
      on Plan contributions, is defined in Section 16.5.

2.7   "Annual Deferral Limit" which is a term used in specifying certain
       ---------------------
      limitations on Plan contributions, is defined in Section 13.9.

2.8   "Beneficiary" means the person or persons entitled to receive a
       -----------
      Participants Plan Benefit after the Participant's death, as provided in
      Section 8.12.

2.9   "Board" means the Board of Directors of the Company, as constituted from
       -----
      time to time.

2.10  "Break in Service" means any Plan Year during which the Participant
       ----------------
      completes less than 501 Hours of Service. Solely for the purpose of
      determining whether a Break in Service has occurred, an Employee who is
      absent from work by virtue of (a) the Employee's pregnancy, (b) the birth
      of the Employee's child, (c) the placement of a child with the employee by
      adoption, (d) the change for any such child for a period of up to one year
      immediately following such birth or placement, (e) Disability, (f) service
      in the armed forces of the United States during a period (including a
      post-discharge period) that entitles the Employee to reemployment rights
      guaranteed by law or (g) a leave of absence taken under the terms of the
      federal Family Medical Leave Act or applicable state family and medical
      leave act, shall be credited with up to 501 additional Hours of Service.
      Such additional Hours of Service in such period of absence shall be based
      on his or her regular work schedule immediately prior to such period;
      provided, however, that such additional Hours of Service shall be credited
      during the Plan Year in which the absence from work begins only if they
      would prevent a Break in Service from occurring for that year. In all
      other cases, the additional Hours of Service shall be credited during the
      immediately following Plan Year.

2.11  "Code" means the Internal Revenue Code of 1986, as amended from time to
       ----
      time.

2.12  "Company" means Amgen Inc., a Delaware corporation.
       -------

2.13  "Company Contributions" means Matching Contributions, Nonelective
       ---------------------
      Contributions, Qualified Nonelective Contributions and Qualified Matching
      Contributions.

2.14  "Company Stock" means shares of common stock issued by the Company.
       -------------

2.15  "Company Stock Fund" means an Investment Fund primarily invested in
       ------------------
      Company Stock.

      amount with respect to which Plan contributions are made and means an
      Eligible Employee's wages, salaries, fees for professional services, and
      other amounts received (without regard to whether or not an amount is paid
      in cash) for personal services actually rendered in the course of
      employment with any member of the Affiliated Group to the extent that the
      amounts are includable in gross income (including, but not limited to,
      commissions paid to salespersons, compensation for services on the basis
      of a percentage of profits, commissions on reimbursements or other expense
      allowances under a nonaccountable plan (as described in Treasury
      Regulation Section 1.62-2(c)), but excluding any "goods and services
                                         ---------
      allowance" provided to certain expatriate staff members. "Compensation"
      shall be computed without regard to any election to reduce or defer salary
      under this Plan or any cafeteria plan under Section 125 of the Code.
      "Compensation" shall not include: (a) any Company Contributions to this
      Plan or any other employee benefit plan for or on account of the Employee,
      except as otherwise provided in the preceding sentence; (b) the items
      described in Treasury Regulation Section 1.415-2(d)(3), which, among other
      items, would exclude from compensation amounts realized from the exercise
      of a nonqualified stock option (or when restricted stock (or property)
      held by an Employee either becomes freely transferable or is no longer
      subject to a substantial risk of forfeiture under Section 83 of the Code)
      and amounts realized from the sale, exchange or other disposition of stock
      acquired under a qualified stock option; or (c) amounts in excess of the
      Compensation Limitation.

2.17  "Compensation Limitation" means the limitation in effect under Section
       -----------------------
      401(a)(17) of the Code for the Plan Year.

2.18  "Disability" means that the Participant is determined, under Title II or
       ----------
      XVI of the Social Security Act, to have been disabled at the time of his
      or her termination of employment. In order for a Participant's Accounts to
      become fully vested on account of Disability pursuant to Sections 7.2 and
      7.3 of the Plan, the Participant must submit evidence of the Social
      Security Administration's determination of disability to the Company prior
      to the distribution (or deemed distribution) of the Participant's
      Accounts.

2.19  "Eligible Employee" means an Employee described in Section 3.3.
       -----------------

2.20  "Employee" means an individual who (a) on the Payroll of a member of the
       --------
      Affiliated Group or (b) is a "leased employee" (within the meaning of
      Section 414(n) of the Code) with respect to a member of the Affiliated
      Group. "Employee" shall not include a nonresident alien who receives no
      earned income (within the meaning of Section 911(b) of the Code) from a
      member of the Affiliated Group that constitutes income from sources within
      the United States (within the meaning of Section 861(a)(3) of the Code).

                                       3

2.21  "Employee Contributions" means Participant Elected Contributions and
       ----------------------
      Rollover Contributions.

2.22  "ERISA" means the Employee Retirement Income Security Act of 1974 (P.L.
       -----
      93-406), as amended.

2.23  "Excess Aggregate Contributions" which is a term used in specifying
       ------------------------------
      certain limitations on Plan contributions, is defined in Section 14.7.

2.24  "Excess Contributions" which is a term used in specifying certain
       --------------------
      limitations on Plan contributions, is defined in Section 13.9.

2.25  "Excess Deferrals" which is a term used in specifying certain limitations
       ----------------
      on Plan contributions, is defined in Section 13.9.

2.26  "Exchange Act" means the Securities Exchange Act of 1934, as amended, and
       ------------
      regulations promulgated thereunder.

2.27  "Five-Year Break in Service" means five or more consecutive one-year
       --------------------------
      Breaks in Service.

2.28  "Forfeiture" is defined in Section 7.4.
       ----------

2.29  "Fund" or "Investment Fund" means a separate fund in which contributions
       ----      ---------------
      to the Plan are invested in accordance with Article 6.

2.30  "Hardship Withdrawal" is a partial distribution of a Participant's
       -------------------
      Account made while he or she is an Employee and in the limited
      circumstances described in Section 11.2.

2.31  "Highly Compensated Employee" is defined in Article 12.
       ---------------------------

2.32  "Hour of Service" means:
       ---------------

      (a) Each hour for which an Employee is directly or indirectly paid, or
          entitled to payment, by a member of the Affiliated Group for the
          performance of services;

      (b) Each hour for which an Employee is directly or indirectly paid, or
          entitled to payment, by a member of the Affiliated Group on account of
          a period of time during which no services are performed (without
          regard to whether the employment relationship between the Employee and
          the member of the Affiliated Group has terminated) due to vacation,
          holiday, illness, incapacity, disability, layoff, jury duty, military
          duty or leave of absence with pay; and

                                       4

     (c) Each hour for which an Employee is directly or indirectly paid, or
         entitled to payment of an amount as back pay (without regard to
         mitigation of damages) either awarded or agreed to by a member of the
         Affiliated Group.

         The foregoing notwithstanding:

         (1)  No more than 501 Hours of Service shall be credited to an Employee
              under Subsection (b) or (c) above on account of any single
              continuous period of time during which no services are performed.

         (2)  An hour for which an Employee is directly or indirectly paid or
              entitled to payment by a member of the Affiliated Group on account
              of a period during which no services are performed shall not
              constitute an Hour of Service hereunder if such payment is made or
              due under a plan maintained solely for the purpose of complying
              with applicable workers' compensation, unemployment compensation
              or disability insurance laws.

         (3)  Hours of Service shall not be credited for payments that solely
              reimburse an Employee for medical or medically related expenses.

         (4)  The same Hour of Service shall not be credited to an Employee both
              under Subsection (a) or (b) and under Subsection (c).

         (5)  The computation period to which Hours of Service determined under
              Subsection (b) or (c) are to be credited shall be determined under
              applicable federal law and regulations, including, without
              limitation, Department of Labor Regulation Section 2530.200b-2(b),
              (c) and (d).

         The Company shall determine the number of Hours of Service, if any, to
         be credited to an Employee under the foregoing rules in a uniform and
         nondiscriminatory manner and in accordance with applicable federal laws
         and regulations, including, without limitation, Department of Labor
         Regulation Section 2530.200b-3.

2.35  "Participating Company" means the Company, and any other member of the
       ---------------------
      Affiliated Group that the Company has designated in writing as a
      Participating Company, as set forth on Appendix A.

2.36  "Payroll" means the system used by an entity to pay those individuals it
       -------
      regards as its employees for their services and to withhold federal income
      and employment taxes from the compensation it pays to such employees.
      "Payroll" does not include any system the entity uses to pay individuals
      whom it does not regard as its employees and for whom it does not actually
      withhold federal income and employment taxes (including, but not limited
      to, individuals it regards as independent contractors, consultants or
      employees of temporary employment agencies).

2.37  "Plan" means the Amgen Retirement and Savings Plan, as amended from time
       ----
      to time.

2.38  "Plan Benefit" means the Participant's Accounts under the Plan, to the
       ------------
      extent vested.

2.39  "Plan Year" means the calendar year.
       ---------

2.40  "QDRO" means a qualified domestic relations order (as defined in Section
       ----
      414(p) of the Code).

2.41  "Qualified Joint and Survivor Annuity" means an annuity for the life of
       ------------------------------------
      the Participant with a survivor annuity for the life of his or her spouse
      that is not less than fifty percent (50%) nor more than one hundred
      percent (100%) of the amount of the annuity payable during the joint lives
      of the Participant and his or her spouse. The value of the Qualified Joint
      and Survivor Annuity shall be not less than the value of the Participant's
      nonforfeitable interest in his or her Account.

2.42  "Rollover Contribution" means an amount contributed to the Plan by an
       ---------------------
      Eligible Employee pursuant to Section 4.5.

2.43  "Salary Deferral Agreement" means the agreement between the Participating
       -------------------------
      Company and an Employee to reduce the Employee's Compensation as provided
      for in Article 4.

2.44  "Section 414(s) Compensation" which is a term used in specifying certain
       ---------------------------
      limitations on Plan contributions, is defined in Section 13.9.

2.45  "Section 415 Compensation" which is a term used in specifying certain
       ------------------------
      limitations on Plan contributions, is defined in Section 16.5.

                                       6

2.46  "Section 415 Employer Group" which is a term used in specifying certain
       --------------------------
      limitations on Plan contributions, is defined in Section 16.5.

2.47  "Single Life Annuity" means an annuity under which payments are made to a
       -------------------
      person for his or her life and cease upon his or her death.

2.48  "Top-Paid Group" which is used in the definition of the term "Highly
       --------------
      Compensated Employee", is defined in Section 12.4(a).

2.49  "Total Compensation" which is used in the definition of the term "Highly
       ------------------
      Compensated Employee", is defined in Section 12.4(b).

2.50  "Trust Agreement" means the trust agreement entered into pursuant to the
       ---------------
      Plan by the Company and the Trustee, as amended from time to time.

2.51  "Trustee" means the trustee or trustees appointed by the Company pursuant
       -------
      to the Plan to hold the assets of the Plan in trust, and any successor
      trustee(s) so appointed.

2.52  "Trust Fund" means the trust fund consisting of the assets of the Plan and
       ----------
      maintained by the Trustee pursuant to the Plan and the Trust Agreement.

2.53  "Valuation Date" means the date on which the assets of the Plan are
       --------------
      valued, determined in accordance with the Trust Agreement.

2.54  "Year of Service" means:
       ---------------

      (a) For purposes of vesting, each Plan Year or portion thereof during
          which an Employee is credited with at least 1,000 Hours of Service.

      (b) For purposes of determining eligibility, the first "computation
          period" in which the Employee completes at least 1,000 Hours of
          Service. An Employee's initial computation period is the 12-
          consecutive-month period following the Employee's employment
          commencement date. If the Employee does not complete at least 1,000
          Hours of Service during the first computation period, subsequent
          computation periods are each Plan Year, beginning with the Plan Year
          in which the first anniversary of the Employee's employment
          commencement date falls.

(a) Regular Full-Time Employee. Unless excluded under (c) below, an individual classified by a Participating Company as a "regular full- time employee" is an Eligible Employee.

(b) Regular Part-Time Employee. Unless excluded under (c) below, an individual classified by a Participating Company as a "regular part- time employee" shall become an Eligible Employee upon completion of a Year of Service.

(c) Excluded Individuals. An individual shall not be an Eligible Employee for any period in which he or she is:

(1) Included in a unit of employees covered by a collective- bargaining agreement that does not provide that such individual shall be eligible to participate in the Plan;

(2) Not on the Payroll of a Participating Company, even though such person may be deemed, for any reason, to be an employee;

(3) Subject to an oral or written agreement that provides that such individual shall not be eligible to participate in the Plan;

(4) Employed by a non-U.S. subsidiary of the Company;

(5) Classified by a Participating Company as a "leased employee" (within the meaning of Section 414(n) of the Code) with respect to such Participating Company or would be so classified but for the period-of-service requirement of Code Section 414(n)(2)(B); or

(6) A temporary employee, independent contractor, consultant, or any other person or entity for whom a Participating Company does not withhold federal income and employment taxes from such person's or entity's compensation.

If, during any period, a Participating Company has not regarded an individual as an Employee and, for that reason, has not withheld employment taxes with respect to that individual, then that individual shall not be an Eligible Employee for that period, even in the event that the individual is determined, retroactively, to have been an Employee during all or any portion of that period.

(a) Neither receives nor is entitled to receive any Compensation, including (without limitation) any leave of absence without pay; or

(b) Does not qualify as an Eligible Employee but remains a Participant.

In accordance with Section 10.8 and 11.4, participation is also suspended for 12 months if a Participant defaults on a Plan loan or takes a Hardship Withdrawal. A Participant shall not make Participant Elected Contributions or receive any allocation of Company Contributions with respect to a period of suspended participation, but a suspended Participant's Accounts shall remain invested as a part of the Trust Fund and shall continue to share in the gains, income, losses and expenses of the Trust Fund.

contribution. Subject to the limitations set forth in Section 4.4 and Articles 13-16, the amount of the Participant Elected Contributions shall be equal to any whole percentage of his or her Compensation, as the Participant shall elect, except that this whole percentage shall not exceed 15 percent of his or her Compensation. Participant Elected Contributions shall be made through payroll deductions from the Participant's Compensation. If a Participant elects to make Participant Elected Contributions, the contributions shall be deemed to be employer contributions to the Plan for federal income tax purposes and, to the extent permitted, for purposes of other federal, state and local taxes. A Participant's election to make Participant Elected Contributions shall constitute an election to have the Participant's taxable salary or wages from the Participating Company reduced by the amount of the Participant Elected Contributions.

(a) The contribution is made entirely in the form of U.S. dollars; and

(b) The Eligible Employee demonstrates to the Company's satisfaction that the contribution is a qualifying rollover contribution under Section
402(c)(4), 403(a)(4) or 408(d)(3) of the Code.

If an Eligible Employee who is not a Participant makes a Rollover Contribution, then he or she shall be considered a Participant solely with respect to his or her Rollover Contribution Account until he or she becomes a Participant for all purposes pursuant to Article 3.

A Rollover Contribution shall be paid to the Company in a lump sum in cash and shall be credited to the Participant's Rollover Account. The Participant may direct the investment of his or her Rollover Account by filing the specified investment election form in accordance with such rules as may be established by the Company.

Matching Contributions formula may limit the amount of Participant Elected Contributions that are taken into account for purposes of allocating Matching Contributions or may limit allocations of Matching Contributions to a specified group of Participants; provided, however, that the Matching Contribution formula(s) shall not discriminate in favor of Highly Compensated Employees. A Matching Contribution shall be paid to the Trustee as soon as reasonably practicable after the pay period to which it relates and shall be allocated to the Accounts of Participants as provided in
Section 6.5.

Nonelective Contributions may include a core contribution equal to a specified percentage of Compensation to be made by the Company for each payroll period during the Plan Year.

Employees. Qualified Matching Contributions shall be paid to the Trustee as soon as reasonably practicable following the date as of which they are allocated.

disallowance of the deduction. If a Company Contribution or Participant Elected Contribution is made to the Plan by reason of a mistake of fact, the amount contributed by reason of such mistake (reduced by any losses incurred with respect to such amount) shall be returned to the Participating Companies within one year after the date such contribution was made.

Participant who is entitled to a Matching Contribution pursuant to Section
5.1. Matching Contributions shall be allocated as of the last day of the period for which the Participant received Compensation with respect to which the Matching Contribution is made.

election is made by a Participant (or successor in interest) who is an officer, director, or greater than 10% stockholder of the Company (within the meaning of Section 16 of the Exchange Act and the rules promulgated thereunder) within six months following the date of the most recent election made under any employee benefit plan sponsored by the Company or an Affiliate if (a) both elections involved either an intra-plan transfer involving a fund invested in the Company's equity securities or a cash distribution from the employee benefit plan to the Participant (or successor in interest) funded by a volitional disposition of the Company's equity securities, (b) the prior election involved an acquisition of the Company's equity securities if the current election involves a disposition of the Company's equity securities, or vice versa, and (c) both elections are made at the volition of the Participant (or successor in interest) not in connection with the Participant's death, disability, retirement, termination of employment, or an election which is required to be made available under a provision of the Code. Such a volitional election (considering without regard as to whether or not any similar elections have occurred within six months of such an election) shall be described as a "Discretionary Transaction." On and after July 1, 1996, transfers into the Company Stock Fund shall be limited so that, after any such transfer, no more than 50% of the value of the Participant's aggregate Account is invested in the Company Stock Fund. For purposes of carrying out Investment Fund transfers, the value of the Accounts shall be determined as of the Valuation Date immediately preceding the Participant's transfer election.

(a) If a Participant's employment with a member of the Affiliated Group is terminated after December 31, 1989 and before his or her Normal Retirement Age for any reason other than Disability or death, in addition to the amounts credited to the Accounts identified in Section 7.1, the Participant shall be entitled to an amount equal to the "vested percentage" of his Matching Contributions Account. Such vested percentage shall be determined in accordance with the following schedule.

Years of Service                             Vested
----------------                             Percentage
                                             ----------
Less than 1                                  0%
1 but less than 2                            25%
2 but less than 3                            50%
3 but less than 4                            75%
4 or more                                    100%

(b) In all events, a Participant's Matching Contributions Account shall be fully vested upon termination of his or her employment with the Company on or after attainment of his or her Normal Retirement Age or by reason of Disability or death.

Account or Matching Contributions Account, as applicable, as of the close of the Plan Year in which the rehire occurs, but only if the Participant returns to the service of a Participating Company before incurring a Five- Year Break in Service. To the extent that Forfeitures for the Plan Year in which the Participant is rehired are insufficient to reinstate the rehired Participant's Forfeiture, then the appropriate Participating Company shall make a special contribution in the amount required to reinstate the Forfeiture.

If a Participant who was not fully vested at the time of his or her termination of employment receives a distribution out of his or her vested Account balance and subsequently returns to a Participating Company's service before incurring a Five-Year Break in Service, a separate account for the Participant's remaining interest in the Plan as of the time of the distribution shall be maintained. At any time, the Participant's vested interest in such account shall be an amount "X" determined in accordance with the following formula:

= P(AB + D) - D

For purposes of such formula, "P" is the vested percentage at the relevant time; "AB" is the account balance at the relevant time and "D" is the amount of the prior distribution.

In the event a Participant's service with a Participating Company terminates and no payment of the Participant's nonforfeitable interest is made, the forfeitable amount of the Participant's interest shall be forfeited after the Participant has incurred a Five-Year Break in Service, as of a Valuation Date determined in a uniform and consistent manner by the Company. In the event the Participant returns to the service of a Participating Company before incurring a Five-Year Break in Service, the Participant's Account shall exist as though no forfeiture had taken place.

(a) Years of Service completed prior to any Break in Service shall not be counted in determining a Participant's nonforfeitable interest under the Plan if, at the time of the earlier termination of employment, the Participant did not have any nonforfeitable interest under the Plan to an accrued benefit derived from Nonelective Contributions or Matching Contributions and the number of the Participant's consecutive one-year Breaks in Service equals or exceeds the greater of five (5) or the aggregate number of his or her Years of Service prior to such Break in Service.

(b) In the case of a Participant who incurs a Five-Year Break in Service, Years of Service completed by such Participant after the Five-Year Break in Service shall not be counted to increase the Participant's nonforfeitable

interest in his or her Account as determined prior to the Five-Year Break in Service.

(a) After the Participant's death, Disability or termination of employment for any other reason;

(b) On or after termination of the Plan, provided that (i) neither the Participating Company nor any Affiliate of the Participating Company maintains a successor defined contribution plan (other than an employee stock ownership plan) and (ii) the Participant's distribution is made in the form of a lump sum;

(c) On or after the disposition, to an entity that is not an Affiliate of the Participating Company, of substantially all of the assets used by the Participating Company in a trade or business, but only with respect to a Participant who continues employment with the entity acquiring such assets, and provided that (i) the Participant's distribution is made in the form of a lump sum and (ii) the Participating Company continues to maintain the Plan following such disposition;

(d) On or after the disposition, to an entity that is not an Affiliate of the Participating Company, of the interest of the Participating Company or an Affiliate of the Participating Company in a subsidiary, but only with respect to a Participant who continues employment with such subsidiary, and provided that (i) the Participant's distribution is made in the form of a lump sum and (ii) the Participating Company continues to maintain the Plan following such disposition; or

(e) As required by applicable law or in connection with a QDRO, as provided in Article 9, or an in-service withdrawal, as provided in Article 11.

(a) Except as provided in Sections 8.5, 8.8 and 8.10, and unless a Participant elects otherwise, the distribution of a Participant's Plan Benefit under Section 8.6 shall occur or commence not later than sixty
(60) days after the close of the Plan Year in which occurs the later of (i) the Participant's attainment of Normal Retirement Age or (ii) the Participant's termination of employment. If distribution of a Participant's Plan Benefit has not yet occurred, on or about nine (9) months before the Participant's Normal Retirement Date, the Company shall furnish the Participant with a written explanation of the terms, conditions and forms of distributions available from the Plan including, where applicable, a general description of the Lifetime Annuity (as defined in Section 8.7), and with a description of the procedures for electing a form of distribution.

(b) A Participant may elect to receive or commence receipt of his or her Plan Benefit at any reasonable time after termination of employment. If the Participant elects to receive his or her Plan Benefit, distribution shall in any event commence not later than one (1) year after the end of the Plan Year (i) in which he or she terminates employment after attaining Normal Retirement Age or due to Disability, or (ii) which is the fifth Plan Year following the Plan Year in which he or she otherwise terminates employment (except by reason of his or her death). An election under this Subsection must be made in writing, must be made not more than ninety (90) days before the date the distribution is to occur or commence and must not be made before the Participant receives a written notice describing the material features and explaining the relative values of the optional forms of benefit available under the Plan, in a manner that would satisfy the notice requirements of Section 417(a)(3) of the Code. Not less than thirty
(30) days and not more than ninety (90) days before the Participant's distribution is to occur or commence, the Company shall provide the Participant with such a written notice, which also shall inform

the Participant of his or her right (if applicable) to defer receipt of his distribution until Normal Retirement Age.

(a) A Participant's Plan Benefit shall be distributed in any of the following forms that he or she elects; provided, however, that only a Participant who has an Hour of Service prior to April 1, 1996 may elect a Lifetime Annuity described in Paragraph (5):

(1) A single sum cash distribution;

(2) A single sum distribution in full shares of Company Stock (with the value of any fractional share paid in cash);

(3) A single sum distribution paid in a combination of cash and full shares of Company Stock;

(4) Cash installments paid at least annually over a period certain not exceeding the life expectancy of the Participant or the joint life expectancy of the Participant and his or her designated Beneficiary. All life expectancies shall be determined not later than the date when payments commence and shall not be redetermined thereafter. The amount of each installment payment shall be determined by dividing the remaining years in the period certain by the value of the Participant's Account; or

(5) Subject to the provisions of Section 8.7, a nontransferable annuity contract that provides for annuity payments at least annually over the lifetime of the Participant or the joint lifetimes of the Participant and his or her designated Beneficiary, and that may provide for a "period certain" feature (a "Lifetime Annuity").

(b) If, by the time for the distribution of a Participant's Plan Benefit in accordance with the foregoing provisions of this Article 8, the Participant has not made any election as to the form of the distribution, payment of his or her Plan Benefit shall be made in the form of a single sum cash distribution.

(c) To the extent that a distribution is to be made in a number of shares of Company Stock that exceeds the number of shares in the Participant's Account under the Company Stock fund, amounts in one or more other Investment Funds comprising the Participant's Account shall be applied to purchase the required additional shares of Company Stock at their fair market value at the time of purchase.

(d) The Company shall establish procedures to notify a Participant (or successor in interest) if any election regarding the form or timing of distribution of benefits from the Plan involving the Company Stock Fund constitutes a Discretionary Transaction (as defined in Section 6.9) which may trigger short-swing trading profits liability for the Participant (or successor in interest) under Section 16(b) of the Exchange Act. In such an event, the person making the election shall be provided with a reasonable opportunity to modify, delay, or revoke such an election.

(1) In the case of a Participant who is legally married on his or her Annuity Starting Date, the normal form of Lifetime Annuity that applies shall be a Qualified Joint and Survivor Annuity.

(2) In the case of a Participant who is not married on his or her Annuity Starting Date, the normal form of Lifetime Annuity that applies shall be a Single Life Annuity.

(1) Not more than ninety (90) days before the Annuity Starting Date, a married Participant who elects to receive a Lifetime Annuity may elect to waive the Qualified Joint and Survivor Annuity form of benefit and to receive payment instead in one of the other forms

specified in Section 8.6(a)(l)-(4) or as a Single Life Annuity. If the Participant elects the form of benefit in Section 8.6(a)(4), he or she also may designate a Beneficiary other than his or her spouse to receive any benefits payable following his or her death. A Participant may revoke any election previously made under this Subsection and may make a new election hereunder any number of times before his or her Annuity Starting Date. A Participant's election or revocation under this Subsection shall be in writing.

(2) An election by a Participant who elects to receive a Lifetime Annuity to waive the Qualified Joint and Survivor Annuity shall not be valid unless the Participant has received the notice and explanation described in Subsection (c) below and the spouse of the Participant consents in writing to such election in a manner that satisfies the spousal consent requirements set forth in
Section 8.13, provided that the Participant's election also must designate a specific alternative form of benefit (as well as a Beneficiary) that may not be changed without further spousal consent (unless expressly permitted by the spouse's consent or a prior consent). Spousal consent is not required in order for a Participant to reinstate an election to receive a Qualified Joint and Survivor Annuity, but is required for any subsequent revocation of the election.

(1) An explanation of the terms and conditions of the normal form of Lifetime Annuity, including the circumstances under which it will be provided if no election is made to waive such form of benefit;

(2) A statement of the Participant's right to make an election to waive the normal form of Lifetime Annuity and an explanation of the effect of such an election;

(3) A statement of the Participant's right to revoke an election to waive the normal form of Lifetime Annuity and an explanation of the effect of such a revocation;

(4) A statement of the right, if any, of the Participant's spouse to consent to the Participant's election to waive the normal form of

Lifetime Annuity and to the Participant's designation of an alternative form of benefit or Beneficiary;

(5) A general explanation of the relative financial impact of an election to waive the normal form of Lifetime Annuity;

(6) A general description of the material features (including eligibility conditions) and an explanation of the relative values of the alternative forms of benefit available under the Plan; and

(7) A statement regarding the availability of the additional information described below in this Subsection (c).

Within thirty (30) days after receipt of a timely written request from the Participant for additional information, the Company shall provide the Participant with a written explanation, in nontechnical language, of the terms and conditions of the alternative forms of benefit available under the Plan and the financial effect (in terms of dollars per monthly payment) upon the Participant's monthly benefit in case of an election to waive the normal form of Lifetime Annuity and receive an alternative form of benefit.

death benefit at any reasonable time after the Participant's death. Such an election must be made in writing not more than ninety (90) days before the date the distribution is to occur or commence. For this purpose, if the Participant's vested Plan Benefit at the time a distribution commences under an installment option pursuant to Section 8.6(a)(4) or a lifetime annuity pursuant to Section 8.7 exceeds $5,000, the value of his or her vested Plan Benefit at all times thereafter will be deemed to exceed $5,000.

(a) Notwithstanding any Beneficiary designation that may be to the contrary, if a Participant who has elected to receive a Lifetime Annuity (and who has not subsequently waived such Lifetime Annuity in accordance with Section 8.7(b)) dies before the Annuity Starting Date with respect to such Lifetime Annuity, and if he or she is married at the time of his or her death, the vested balance in his or her Account shall be applied toward the purchase of a Single Life Annuity for the Participant's surviving spouse.

(b) Except as provided in Subsection (a) above, if a Participant dies before the Annuity Starting Date (i.e., with respect to any form of distribution specified in Section 8.6(a)(l)-(4)), the vested balance in his or her Account shall be distributed to his or her Beneficiary in such form as such Beneficiary may elect from among the alternatives specified in Section 8.6(a)(l)-(3). In the absence of an election by the Beneficiary, payment shall be made in the form designated by the Participant, or, if none, in a single sum cash distribution.

(c) If a Participant dies after the Annuity Starting Date with respect to the form of distribution in effect under Section 8.6, the remaining amounts that had not yet been distributed under such form of distribution, if any, shall be paid to the Participant's Beneficiary in accordance with the applicable terms of such distribution method. In the case of a distribution in the form of an annuity contract (including a Lifetime Annuity) under Section 8.6(a)(4) or (5), the amount and timing of death or survivor benefit payments, if any, shall be as determined under such annuity contract.

9.1 Immediate Distribution.

(a) Any distribution to an Alternate Payee of all or some portion of a Participant's Accounts pursuant to a qualified domestic relations order, shall be made as soon as reasonably practicable after the order is determined to be a QDRO, if:

(1) The QDRO specifies such time of distribution; or

(2) The Alternate Payee has consented in writing to such time of distribution.

(b) Notwithstanding the foregoing, in determining the award to an Alternate Payee under a QDRO, the award to the Alternate Payee shall be derived solely from a portion of the Participant's vested Accounts in the Plan as of the Valuation Date provided in the QDRO.

practicable after the Plan Administrator's receipt of completed distribution forms provided by the Plan Administrator for this purpose.

10.1  Amount of Loan.  A Participant may obtain a cash loan from his or her
      --------------
      Accounts if he or she is an Employee who is not on a leave of absence at
      the time of the loan and his or her Plan participation is not suspended
      pursuant to Section 3.5. The minimum amount of any such loan shall be
      $1,000 at the time the loan is elected. No loan shall be granted under the
      Plan if such loan, when aggregated with the Participant's outstanding
      loans under any other qualified plans maintained by any member of the
      Affiliated Group, would exceed the lesser of:

      (a) $50,000, less the amount by which such aggregate balance has been
          reduced through repayments during the period of 12 months ending on
          the day before the new loan is made; or

      (b) One-half of the Participant's vested interest in his or her Accounts.

10.2  Terms of Loans.  A loan to a Participant shall be made on such terms and
      --------------
      conditions as the Company may determine, provided that the loan shall:

      (a) Be evidenced by a promissory note signed by the Participant and
          secured by one-half of the value of his or her Accounts, to the extent
          vested (regardless of the amount of the loan or the source of the loan
          funds);

      (b) Bear interest at a fixed rate commensurate with the interest rates
          charged by major financial institutions for similar loans;

      (c) Provide for level amortization over its term with payments at monthly
          or more frequent intervals, as determined by the Company;

      (d) Provide for loan payments (1) to be withheld whenever possible through
          periodic payroll deductions from the Participant's compensation from
          any member of the Affiliated Group or (2) to be paid by check or money
          order whenever payroll withholding is not possible;

      (e) Provide for repayment in full on or before the earlier of (1) the date
          when the Participant severs from all employment with any member of the
          Affiliated Group or (2) the date (A) five years after the loan is made
          or (B) 20 years after the loan is made if the loan is used to acquire
          a dwelling unit which within a reasonable time is to be used as the
          Participant's principal residence;

                                       29

      (f)  Provide that a Participant may not receive any distribution from any
           of his or her Accounts under Article 8 or 11 until the loan
           obligation is repaid, except to the extent that all or any part of
           such distribution is used to repay the outstanding balance of the
           loan; and

      (g)  Provide that a Participant's Accounts may not be applied to the
           satisfaction of the Participant's loan obligations before the
           Accounts become distributable under Article 8, unless the Company
           determines that the loan obligations are in default because a
           periodic payment is more than 60 days past due and takes such actions
           as the Company deems necessary or appropriate to cause the Plan to
           realize on its security for the loan. Such actions may include
           (without limitation) an involuntary withdrawal from the Participant's
           Accounts, whether or not the withdrawal would be permitted under
           Article 11 on a voluntary basis; provided that an involuntary
           withdrawal attributable to Company Contributions made with respect to
           Plan Years that ended less than 24 months prior to the date of the
           withdrawal (adjusted to reflect any earnings, appreciation or losses
           attributable to Company Contributions) or attributable to Participant
           Elected Contributions shall be permitted only to the extent that the
           hardship requirements of Code Section 401(k)(2)(B)(I)(IV) and of
           Sections 1.401(k)-l(d)(2)(ii) and 1.401(k)1(d)(2)(iii)(A) of the
           Treasury Regulations are met. The Company may take such other action
           as it deems necessary to recover the balance of a loan secured by the
           Participant's Accounts. If an involuntary withdrawal occurs (or would
           have occurred if permitted under this Section, the Participant shall
           not be permitted to obtain a loan under the Plan thereafter.

10.3  Company Consent.  The Company, in its sole discretion, may withhold its
      ---------------
      consent to any loan under this Article or may consent only to the
      borrowing of a part of the amount requested by the Participant. The
      Company shall act upon requests for loans in a uniform and
      nondiscriminatory manner, consistent with the requirements of Section
      401(a), Section 401(k) and related provisions of the Code.

10.4  Source of Loans.   If a Participant requests and is granted a loan, a Loan
      ---------------
      Account shall be established for the Participant. The Loan Account shall
      be held by the Trustee as part of the Loan Fund. The amount of the loan
      shall be transferred to the Participant's Loan Account from the
      Participant's other Accounts and shall be disbursed from the Loan Account.
      Transfers from the Company Stock Fund shall be made in accordance with the
      requirements for exemption under Section 16(b) of the Exchange Act if such
      a transfer would cause the Participant to incur short-swing trading
      profits liability under Section 16(b) of the Exchange Act. The promissory
      note executed by the Participant shall be held by the Trustee (or by the

                                       30

      Company as agent of the Trustee) and the promissory note shall be treated
      as an investment of the Participant's Loan Account.

10.5  Disbursement of Loans.   A Participant may request a loan by completing
      ---------------------
      the loan request procedures prescribed by the Company. A loan shall be
      disbursed as soon as reasonably practicable after the date on which the
      Company (or its agent) receives the loan request (subject to the Company's
      consent).

10.6  Loan Fees.   A Participant who obtains a loan under this Article shall be
      ---------
      required to pay such fees as the Company may impose in order to defray the
      cost of administering loans from the Plan.

10.7  Valuation Date.  For purposes of this Article, the value of a
      --------------
      Participant's Accounts shall be determined as of a Valuation Date within a
      reasonable period, not generally to exceed 30 days, on or after the date
      on which the Company (or its agent) receives the prescribed loan request.

10.8  Loan Payments and Defaults.  Principal and interest payments on a
      --------------------------
      Participant's loan shall be credited initially to the Participant's Loan
      Account and shall be transferred as soon as reasonably practicable
      thereafter to the Participant's other Accounts in the ratio specified by
      the Participant under Section 6.2 for the investment of future
      contributions. Any loss caused by nonpayment or other default on a
      Participant's loan obligations shall be satisfied solely by that
      Participant's Accounts. If a Participant defaults on a Plan loan, both his
      or her participation and ability to obtain a Plan loan shall be suspended
      for 12 months. The consequences of suspension from participation in the
      Plan are described in Section 3.5.

11.1  Age 59 1/2 and Disability Withdrawals: Withdrawals from Rollover Account
      ------------------------------------------------------------------------

      (a) A Participant who is an Employee may withdraw up to the full amount of
          his or her Rollover Account.

      (b) A Participant who is an Employee and who has attained age 59 1/2 may
          withdraw up to the full amount of his or her vested Accounts.

      (c) A Participant who is an Employee and who is Disabled may withdraw up
          to the full amount of his or her vested Accounts.

11.2  Hardship Withdrawals.  A Participant who is an Employee may take a
      --------------------
      Hardship Withdrawal of all or any portion of his or her previously
      unwithdrawn Employee Contributions and earnings thereon accrued prior to
      January 1, 1988. A Hardship

                                       31

      Withdrawal may be made only if the Company determines that it is required
      on account of one or more of the following Hardships:

      (a) The construction or purchase (excluding mortgage payments) of a
          principal residence of the Participant;

      (b) The payment of tuition and related educational fees for up to 12
          months of post-secondary education for the Participant or his or her
          spouse, children or dependents;

      (c) The payment of medical expenses described in Section 213(d) of the
          Code incurred by the Participant or the Participant's spouse or
          dependents, or to obtain medical care giving rise to such expenses;

      (d) The payment of expenses incurred by the Participant for the funeral of
          a family member;

      (e) The prevention of the eviction of the Participant from his or her
          principal residence or foreclosure on a mortgage on the Participant's
          principal residence; or

      (f) A financial need that has been identified as a deemed immediate and
          heavy financial need in a ruling, notice or other document of general
          applicability issued under the authority of the Commissioner of
          Internal Revenue.

      For purposes of this Section, the term "dependent" shall be defined as set
      forth in Section 152 of the Code.

11.3  Amount of a Hardship Withdrawal.  The maximum amount of a Hardship
      -------------------------------
      Withdrawal is the amount necessary to satisfy the immediate and heavy
      financial need caused by the Hardship, including amounts necessary to pay
      taxes or penalties that the Company determines may be reasonably
      anticipated to result from the Hardship Withdrawal. The determination of
      the amount of a permitted Hardship Withdrawal is made by the Company only
      after the Participant has obtained all withdrawals and distributions,
      other than hardship withdrawals, and all nontaxable loans under all plans
      maintained by the Affiliated Group.

11.4  Consequences of a Hardship Withdrawal.  The following consequences shall
      -------------------------------------
      follow a Participant's Hardship Withdrawal:

      (a) Plan participation and all employee before- and after-tax
          contributions to the Plan and other qualified and nonqualified
          deferred compensation plans sponsored by members of the Affiliated
          Group shall be suspended for a

                                      32

          period of 12 months. The consequences of suspension from the Plan are
          described in Section 3.5.

      (b) For the calendar year following the Hardship Withdrawal, the maximum
          amount of Participant Elected Contributions and all other before-tax
          employee contributions to qualified retirement plans sponsored by
          members of the Affiliated Group shall be limited to the Annual
          Deferral Limit, as defined in Section 13.9(b), minus the amount of the
          Participant's Participant Elected Contributions and all other before
          tax employee contributions to qualified retirement plans sponsored by
          members of the Affiliated Group for the calendar year of the Hardship
          Withdrawal.

11.5  Valuation Date.  For purposes of this Article, the value of a
      --------------
      Participant's Accounts shall be determined as of the Valuation Date
      preceding the date on which the withdrawal is to be paid.

11.6  Source of Withdrawals.  Withdrawals shall be paid from the affected
      ---------------------
      Accounts. If more than one Account is available to pay the withdrawal
      because the Participant elected to invest in more than one Investment
      Fund, the withdrawal shall be made from the subaccount(s) designated by
      the Participant, subject to such ordering and timing restrictions as the
      Company may adopt.

11.7  Payment of Withdrawals.  A Participant may request a withdrawal by
      ----------------------
      following the procedures prescribed by the Company. A withdrawal shall be
      paid as soon as reasonably practicable after the date on which the Company
      receives the prescribed withdrawal request. Withdrawals shall be paid only
      in cash.

11.8  Limitations on Withdrawals. A Participant shall not be permitted to make
      --------------------------
      more than one withdrawal under this Article in any period of six
      consecutive months; provided, however, that withdrawals made at the same
      time shall be considered a single withdrawal. The timing of withdrawals
      from the Company Stock Fund shall be limited when necessary to avoid
      liability from the short-swing trading profits provisions of Section 16(b)
      of the Exchange Act.

12.1  Determining the Highly Compensated Employee Group.  An individual is
      -------------------------------------------------
      deemed to be a Highly Compensated Employee for any Plan Year if the
      individual is an active Employee who, during the look-back year, received
      Total Compensation of more than $80,000 (or such larger amount as may be
      adopted by the Commissioner of Internal Revenue to reflect a cost-of-
      living adjustment) and was a member of the Top-Paid Group; or was a five-
      percent owner at any time during the Plan Year or the look-back year. The
      look-back year shall be the 12-month period immediately preceding the Plan
      Year. The determination of who is a

                                       33

      Highly Compensated Employee, including the determinations of the number
      and identity of Employees in the Top Paid Group and the Total Compensation
      that is considered, will be made in accordance with Section 414(q) of the
      Code and the regulations thereunder.

12.2  "Highly Compensated Former Employee"  means a former Employee who
       ----------------------------------
      separated from service (or is deemed to have separated) prior to the
      determination year, performs no service for any member of the Affiliated
      Group during the determination year, and was a Highly Compensated Employee
      as an active Employee for either the separation year or any determination
      year ending on or after the Employee's 55th birthday. The determination of
      who is a Highly Compensated Former Employee will be made in accordance
      with Section 414(q) of the Code and regulations thereunder.

12.3  "Nonhighly Compensated Employee"  for any Plan Year means any active
       ------------------------------
      Employee who is not a Highly Compensated Employee.

12.4  Special Definitions Used in Article 12.  The following definitions shall
      --------------------------------------
      apply for purposes of this Article 12:

      (a) "Top-Paid Group"  for any Plan Year means the top 20 percent (in
          --------------
          terms of Total Compensation) of all Employees of the Affiliated Group,
          where the number that is 20 percent of all Employees of the Affiliated
          Group is determined by excluding:

          (1)  Any Employee covered by a collective bargaining agreement;

          (2)  Any Employee who is a nonresident alien with respect to the
               United States and who receives no income with a source within the
               United States from a member of the Affiliated Group;

          (3)  Any Employee who has not completed six months of service at the
               end of the Plan Year;

          (4)  Any Employee who normally works less than 17 1/2 hours per week;

          (5)  Any Employee who normally works no more than six months during
               any year; and

          (6)  Any Employee who has not attained the age of 21 at the end of the
               Plan Year.

      The Company may elect, in a consistent and uniform manner, to apply one or
      more of the age- and service-based exclusions above by substituting a
      younger

                                       34

      age or shorter period of service, or by not excluding individuals on the
      basis of age or service.

      (b) "Total Compensation" means "Compensation," as defined in Section 2.16,
          ------------------
          but determined by including amounts deferred but not refunded under
          Section 403(b) of the Code, under a cafeteria plan, as such term is
          defined in Section 125(c) of the Code, under a simplified employee
          pension, as such term is defined in Section 408(k) of the Code and
          under a plan, including this Plan, qualified under Section 401(k) of
          the Code.

13.1  Return of Excess Deferrals.  The aggregate Participant Elected
      --------------------------
      Contributions of any Participant for any calendar year, together with his
      or her elective deferrals under any other plan or arrangement to which
      Section 402(g) of the Code applies and that is maintained by a member of
      the Affiliated Group, shall not exceed the Annual Deferral Limit. In the
      event that the aggregate Participant Elected Contributions of any
      Participant for any calendar year, together with any other elective
      deferrals (within the meaning of Section 402(g)(3) of the Code) under all
      plans, contracts or arrangements of the Affiliated Group and any other
      employers, exceed the Annual Deferral Limit, then the Participant may
      designate all or a portion of such Excess Deferrals as attributable to
      this Plan and may request a refund of such portion by notifying the
      Company in writing on or before the March 1 next following the close of
      such calendar year. If timely notice is received by the Company, then such
      portion of the Excess Deferrals, and any income or loss allocable to such
      portion, shall be refunded to the Participant not later than the April 15
      next following the close of such calendar year.

      If the Participant fails properly to request a distribution of all such
      Excess Deferrals, and such Excess Deferrals are attributable solely to
      plans, contracts or arrangements of the Affiliated Group, then the Company
      shall be deemed to have notice of such Excess Deferrals and shall
      designate one or more plans maintained by a member of the Affiliated Group
      from which the refund of Excess Deferrals and allocable income or loss
      shall be made no later than April 15 next following the close of such
      calendar year.

      Any Participant Elected Contributions distributed pursuant to this Section
      13.1 shall not be included in the Participant Elected Contributions to
      which a Matching Contribution under Section 5.1 or a Qualified Matching
      Contribution under Section 5.4 of the Plan attaches.

                                       35

13.2  Actual Deferral Percentage Limitation. The Plan shall satisfy the actual
      -------------------------------------
      deferral percentage test, as provided in Section 401(k)(3) of the Code and
      the regulations issued thereunder. Subject to the special rules described
      in Section 13.7, the Aggregate 401(k) Contributions of Highly Compensated
      Employees shall not exceed the limits described below:

      (a) An Actual Deferral Percentage shall be determined for each individual
          who, at any time during the Plan Year, is a Participant (including a
          suspended Participant) or is eligible to participate in the Plan,
          which Actual Deferral Percentage shall be the ratio, computed to the
          nearest one-hundredth of one percent, of the individual's Aggregate
          401(k) Contributions for the Plan Year to the individual's Section
          414(s) Compensation for the Plan Year;

      (b) The Actual Deferral Percentages (including zero percentages) of Highly
          Compensated Employees and Nonhighly Compensated Employees shall be
          separately averaged to determine each group's Average Deferral
          Percentage; and

      (c) The Aggregate 401(k) Contributions of Highly Compensated Employees
          shall constitute Excess Contributions and shall be reduced, pursuant
          to Sections 13.3 and 13.4, to the extent that the Average Deferral
          Percentage of Highly Compensated Employees exceeds the greater of (1)
          125 percent of the Average Deferral Percentage of Nonhighly
          Compensated Employees for the preceding Plan Year or (2) the lesser of
          (A) 200 percent of the Average Deferral Percentage of Nonhighly
          Compensated Employees for the preceding Plan Year or (B) the Average
          Deferral Percentage of Nonhighly Compensated Employees for the
          preceding Plan Year plus two percentage points.

13.3  Allocation of Excess Contributions to Highly Compensated Employees. Any
      ------------------------------------------------------------------
      Excess Contributions for a Plan Year shall be allocated to Highly
      Compensated Employees by use of a leveling process, whereby the amount of
      Aggregate 401(k) Contributions of the Highly Compensated Employee with the
      highest amount of Aggregate 401(k) Contributions is reduced to the extent
      required to (a) eliminate all Excess Contributions or (b) cause such
      Highly Compensated Employee's amount of Aggregate 401(k) Contributions to
      equal the amount of Aggregate 401(k) Contributions of the Highly
      Compensated Employee with the next highest amount of Aggregate 401(k)
      Contributions. The leveling process shall be repeated until all Excess
      Contributions for the Plan Year are allocated to Highly Compensated
      Employees.

13.4  Distribution of Excess Contributions.  Excess Contributions allocated to
      ------------------------------------
      Highly Compensated Employees for the Plan Year pursuant to Section 13.3,
      together with any income or loss allocable to such Excess Contributions,
      shall be

                                       36

      distributed to such Highly Compensated Employees not later than two-and-
      one-half months following the close of such Plan Year, if possible, and in
      any event no later than 12 months following the close of such Plan Year.
      Any Participant Elected Contributions distributed pursuant to this Section
      13.4 shall not be included in the Participant Elected Contributions to
      which a Matching Contribution under Section 5.1 or a Qualified Matching
      Contribution under Section 5.4 of the Plan attaches.

13.5  Qualified Matching Contributions.  The Company, in its sole discretion,
      --------------------------------
      may include all or a portion of the Qualified Matching Contributions for a
      Plan Year in Aggregate 401(k) Contributions taken into account in applying
      the Average Deferral Percentage limitation described in Section 13.2 for
      the Plan Year; provided that such Qualified Matching Contributions for the
      Plan Year are fully and immediately vested, may not be withdrawn while the
      Participant is an Employee or may be withdrawn only in circumstances that
      would permit a Hardship Withdrawal, and the additional requirements of
      Treasury Regulation Section 1.401(k)-l(b)(5) are satisfied.

13.6  Corrective Qualified Nonelective Contributions.  In order to satisfy (or
      ----------------------------------------------
      partially satisfy) the Average Deferral Percentage limitation described in
      Section 13.2, the Average Contribution Percentage limitation described in
      Section 14.1 or the multiple-use limitation described in Section 15.1 (or
      more than one of such limitations), the Company, in its sole discretion,
      may cause one or more Participating Companies to make a Qualified
      Nonelective Contribution to the Plan. Any such Qualified Nonelective
      Contribution shall be allocated to the Accounts of those Participants who
      are eligible to receive an allocation of Matching Contributions under
      Section 5.1 of the Plan or Nonelective Contributions under Section 5.2, as
      the Company designates, and who are Nonhighly Compensated Employees for
      the Plan Year with respect to which the Qualified Nonelective Contribution
      is made, beginning with the Participant with the lowest Section 414(s)
      Compensation for the Plan Year and allocating the maximum amount
      permissible under Article 16 before allocating any portion of the
      Qualified Nonelective Contribution to the Participant with the next lowest
      Section 414(s) Compensation. These allocations shall continue until the
      Plan satisfies the Average Deferral Percentage limitation described in
      Section 13.2, the Average Contribution Percentage limitation described in
      Section 14.1 or the multiple-use limitation described in Section 15.1 (or
      more than one of such limitations), or until the amount of the Qualified
      Nonelective Contribution is exhausted.

      The Company, in its sole discretion, may include all or a portion of the
      Qualified Nonelective Contributions for a Plan Year in Aggregate 401(k)
      Contributions taken into account in applying the Average Deferral
      Percentage limitation

                                       37

      described in Section 13.2 for such Plan Year, provided that the
      requirements of Treasury Regulation Section 1.401(k)l(b)(5) are satisfied.

      Qualified Nonelective Contributions shall be paid to the Trustee as soon
      as reasonably practicable following the close of the Plan Year, shall be
      allocated to the Accounts of Nonhighly Compensated Employees as of the
      last day of the Plan Year and shall be fully and immediately vested. In
      all other respects, the contribution, allocation, investment and
      distribution of Qualified Nonelective Contributions shall be governed by
      the provisions of the Plan concerning Matching Contributions.

13.7  Special Rules.  The following special rules shall apply for purposes of
      -------------
      this Article 13:

      (a) The amount of Excess Deferrals to be distributed to a Participant for
          a calendar year pursuant to Section 13.1 shall be reduced by the
          amount of any Excess Contributions previously distributed to such
          Participant for the Plan Year beginning within such calendar year;

      (b) The amount of Excess Contributions to be distributed to a Participant
          for a Plan Year pursuant to Section 13.4 shall be reduced by the
          amount of any Excess Deferrals previously distributed to such
          Participant for the calendar year ending within such Plan Year;

      (c) For purposes of applying the limitation described in Section 13.2, the
          Actual Deferral Percentage of any Highly Compensated Employee who is
          eligible to make Participant Elected Contributions and to make
          elective deferrals (within the meaning of Section 402(g)(3) of the
          Code) under any other plans, contracts or arrangements of the
          Affiliated Group shall be determined as if all such Participant
          Elected Contributions and elective deferrals were made under a single
          arrangement; provided, however, that plans, contracts and arrangements
          shall not be treated as a single arrangement to the extent that
          Treasury Regulation Section 1.401(k)-l(b)(3)(ii)(B) prohibits
          aggregation;

      (d) In the event that this Plan is aggregated with one or more other plans
          in order to satisfy the requirements of Code Section 401(a)(4), 401(k)
          or 410(b), then all such aggregated plans, including the Plan, shall
          be treated as a single plan for all purposes under all such Code
          sections (except for purposes of the average benefit percentage
          provisions of Code Section 410(b)(2)(A)(ii));

      (e) In the event that the mandatory disaggregation rules of Treasury
          Regulation Section 1.401(k)-l(b)(3)(ii)(B) apply to the Plan, or to
          the Plan and other plans with which it is aggregated as described in
          Subsection (d)

                                       38

          above, then the limitation described in Section 13.2 shall be applied
          as if each mandatorily disaggregated portion of the Plan (or
          aggregated plans) were a single arrangement; and

      (f) Income (and loss) allocable to Excess Contributions for the Plan Year
          shall be determined pursuant to the provisions for allocating income
          (and loss) to a Participant's Accounts under Section 6.10 of the Plan.

13.8  Prospective Limitations on Participant Elected Contributions.  At any
      ------------------------------------------------------------
      time, the Company (at its sole discretion) may reduce the maximum rate at
      which any Participant may make Participant Elected Contributions to the
      Plan, or the Company may require that any Participant discontinue all
      Participant Elected Contributions, in order to ensure that the limitations
      described in this Article 13 are met. Any reduction or discontinuance of
      Participant Elected Contributions may be applied selectively to individual
      Participants or to particular classes of Participants, as the Company may
      determine. Upon such date as the Company may determine, this Section shall
      automatically cease to apply until the Company again determines that a
      reduction or discontinuance of Participant Elected Contributions is
      required for any Participant.

13.9  Special Definitions Used in Article 13.  The following definitions shall
      --------------------------------------
      apply for purposes of this Article 13, and some may also apply for one or
      more of Articles 14, 15 and 16.

      (a) "Aggregate 401(k) Contributions"  means, for any Plan Year, the sum
          ------------------------------
          of the following: (a) the Participant's Participant Elected
          Contributions for the Plan Year; (b) the Qualified Matching
          Contributions allocated to the Participant's Accounts as of a date
          within the Plan Year, but only to the extent that such Qualified
          Matching Contributions are aggregated with Participant Elected
          Contributions pursuant to Section 13.5; and (c) the Qualified
          Nonelective Contributions allocated to the Participant's Accounts as
          of a date within the Plan Year, but only to the extent that such
          Qualified Nonelective Contributions are aggregated with Participant
          Elected Contributions pursuant to Section 13.6.

      (b) "Annual Deferral Limit" means the dollar limit in effect for any
           ---------------------
          calendar year under Section 402(g) of the Code.

      (c) "Excess Contributions" means the amount by which the Aggregate 401(k)
           --------------------
          Contributions of Highly Compensated Employees is reduced pursuant to
          Section 13.3.

      (d) "Excess Deferrals" means the amount of a Participant's Participant
           ----------------
          Elected Contributions and elective deferrals (within the meaning of

                                       39

          Section 402(g)(3) of the Code) that exceed the Annual Deferral Limit
          set forth in Section 13.1 (as defined in Section 13.9).

      (e) "Section 414(s) Compensation" means any one of the following
          ---------------------------
          definitions of compensation received by an Employee from members of
          the Affiliated Group:

          (1)  Compensation as defined in Treasury Regulation Section 1.415-2(d)
               or any successor thereto;

          (2)  "Wages" as defined in Section 3401(a) of the Code for purposes of
               income tax withholding at the source, but determined without
               regard to any rules that limit the remuneration included in wages
               based on the nature or location of the employment or the services
               performed (such as the exception for agricultural labor in
               Section 3401(a)(23) of the Code);

          (3)  "Wages" as defined in Section 3401(a) of the Code for purposes of
               income tax withholding at the source, plus all other payments of
               compensation reportable under Code Sections 6041(d) and
               6051(a)(3) and the regulations thereunder, determined without
               regard to any rules that limit such Wages or reportable
               compensation based on the nature or location of the employment or
               the services performed (such as the exception for agricultural
               labor in Section 3401(a)(23) of the Code), and modified, at the
               election of the Company, to exclude amounts paid or reimbursed
               for the Employee's moving expenses, to the extent it is
               reasonable to believe that these amounts are deductible by the
               Employee under Section 217 of the Code;

          (4)  Any of the definitions of Section 414(s) Compensation set forth
               in Subsections (1), (2) and (3) above, reduced by all of the
               following items (even if includable in gross income):
               reimbursements or other expense allowances, fringe benefits (cash
               and noncash), moving expenses, deferred compensation and welfare
               benefits;

          (5)  Any of the definitions of Section 414(s) Compensation set forth
               in Subsections (1), (2), (3) and (4) above, modified to include
               the following: (a) any elective contributions made by a member of
               the Affiliated Group on behalf of the Employee that are not
               includable in gross income under Section 125, 402(e)(3), 402(h)
               or 403(b) of the Code; (b) compensation deferred under an
               eligible deferred compensation plan within the meaning of Section
               457(b) of the Code; and (c) employee contributions described in

                                       40

               Section 414(h)(2) of the Code that are picked up by the employing
               unit and thus are treated as employer contributions; or

          (6)  Any reasonable definition of compensation that does not by design
               favor Highly Compensated Employees and that satisfies the
               nondiscrimination requirement set forth in Treasury Regulation
               Section 1.414(s)-lT(d)(2) or the successor thereto.

          Any definition of Section 414(s) Compensation shall be used
          consistently to define the compensation of all Employees taken into
          account in satisfying the requirements of an applicable provision of
          Articles 13, 14, 15 and 16 for the relevant determination period.  For
          purposes of applying the limitations set forth in Articles 13, 14 and
          15 for a Plan Year, Section 414(s) Compensation shall not exceed the
          Compensation Limitation.

14.1  Average Contribution Percentage Limitation.  The Plan shall satisfy the
      ------------------------------------------
      actual contribution percentage test, as provided in Section 401(m)(2) of
      the Code and Section 1.401(m)-l of the regulations issued thereunder.
      Subject to the special rules described in Section 14.6, the Aggregate
      401(m) Contributions of Highly Compensated Employees shall not exceed the
      limits described below:

      (a) An Actual Contribution Percentage shall be determined for each
          individual who, at any time during the Plan Year, is a Participant
          (including a suspended Participant) or is eligible to participate in
          the Plan, which Actual Contribution Percentage shall be the ratio,
          computed to the nearest one-hundredth of one percent, of the
          individual's Aggregate 401(m) Contributions for the Plan Year to the
          individual's Section 414(s) Compensation for the Plan Year;

      (b) The Actual Contribution Percentages (including zero percentages) of
          Highly Compensated Employees and Nonhighly Compensated Employees shall
          be separately averaged to determine each group's Average Contribution
          Percentage; and

      (c) The Aggregate 401(m) Contributions of Highly Compensated Employees
          shall constitute Excess Aggregate Contributions and shall be reduced,
          pursuant to Sections 14.2 and 14.3, to the extent that the Average
          Contribution Percentage of Highly Compensated Employees exceeds the
          greater of (1) 125 percent of the Average Contribution Percentage of
          Nonhighly Compensated Employees for the preceding Plan Year or (2) the
          lesser of (A) 200 percent of the Average Contribution Percentage of

                                       41

          Nonhighly Compensated Employees for the preceding Plan Year or (B) the
          Average Contribution Percentage of Nonhighly Compensated Employees for
          the preceding Plan Year plus two percentage points.

14.2  Allocation of Excess Aggregate Contributions to Highly Compensated
      ------------------------------------------------------------------
      Employees.  Any Excess Aggregate Contributions for a Plan Year shall be
      ---------
      allocated to Highly Compensated Employees by use of a leveling process,
      whereby the Aggregate 401(m) Contributions of the Highly Compensated
      Employee with the highest amount of Aggregate 401(m) Contributions is
      reduced to the extent required to (a) eliminate all Excess Aggregate
      Contributions or (b) cause the amount of such Highly Compensated
      Employee's Aggregate 401(m) Contributions to equal the amount of Aggregate
      401(m) Contributions of the Highly Compensated Employee with the next-
      highest amount of Aggregate 401(m) Contributions. The leveling process
      shall be repeated until all Excess Aggregate Contributions for the Plan
      Year are allocated to Highly Compensated Employees.

14.3  Distribution of Excess Aggregate Contributions.  Excess Aggregate
      ----------------------------------------------
      Contributions allocated to Highly Compensated Employees for the Plan Year
      pursuant to Section 14.2, together with any income or loss allocable to
      such Excess Aggregate Contributions, shall be distributed to such Highly
      Compensated Employees not later than two-and-one-half months following the
      close of such Plan Year, if possible, and in any event no later than 12
      months following the close of such Plan Year, but only to the extent the
      Highly Compensated Employee has a nonforfeitable interest in the Excess
      Aggregate contributions. Excess Aggregate Contributions (for Participants
      who are Highly Compensated Employees), to the extent not vested, may be
      forfeited and allocated, after all other Forfeitures under the Plan, to
      other Participants (but in no event to any Highly Compensated Employee) in
      the proportion that such Participant's Participant Elected Contributions,
      if any, for that Plan Year bears to the total Participant Elected
      Contributions of all such Participants for the Plan Year. Any such amounts
      shall be included in the calculation of the Actual Contribution Percentage
      and in the calculation of the limits set forth in Article 16.

14.4  Use of Participant Elected Contributions.  The Company, in its sole
      ----------------------------------------
      discretion, may include all or a portion of the Participant Elected
      Contributions for a Plan Year in Aggregate 401(m) Contributions taken into
      account in applying the Average Contribution Percentage limitation
      described in Section 14.1 for the Plan Year, provided that all Participant
      Elected Contributions satisfy the average deferral percentage test, as
      described in Section 13.2, and that the additional requirements of
      Treasury Regulation Section 1.401(m)-l(b)(5) are satisfied.

14.5  Corrective Qualified Nonelective Contributions.  The Company, in its sole
      ----------------------------------------------
      discretion, may include all or a portion of the Qualified Nonelective
      Contributions

                                       42

      made pursuant to Section 13.6 for a Plan Year in Aggregate 401(m)
      Contributions taken into account in applying the Average Contribution
      Percentage limitation described in Section 14.1 for the Plan Year,
      provided that the requirements of Treasury Regulation Section 1.401(m)-
      l(b)(5) are satisfied.

14.6  Special Rules.  The following special rules shall apply for purposes of
      -------------
      this Article 14:

      (a) For purposes of applying the limitation described in Section 14.1, the
          Actual Contribution Percentage of any Highly Compensated Employee who
          is eligible to participate in the Plan and to make employee
          contributions or receive an allocation of matching contributions
          (within the meaning of Section 401(m)(4)(A) of the Code) under any
          other plans, contracts or arrangements of the Affiliated Group shall
          be determined as if Matching Contributions and Qualified Matching
          Contributions allocated to the Highly Compensated Employee's Accounts
          and all such employee contributions and matching contributions were
          made under a single arrangement;

      (b) In the event that this Plan is aggregated with one or more other plans
          in order to satisfy the requirements of Code Section 401(a)(4), 401(m)
          or 410(b), then all such aggregated plans, including the Plan, shall
          be treated as a single plan for all purposes under all such Code
          sections (except for purposes of the average benefit percentage
          provisions of Code Section 410(b)(2)(A)(ii));

      (c) In the event that the mandatory disaggregation rules of Treasury
          Regulation Section 1.401(m)-l(b)(3)(ii) apply to the Plan, or to the
          Plan and other plans with which it is aggregated as described in
          Subsection (b) above, then the limitation described in Section 14.1
          shall be applied as if each mandatorily disaggregated portion of the
          Plan (or aggregated plans) were a single arrangement; and

      (d) Income (and loss) allocable to Excess Aggregate Contributions for the
          Plan Year shall be determined pursuant to the provisions for
          allocating income (and loss) to a Participant's Accounts under Section
          6.10.

14.7  Special Definitions Used in Article 14.  The following definitions shall
      --------------------------------------
      apply for purposes of this Article 14:

      (a) "Aggregate 401(m) Contributions" means, for any Plan Year, the sum of
           ------------------------------
          the following: (a) the Matching Contributions and Qualified Matching
          Contributions allocated to the Participant's Accounts as of a date
          within the Plan Year; (b) the Participant's Participant Elected
          Contributions for the Plan Year, but only to the extent that such
          Participant Elected

                                       43

          Contributions are aggregated with Matching Contributions and Qualified
          Matching Contributions pursuant to Section 14.4; and (c) the Qualified
          Nonelective Contributions allocated to the Participant's Accounts as
          of a date within the Plan Year, but only to the extent that such
          Qualified Nonelective Contributions are aggregated with Matching
          Contributions and Qualified Matching Contributions pursuant to Section
          14.5.

      (b) "Excess Aggregate Contributions" means the amount by which the
           ------------------------------
          Aggregate 401(m) Contributions of Highly Compensated Employees are
          reduced pursuant to Section 14.2.

15.1  Applicability of the Multiple-Use Limitation.  The limitation described in
      --------------------------------------------
      this Article 15 shall apply only if, for a Plan Year, after the
      limitations of Articles 13 and 14 are applied:

      (a) The Average Deferral Percentage of Highly Compensated Employees (1)
          exceeds 125 percent of the Average Deferral Percentage of Nonhighly
          Compensated Employees, but (2) does not exceed the lesser of (A) 200
          percent of the Average Deferral Percentage of Nonhighly Compensated
          Employees or (B) the Average Deferral Percentage of Nonhighly
          Compensated Employees plus two percentage points; and

      (b) The Average Contribution Percentage of Highly Compensated Employees
          (1) exceeds 125 percent of the Average Contribution Percentage of
          Nonhighly Compensated Employees, but (2) does not exceed the lesser of
          (A) 200 percent of the Average Contribution Percentage of Nonhighly
          Compensated Employees or (B) the Average Contribution Percentage of
          Nonhighly Compensated Employees plus two percentage points.

15.2  Multiple-Use Limitation.  The sum of the Average Deferral Percentage and
      -----------------------
      Average Compensation Percentage of Highly Compensated Employees shall not
      exceed the greater of (a) or (b) below.

      (a) This limit equals the sum of:

          (1)  1.25 times the greater of the Average Deferral Percentage or
               Average Contribution Percentage of Nonhighly Compensated
               Employees; and

          (2)  The lesser of (A) 200 percent of the lesser of the Average
               Deferral Percentage or Average Contribution Percentage of
               Nonhighly Compensated Employees, or (b) the lesser of the Average
               Deferral

                                       44

               Percentage or Average Contribution Percentage of Nonhighly
               Compensated Employees plus two percentage points.

      (b) This limit equals the sum of:

          (1)  1.25 times the lesser of the Average Deferral Percentage or
               Average Contribution Percentage of Nonhighly Compensated
               Employees; and

          (2)  The lesser of (A) 200 percent of the greater of the Average
               Deferral Percentage or Average Contribution Percentage of
               Nonhighly Compensated Employees, or (B) the greater of the
               Average Deferral Percentage or Average Contribution Percentage of
               Nonhighly Compensated Employees plus two percentage points.

15.3  Correction of Multiple-Use Limitation.  To the extent necessary, the
      -------------------------------------
      limitation of Section 15.2 shall be satisfied by one or more of the
      following methods: (a) the allocation of corrective Qualified Nonelective
      Contributions in the manner set forth in Sections 13.6 or 14.5, or (b) the
      distribution of Aggregate 401(m) Contributions (and income or loss
      allocable thereto) to Highly Compensated Employees in the manner set forth
      in Sections 14.2 and 14.3, followed by the distribution of Aggregate
      401(k) Contributions (and income or loss allocable thereto) to Highly
      Compensated Employees in the manner set forth in Sections 13.3 and 13.4.

16.1  Limitation on Contributions.  The Annual Additions allocated or attributed
      ---------------------------
      to a Participant for any Plan Year shall not exceed the lesser of the
      following:

      (a) $30,000; or

      (b) 25% of the Participant's Section 415 Compensation for such year.

      If a Participant's Annual Additions would exceed the foregoing limitation,
      then such Annual Additions shall be reduced by reducing the components
      thereof as necessary in the order in which they are listed in Section
      16.5(a). Any amounts so reduced shall not be included in a Participant's
      Aggregate 401(k) Contributions or Aggregate 401(m) Contributions. The
      limitation in Section 16.1(b) shall not apply to any amount that otherwise
      is an Annual Addition under Section 415(l)(1) or 419A(d)(2) of the Code.

                                       45

16.2  Combined Limitation on Benefits and Contributions.  The sum of a
      -------------------------------------------------
      Participant's defined-benefit plan fraction and his or her defined
      contribution plan fraction shall not exceed 1.0 with respect to any Plan
      Year. For purposes of this Section, the terms "defined-benefit plan
      fraction" and "defined-contribution plan fraction" shall have the meaning
      given to such terms by Section 415(e) of the Code and the regulations
      thereunder. If a Participant would exceed the foregoing limitation, then
      the Participant's benefits under any qualified defined-benefit plan that
      may be maintained by the Section 415 Employer Group shall be reduced as
      necessary to allow his or her Annual Additions to equal the maximum
      permitted by Section 16.l.

16.3  Return of Employee Contributions.  If the amount of any Participant's
      --------------------------------
      Participant Elected Contributions is determined to be an excess Annual
      Addition under this Article, then the amount of such excess (adjusted to
      reflect any earnings, appreciation or losses attributable to such excess)
      shall be refunded by the Trustee in cash to the Participant.

16.4  Excess Company Contributions.  If the amount of the Company Contributions
      ----------------------------
      allocated to a Participant for any Plan Year must be reduced to meet the
      limitation described in Section 16.1, then the amount of the reduction
      shall be applied to reduce the total amount that the Participating
      Companies otherwise would contribute for such year pursuant to Article 5
      of the Plan. If the amount that the Participating Companies may contribute
      is thereby reduced to zero and if there are Company Contributions that
      still cannot be allocated to any Participant because of the limitation
      described in Section 16.1, then the excess shall be transferred to a
      suspense account. Any gains, income or losses attributable to the suspense
      account shall be allocated to such account. All amounts credited to the
      suspense account shall be applied to reduce the total amount that the
      Participating Companies otherwise would contribute to the Plan for the
      next Plan Year, and for succeeding Plan Years if necessary. Such amounts
      shall be allocated among Participants pursuant to Article 5 of the Plan
      until the suspense account is exhausted (subject to this Article). No
      Participant Elected Contributions or Company Contributions shall be made
      as long as any amount remains in the suspense account.

16.5  Special Definitions Used in this Article 16.  The following definitions
      -------------------------------------------
      shall apply for purposes of this Article 16.

      (a) "Annual Additions" means, for any Plan Year, the sum of the following:
           ----------------

          (1)  The amount of after-tax contributions that the Participant
               contributes during such year to all qualified retirement plans,
               other than this Plan, maintained by the Section 415 Employer
               Group;

                                       46

          (2)  The amount of elective contributions that the Participant
               contributes during such year to all qualified retirement plans,
               other than this Plan, maintained by the Section 415 Employer
               Group;

          (3)  The amount of Participant Elected Contributions that the
               Participant contributes during such year;

          (4)  The amount of employer contributions and forfeitures allocated to
               the Participant under any qualified defined contribution plan
               that may be maintained by the Section 415 Employer Group, other
               than this Plan, as of any date within such year; and

          (5)  The amount of Company Contributions and Forfeitures allocated to
               the Participant as of any date within such year.

      (b) "Section 415 Compensation" means any one of the definitions of Section
           ------------------------
          414(s) Compensation described in Paragraphs (1), (2), (3) or (4) of
          Section 13.9(e) received by an Employee from members of the Section
          415 Employer Group. Any definition of Section 415 Compensation shall
          be used consistently to define the compensation of all Employees taken
          into account in satisfying the requirements of an applicable provision
          of the Plan for the relevant determination period.

      (c) "Section 415 Employer Group" means the Affiliated Group, except that
           --------------------------
          "more than 50 percent" shall be substituted for "at least 80 percent"
          wherever the phrase occurs in Section 1563(a) of the Code (as
          incorporated by reference in Sections 414(b) and (c) of the Code).

17.1  Control and Management of Plan Assets.  The Company is a named fiduciary
      -------------------------------------
      with respect to control over and management of the assets of the Plan, but
      only to the extent of having the authority (a) to appoint one or more
      trustees to hold assets of the Plan in trust and to enter into a trust
      agreement with each trustee it appoints, (b) to appoint one or more
      insurance companies that are qualified to do business in at least one
      state to hold assets of the Plan and to enter into a contract with each
      insurance company it appoints (or to direct the Trustee to enter into such
      contract), (c) to appoint one or more Investment Managers for any assets
      of the Plan and to enter into an investment management agreement with each
      Investment Manager it appoints, and (d) to direct the investment of any
      Plan assets not assigned to an Investment Manager.

                                       47

17.2  Trustee Duties.  The Trustee shall have the exclusive authority and
      --------------
      discretion to control and manage assets of the Plan it holds in trust,
      except to the extent that (a) the Plan prescribes how such assets shall be
      invested, (b) the Company directs how such assets shall be invested or (c)
      the Company allocates the authority to manage such assets to one or more
      Investment Managers. Each Investment Manager shall have the exclusive
      authority to manage, including the authority to acquire and dispose of,
      the assets of the Plan assigned to it by the Company, except to the extent
      that the Plan prescribes or the Company directs how such assets shall be
      invested. Each Trustee and Investment Manager shall be solely responsible
      for diversifying, in accordance with Section 404(a)(1)(C) of ERISA, the
      investment of the assets of the Plan assigned to it by the Company, except
      to the extent that the Plan prescribes or the Company directs how such
      assets shall be invested.

17.3  Independent Qualified Public Accountant.  The Company shall engage an
      ---------------------------------------
      independent qualified public accountant to conduct such examinations and
      to express such opinions as may be required by Section 103(a)(3) of ERISA.
      The Company in its discretion may remove and discharge the person so
      engaged, in which event it shall appoint a successor independent qualified
      public accountant to perform such examinations and express such opinions.

17.4  Administrative Expenses.  All expenses of the Plan and the Trust Fund
      -----------------------
      shall be paid by the Participating Companies and by the Trust Fund. The
      Company shall have complete and unfettered discretion to determine whether
      an expense of the Plan shall be paid out of the Trust Fund or by the
      Participating Companies, and the Company's discretion and authority to
      direct the payment of expenses out of the Trust Fund shall not be limited
      in any way by any prior decision or practice regarding the payment of Plan
      expenses.

17.5  Benefit Payments. All benefits payable pursuant to the Plan shall be paid
      ----------------
      by the Trustee out of the Trust Fund pursuant to the directions of the
      Company and the terms of the Trust Agreement.

18.1  Plan Administration.  The Company is the named fiduciary that has the
      -------------------
      discretionary authority to control and manage the operation and
      administration of the Plan, and the Company is the "administrator" and
      "plan sponsor" of the Plan (as such terms are used in ERISA). The Company
      in its sole discretion shall make such rules, interpretations and
      computations and shall take such other actions to administer the Plan as
      it may deem appropriate. Such rules, interpretations, computations and
      actions shall be conclusive and binding on all persons. In administering
      the Plan, the Company (a) shall act in a nondiscriminatory manner to the
      extent required by Section 401(a) and related

                                       48

      sections of the Code and (b) shall at all times discharge its duties in
      accordance with the standards set forth in Section 404(a)(1) of ERISA.

18.2  Employment of Advisers.  The Company may retain such attorneys,
      ----------------------
      accountants, consultants or other persons to render advice or to perform
      services with regard to its responsibilities under the Plan as it shall
      determine to be necessary or desirable. The Company may designate by
      written instrument (signed by both parties) one or more persons to carry
      out, where appropriate, fiduciary responsibilities under the Plan. The
      Company's duties and responsibilities under the Plan that have not been
      delegated to other fiduciaries pursuant to the preceding sentence shall be
      carried out by its directors, officers and employees, acting on behalf and
      in the name of the Company in their capacities as directors, officers and
      employees, and not as individual fiduciaries.

18.3  Service in Several Fiduciary Capacities.  Nothing herein shall prohibit
      ---------------------------------------
      any person or group of persons from serving in more than one fiduciary
      capacity with respect to the Plan.

19.1  Applications for Benefits.  Any application for benefits under the Plan
      -------------------------
      shall be submitted to the Company at its principal office. Such
      application shall be in writing on the prescribed form and shall be signed
      by the applicant.

19.2  Denial of Applications.  In the event that any application for benefits is
      ----------------------
      denied in whole or in part, the Company shall notify the applicant in
      writing of the right to a review of the denial. Such written notice shall
      set forth, in a manner calculated to be understood by the applicant,
      specific reasons for the denial, specific references to the Plan
      provisions on which the denial was based, a description of any information
      or material necessary to perfect the application, an explanation of why
      such material is necessary, and an explanation of the Plan's review
      procedure. Such written notice shall be given to the applicant within 90
      days after the Company receives the application, unless special
      circumstances require an extension of time for processing the application.
      In no event shall such an extension exceed a period of 90 days from the
      end of the initial 90-day period. If such an extension is required,
      written notice thereof shall be furnished to the applicant before the end
      of the initial 90-day period. Such notice shall indicate the special
      circumstances requiring an extension of time and the date by which the
      Company expects to render a decision. If written notice is not given to
      the applicant within the period prescribed by this Section 19.2, the
      application shall be deemed to have been denied for purposes of Section
      19.4 upon the expiration of such period.

                                       49

19.3  Review Panel.  The Company from time to time shall appoint a Review Panel.
      ------------
      The Review Panel shall consist of three or more individuals who may (but
      need not) be employees of the Company and shall be the named fiduciary
      with the authority to act on any employee benefit appeal.

19.4  Requests for Review.  Any person whose application for benefits is denied
      -------------------
      in whole or in part (or such person's duly authorized representative) may
      appeal the denial by submitting to the Review Panel a request for a review
      of such application within 90 days after receiving written notice of the
      denial. The Review Panel shall give the applicant or such representative
      an opportunity to review pertinent documents (except legally privileged
      materials) in preparing such request for review and to submit issues and
      comments in writing. The request for review shall be in writing and shall
      be addressed to the Company's principal office. The request for review
      shall set forth all of the grounds on which it is based, all facts in
      support of the request, and any other matters which the applicant deems
      pertinent. The Review Panel may require the applicant to submit such
      additional facts, documents or other material as it may deem necessary or
      appropriate in making its review.

19.5  Decisions on Review.  The Review Panel shall act upon each request for
      -------------------
      review within 60 days after receipt thereof, unless special circumstances
      require an extension of time for processing, but in no event shall the
      decision on review be rendered more than 120 days after the Review Panel
      receives the request for review. If such an extension is required, written
      notice thereof shall be furnished to the applicant before the end of the
      initial 90-day period. The Review Panel shall give prompt, written notice
      of its decision to the applicant and to the Company. In the event that the
      Review Panel confirms the denial of the application for benefits in whole
      or in part, such notice shall set forth, in a manner calculated to be
      understood by the applicant, the specific reasons for such denial and
      specific references to the Plan provisions on which the decision is based.
      To the extent that the Review Panel overrules the denial of the
      application for benefits, such benefits shall be paid to the applicant.

19.6  Rules and Procedures.  The Review Panel shall adopt such rules and
      --------------------
      procedures, consistent with ERISA and the Plan, as it deems necessary or
      appropriate in carrying out its responsibilities under this Article 19.

19.7  Exhaustion of Administrative Remedies.  No legal or equitable action for
      -------------------------------------
      benefits under the Plan shall be brought unless and until the claimant (a)
      has submitted a written application for benefits in accordance with
      Section 19.1, (b) has been notified that the application is denied, (c)
      has filed a written request for a review of the application in accordance
      with Section 19.4, and (d) has been notified in writing that the Review
      Panel has affirmed the denial of the application; provided, however, that
      an action may be brought after the Company or the Review Panel

                                       50

      has failed to act on the claim within the time prescribed in Section 19.2
      and Section 19.5, respectively.

20.1  Right To Amend or Terminate.  The Company expects to continue the Plan
      ---------------------------
      indefinitely. However, future conditions cannot be foreseen, and the
      Company reserves the right at any time and for any reason, by action of
      its board of directors or by a person or persons acting pursuant to a
      valid delegation of authority, (a) to amend the Plan, (b) to reduce or
      discontinue Employee Contributions, Company Contributions or all
      Contributions or (c) to terminate the Plan and the Trust Fund.

20.2  Protection of Participants.  No amendment of the Plan shall reduce the
      --------------------------
      benefit of any Participant that accrued under the Plan prior to the date
      when such amendment is adopted, except to the extent that a reduction in
      accrued benefits may be permitted by the Code and ERISA. No Plan amendment
      or other action by the Company shall divert any part of the Plan's assets
      to purposes other than the exclusive purpose of providing benefits to the
      Participants and Beneficiaries who have an interest in the Plan and of
      defraying the reasonable expenses of administering the Plan.

20.3  Effect of Termination.  Upon termination of the Plan, no assets of the
      ---------------------
      Plan shall revert to any Participating Company or be used for, or diverted
      to, purposes other than the exclusive purpose of providing benefits to
      Participants and Beneficiaries and of defraying the reasonable expenses of
      termination. If the Plan is terminated or partially terminated, or if all
      contributions to the Plan are completely discontinued, then each
      Participant who then is an Employee and who is directly affected by such
      event shall have a 100 percent vested interest in each of his or her
      Accounts, without regard to the number of Years of Service he or she has
      completed.

20.4  Allocation of Trust Fund Upon Termination.  Upon termination of the Plan,
      -----------------------------------------
      the Trust Fund shall continue in existence until the Accounts of each
      Participant have been distributed to such Participant (or to his or her
      Beneficiary) pursuant to Article 8; provided, however, that the assets of
      the Plan shall be allocated in accordance with any applicable requirements
      under Section 403(d)(1) of ERISA.

20.5  Partial Termination.  Upon a partial termination of the Plan, Sections
      -------------------
      20.3 and 20.4 shall apply with respect to such Participants and
      Beneficiaries as are affected by such partial termination.

21.1  Plan Mergers.  The Plan shall not merge or consolidate with, or transfer
      ------------
      assets or liabilities to, any other plan unless each Participant would
      receive a benefit immediately after such merger, consolidation or transfer
      (if the Plan then terminated) that is equal to or greater than the benefit
      that such Participant would have been entitled to receive immediately
      before the merger, consolidation or transfer (if the Plan had then
      terminated).

21.2  No Assignment of Property Rights.  Except as otherwise provided in Article
      --------------------------------
      9 with respect to QDROs or as provided in the following sentence, the
      interest or property rights of any Participant or Beneficiary in the Plan,
      in the Trust Fund or in any distribution to be made under the Plan shall
      not be subject to option nor be assignable, either by voluntary or
      involuntary assignment or by operation of law, including (without
      limitation) bankruptcy, garnishment, attachment or other creditor's
      process, and any act in violation of this Section 21.2 shall be void.
      Notwithstanding any Plan provision to the contrary, a Participant's Plan
      benefits shall be reduced by any amount such Participant is ordered or
      required to pay to the Plan if the order or requirement to pay arises (i)
      under a judgement or conviction for a crime involving the Plan (ii) under
      a civil judgment (including a consent order or decree) entered by a court
      in an action brought in connection with a breach (or alleged breach) of
      fiduciary duty under ERISA, or (iii) pursuant to a settlement agreement
      entered into by the Participant and the Secretary of Labor in connection
      with a breach of fiduciary duty under ERISA by a fiduciary or any other
      person; provided, however, that the judgment, order, decree, or settlement
      agreement expressly provides for the offset of all or part of the amount
      ordered or required to be paid to the Plan against the Participant's
      benefits under the Plan.

21.3  No Employment Rights.  Nothing in the Plan shall be deemed to give any
      --------------------
      individual a right to remain in the employ of an Affiliate or affect the
      right of an Affiliate to terminate an individual's employment at will with
      or without cause, at any time with or without notice, for any reason or no
      reason, which right is hereby reserved.

21.4  Choice of Law.  The Plan and all rights thereunder shall be interpreted
      -------------
      and construed in accordance with ERISA and, to the extent that state law
      is not preempted by ERISA, the law of the State of California.

21.5  Voting of Company Stock.  Before each annual or special meeting of the
      -----------------------
      Company's shareholders, the Company shall cause to be sent to each
      Participant who has invested any part of his or her Account in the Company
      Stock fund the proxy statement and any related materials that are sent to
      the Company's registered shareholders. Each Participant shall have the
      right to instruct the Trustee confidentially (in writing on the prescribed
      form) with respect to the

                                       52

      voting at such meeting of the number of shares of Company Stock that were
      allocated to the Participant's Account as of the Valuation Date
      immediately preceding the record date for such meeting or such later date,
      up to and including the record date for such meeting, as the Plan
      Administrator may deem practicable. Such instructions shall be submitted
      to the Trustee by the date specified by the Company and, once received by
      the Trustee, shall be irrevocable. Under no circumstances shall the
      Trustee permit any Participating Company or any officer, employee or
      representative thereof to see any voting instructions given by a
      Participant to the Trustee. The Trustee shall vote any Company Stock for
      which it has not received timely written instructions in the same
      proportion as the Trustee votes the shares for which timely voting
      instructions have been received from Participants.

21.6  Tender Offers.  In the event that any person or group makes an offer
      -------------
      subject to Section 14(d) of the Exchange Act to acquire all or part of the
      outstanding Company Stock, including Company Stock held in the Plan
      ("Acquisition Offer"), each Participant shall be entitled to direct the
      Trustee confidentially (on a form prescribed by the Company) to tender all
      or part of those shares of Company Stock that would then be subject to
      such Participant's voting instructions under Subsection 21.5 above. If the
      Trustee receives such an instruction by a date determined by the Trustee
      and communicated to Participants, the Trustee shall tender such Company
      Stock in accordance with such instruction. Any Company Stock as to which
      the Trustee does not receive instructions within such period shall not be
      tendered by the Trustee. The Trustee shall obtain and distribute to each
      Participant all appropriate materials pertaining to the Acquisition Offer,
      including the statement of the position of the Company with respect to
      such offer issued pursuant to Regulation 14(e)-2 of the Exchange Act, as
      soon as practicable after such materials are issued, provided, however,
      that if the Company fails to issue such statement within five (5) business
      days after the commencement of such offer, the Trustee shall distribute
      such materials to each Participant without such statement by the Company
      and shall separately distribute such statement by the Company as soon as
      practicable after it is issued. The Trustee shall follow the procedures
      regarding confidentiality and verification of compliance with voting
      instructions described in Section 21.5 above.

22.1  Determination of Top-Heavy Status.  Any other provision of the Plan
      ---------------------------------
      notwithstanding, this Article shall apply to any Plan Year in which the
      Plan is a Top-Heavy Plan. The Plan shall be considered a "Top-Heavy Plan"
      for a Plan Year if, as of the Determination Date for such Plan Year, the
      Top-Heavy Ratio for the Aggregation Group exceeds 60 percent.

                                       53

22.2  Minimum Allocations.  For any Plan Year during which the Plan is a Top-
      -------------------
      Heavy Plan, the Company Contributions (exclusive of Qualified Nonelective
      Contributions and Qualified Matching Contributions) allocated to the
      Account of each Participant who is not a Key Employee, but who is an
      Employee on the last day of such Plan Year, shall not be less than the
      lesser of the following amounts:

      (a) Three percent of his or her Top-Heavy Compensation; or

      (b) A percentage of his or her Top-Heavy Compensation equal to the
          greatest allocation of Company Contributions and Participant Elected
          Contributions, expressed as a percentage of Top-Heavy Compensation,
          made on behalf of any Participant who is a Key Employee.

22.3  Impact on Maximum Benefits.  For any Plan Year in which the Plan is a Top-
      --------------------------
      Heavy Plan, the number "1.00" shall be substituted for the number "1.25"
      wherever it appears in Section 415(e)(2) and (3) of the Code.

22.4  Special Definitions.  For purposes of this Article 22, the following
      -------------------
      definitions shall apply:

      (a) "Aggregation Group" means either the Required Aggregation Group or any
           -----------------
          Permissive Aggregation Group, as the Company may elect.

      (b) "Determination Date" means the December 31 next preceding the
           ------------------
          applicable Plan Year.

      (c) "Key Employee" means a "key employee" (within the meaning of Section
           ------------
          416(i) of the Code). In applying Section 416(i) of the Code, "annual
          compensation" shall mean Top-Heavy Compensation

      (d) "Permissive Aggregation Group" means a group of qualified plans that
           ----------------------------
          includes (1) the Required Aggregation Group and (2) one or more plans
          of the Affiliated Group that are not part of the Required Aggregation
          Group. A Permissive Aggregation Group, when viewed as a single plan,
          must satisfy the requirements of Sections 401(a)(4) and 410 of the
          Code.

      (e) "Required Aggregation Group" means a group of qualified plans that
           --------------------------
          includes (1) each plan of the Affiliated Group in which a Key Employee
          is a participant and (2) each other plan of the Affiliated Group that
          enables any plan in which a Key Employee participates to meet the
          requirements to Section 401(a)(4) or 410 of the Code.

      (f) "Top-Heavy Compensation" means Section 415 Compensation, as defined in
           ----------------------
          Section 16.5(b); provided, however, that Top-Heavy

                                       54

          Compensation shall not include any amount paid to a Participant for
          the Plan Year in excess of the Compensation Limitation.

      (g) "Top-Heavy Ratio" means a percentage determined pursuant to Section
           ---------------
          416(g) of the Code.

22.5  Top-Heavy Vesting Rules.
      ----------------------

      (a) The vested interest in the Nonelective Account of each Participant
          with one or more Hours of Service in a Plan Year in which the Plan is
          a Top-Heavy Plan shall be determined in accordance with the following

schedule:

Years of Service                             Vested Percentage
----------------                             -----------------
Less than 2                                  0%
2 but less than 3                            20%
3 but less than 4                            40%
4 but less than 5                            60%
5 or more                                    100%

The vested interest in the Matching Contributions Account of each Participant with one or more Hours of Service in a Plan Year in which the Plan is a Top-Heavy Plan shall be determined under Section 7.2.

(b) If the Plan ceases to be a Top-Heavy Plan, the vesting rules described in Section 7.3 shall again apply to all Years of Service with respect to the Participant's Nonelective Account; however, any Participant described in Subsection (a) who has at least three (3) Years of Service to his or her credit at the time the Plan ceases to be a Top- Heavy Plan shall continue to have his or her vested percentage computed under the Plan in accordance with Subsection (a).

To record the amendment and restatement of the Plan as set forth herein, effective as of October 23, 2000, the Company has caused its authorized officer to execute the same this 6th day of December, 2000.

AMGEN INC.

By: /s/ Steven M. Odre
    ----------------------------
    Steven M. Odre, Senior Vice
    President, General Counsel and
    Secretary

Amgen (Bermuda) Clinical Development, Limited Amgen (Bermuda) Clinical Development 2, Limited Amgen (Bermuda) Clinical Development 3, Limited Amgen (Bermuda) Clinical Development 4, Limited Amgen (Bermuda) Clinical Development 5, Limited Amgen (Bermuda) Clinical Development 6, Limited Amgen (Bermuda) Clinical Development 7, Limited Amgen (Bermuda) Clinical Development 8, Limited

EXHIBIT 10.14

FIRST AMENDMENT TO THE
AMGEN RETIREMENT AND SAVINGS PLAN
AS AMENDED AND RESTATED EFFECTIVE OCTOBER 23, 2000

The Amgen Retirement and Savings Plan as Amended and Restated Effective October 23, 2000, (the "Plan") is hereby amended as follows:

1. Effective December 14, 2000, Kinetix Pharmaceuticals, Inc. shall be a Participating Company for so long as Kinetix Pharmaceuticals, Inc. remains in existence, and Appendix A to the Plan is thereby amended to include Kinetix Pharmaceuticals, Inc.

2. Effective midnight of January 1, 2001, the Kinetix Pharmaceuticals, Inc.
401(k) Plan shall be merged into the Plan to coincide with the upstream merger of Kinetix Pharmaceuticals, Inc. into the Company. The merged Plan will conform to the terms of the Plan. Thereafter, Kinetix Pharmaceuticals, Inc. shall no longer be a Participating Company and Appendix A to the Plan is thereby amended to delete Kinetix Pharmaceuticals, Inc.

3. Effective June 1, 2001, annuities will be eliminated as a form of distribution. This effective date is at least 90 days following the date on which notice will be provided to Plan participants of the elimination. As such:

a. Section 2.41 is deleted in its entirety.

b. Section 2.47 is deleted in its entirety.

c. Section 8.3 (a) restated in its entirety to read:

Except as provided in Sections 8.5, 8.8 and 8.10, and unless a Participant elects otherwise, the distribution of a Participant's Plan Benefit under Section 8.6 shall occur or commence not later than sixty (60) days after the close of the Plan Year in which occurs the later of (i) the Participant's attainment of Normal Retirement Age or (ii) the Participant's termination of employment. If distribution of a Participant's Plan Benefit has not yet occurred, on or about nine (9) months before the Participant's Normal Retirement Date, the Company shall furnish the Participant with a written explanation of the terms, conditions and forms of distributions available from the Plan with a description of the procedures for electing a form of distribution.

d. Section 8.6 (a) is restated to read:

A Participant's Plan Benefit shall be distributed in any of the following forms that he or she elects:

e. Sections 8.6 (a) (5) is deleted in its entirety.

f. Section 8.7 is deleted in its entirety.

g. Section 8.8 is restated in its entirety to read:

h. Section 8.9 is deleted in its entirety.

i. Section 8.13 is restated in its entirety to read:

To record this First Amendment to the Plan as set forth herein, the Company has caused its authorized officer to execute this document this 26th day of February, 2001.

AMGEN INC.

By:  /s/ Steven M. Odre
     --------------------------------
Title:  Senior Vice President, General
Counsel and Secretary

G-CSF UNITED STATES LICENSE AGREEMENT

by and between

KIRIN-AMGEN, INC.,

a California corporation

and

AMGEN INC.,

a Delaware corporation

                                                                            Page
                                                                            ----
RECITALS.                                                                      1
I.       DEFINITIONS.....................................................      2

         1.01   Incorporation by Reference...............................      2
         1.02   Territory................................................      2
         1.03   Party....................................................      2
         1.04   G-CSF....................................................      2
         1.05   G-CSF Products...........................................      2
         1.06   G-CSF Technology.........................................      2
         1.07   Subsidiary...............................................      3
         1.08   Sales Value..............................................      3

II.      GRANT OF LICENSE................................................      3

         2.01 Grant of License...........................................      3
         2.02 Rights to Sublicense.......................................      3

III.     DISCLOSURE......................................................      4

         3.01   Disclosure...............................................      4
         3.02   Confidentiality..........................................      5

IV.      ROYALTY.........................................................      7

         4.01   Royalty..................................................      7
         4.02   Sales to Subsidiaries....................................      7
         4.03   Payment of Royalties to Sloan Kettering Cancer Center....      7
         4.04   Records..................................................      7
         4.05   Terms of Accounting......................................      7
         4.06   Late Payments............................................      8
         4.07   Payments.................................................      9
         4.08   Taxes....................................................      9

V.       PATENT APPLICATIONS.............................................     10

         5.01   Patent Applications......................................     10

VI.      PATENT AND TRADE SECRET ENFORCEMENT.............................     10

         6.01   Enforcement..............................................     10
         6.02   Infringements............................................     10
         6.03   Maintenance of Action....................................     11

TABLE OF CONTENTS (Cont'd)

Page

VII. TERM AND TERMINATION............................................. 12

7.01   Term......................................................    12
7.02   Effective Date............................................    13
7.03   Default...................................................    13
7.04   Survival..................................................    13

VIII. INFRINGEMENTS.................................................... 14

8.01 Infringements............................................. 14

         9.01   Best Efforts..............................................    14

X.       NOTICE...........................................................    15

         10.01  Notices...................................................    15

         11.01  Entire Agreement..........................................    16
         11.02  Headings..................................................    16
         11.03  Execution in Counterparts.................................    16
         11.04  Force Majeure.............................................    16
         11.05  Applicable Law............................................    17
         11.06  Assignment on Written Consent.............................    17
         11.07  Severability..............................................    17
         11.08  No Waiver.................................................    17
         11.09  Trademarks and Tradenames.................................    18
         11.10  Indemnity.................................................    18
         11.11  Other Agreements..........................................    18
         11.12  Remedies..................................................    18
         11.13  Attorneys' Fees and Costs.................................    19
         11.14  Number and Gender.........................................    19
         11.15  Agreement to Perform Necessary Acts.......................    20
         11.16  Representations...........................................    20

SIGNATURE PAGE............................................................    21

EXHIBIT "A", G-CSF

THIS AMGEN/KIRIN-AMGEN, INC. G-CSF UNITED STATES LICENSE AGREEMENT ("Agreement") is made and entered into this lst day of June, 1987 and is made effective as of the 1st day of July, 1986, by and between KIRIN-AMGEN, INC., a California corporation ("Company"), and AMGEN INC., a Delaware corporation ("Amgen").

RECITALS

WHEREAS, effective July 1, 1986, KIRIN BREWERY CO., LTD., a Japanese corporation ("Kirin"), and Amgen assigned all of their right, title and interest in and to the G-CSF Technology (as defined herein) to Company,

WHEREAS, Kirin and Amgen are each being granted a license by Company for the development, manufacture and sale of G-CSF Products (as defined herein), in Japan with respect to Kirin, and in the United States with respect to Amgen,

WHEREAS, Company now desires to more formally document the license agreements from Company to Kirin and Amgen embodied in Amendment No. 3 to the Shareholders' Agreement among Company, Kirin and Amgen dated May 11, 1984, as amended, and certain agreements among Kirin, Amgen, and Company, and

WHEREAS, Company now desires to grant Amgen an exclusive license to further develop, manufacture, and sell G-CSF Products for the territory of the United States (as defined herein),

NOW, THEREFORE, in consideration of the mutual covenants expressed herein and other good and valuable consideration, the parties hereby agree as follows:

ARTICLE I

ARTICLE II

With the prior written consent of Company, which consent shall not be unreasonably withheld, Amgen shall have the right to sublicense any of the rights granted to it under this Agreement; provided, however, that any such sublicensee of Amgen shall undertake in writing to be bound by the provisions of
Section 3.02 hereof to the same extent Amgen is bound. Amgen shall notify the Company of the identity of each sublicensee to whom a sublicense is granted and provide the Company a true copy of such sublicense. In the event that the license granted to Amgen hereunder is terminated at any time in accordance with Article VII, and the Company shall not be in default under Section 7.03, the Company shall have the option to terminate or to have Amgen assign to the Company, retroactive to the date of such termination, any sublicenses granted hereunder by Amgen. Amgen shall include, in all its sublicenses granted hereunder provisions for such termination and assignment.

ARTICLE III

(a) The Company shall, in accordance with the Shareholders' Agreement, reasonably disclose and deliver to Amgen all G-CSF Technology in sufficient detail to permit Amgen to employ such data for the purposes provided herein.

(b) Amgen shall have the right to attend and participate in the Company's technical meetings, conduct plant visits at reasonable intervals and receive information concerning the G-CSF Technology. Amgen shall be provided with reasonable notice of the time and place of such meetings.

(a) Any secret or confidential G-CSF Technology which is disclosed to Amgen pursuant to this Agreement or the Shareholders' Agreement, shall be designated as confidential information in the following manner:

(i) If the disclosure is in written form, by prominently marking or stamping each document containing such information with a notice indicating the confidential and proprietary nature of the information; and
(ii) If the disclosure is in oral form, by orally stating at the time of such disclosure that the information disclosed is confidential and proprietary and by delivering to Amgen within fifteen (15) days of the oral disclosure written notice confirming the confidential and proprietary nature of the information.

(b) Except to the extent expressly authorized by this Agreement, the Shareholders' Agreement, or by another prior written consent of the Company, for the term of this Agreement and thereafter, Amgen shall keep completely confidential and shall not publish or otherwise disclose to others and shall not use any secret or confidential G-CSF Technology disclosed or provided to Amgen by the Company. For the purposes of this

Agreement, G-CSF Technology shall be deemed not secret or confidential to the extent, and only to the extent, that it:

(i) was known to Amgen at the time of its disclosure and not otherwise subject to an obligation of Amgen to keep such information confidential;

(ii) was generally available to the public or was otherwise part of the public domain at the time of its disclosure:

(iii) became generally available to the public or became otherwise part of the public domain after its disclosure and other than through any act or omission of Amgen in breach of this Agreement; or

(iv) became known to Amgen after its disclosure (A) from a source other than the Company (including from independent development by Amgen), (B) other than from a third party who had an obligation to the Company not to disclose such information to others, and (C) other than under an obligation of confidentiality. Amgen may disclose any G-CSF Technology to the extent such disclosure or delivery is necessary for Amgen to comply with laws or regulations, or to make, use or sell under any license granted hereunder by the Company or to sublicense others to do so; provided, that Amgen shall give the Company reasonable advance notice of such proposed disclosure or delivery, shall use its best efforts to secure confidential treatment of the

G-CSF Technology to be disclosed and shall advise the Company in writing of the manner in which that was done.

(c) The obligation of confidentiality imposed by this Section 3.02 shall survive termination of this Agreement for any reason whatsoever.

ARTICLE IV

responsibility for any and all such royalties in excess of five percent (5%).

(a) Within sixty (60) days after the end of each semiannual period ending on June 30th or December 31st, commencing with the semiannual period within which is made the first sale of G-CSF Products by Amgen, Amgen shall furnish to the Company a statement, in form acceptable to the Company, certified by a responsible official of Amgen showing all G-CSF Products sold during such semiannual period, the Sales Value of

such G-CSF Products and the amount of royalty payable thereon (or if no G-CSF Products have been so sold, showing that fact).

(b) Within such sixty (60) days Amgen shall, irrespective of its own business and accounting methods, pay to the Company the royalties payable for such semiannual period.

(c) Amgen shall furnish whatever additional information the Company may reasonable prescribe from time to time to enable the Company to ascertain which G-CSF Products sold by Amgen or any of its Subsidiaries or sublicensees permitted under this Agreement are subject to the payment of royalty to the Company, and the amount of royalty payable thereon.

or transfer of licenses or other rights or considerations hereunder, and any tax which Amgen is required to withhold or deduct from payments to the Company, except any such tax imposed upon the Company by any governmental entity within or without the United States.

ARTICLE V

ARTICLE VI

the making, use or sale of G-CSF Products. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company its reasonable expenses (excluding its attorney's fees) in connection with any such suit or action. Should Amgen lack standing to bring any such action then Amgen may cause the Company to do so upon first undertaking to indemnify and hold the Company harmless (to the extent permissible by law) from all consequent liability and to promptly reimburse all reasonable expenses (including attorney fees) stemming therefrom. Any amount recovered in any such action or suit, whether by judgment or settlement, shall be paid to or retained entirely by Amgen.

represented by counsel of its choice unless the Company and Amgen otherwise agree, any amount recovered in any such action, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained by Amgen. In the event the Company fails to take action with respect to such infringement within a reasonable period, no less than six (6) months, following receipt of such notice and evidence, Amgen shall have the right to bring, defend and maintain any appropriate suit or action involving such infringement. If Amgen finds it necessary to join the Company in such suit or action, the Company shall execute all papers and perform such other acts as may be reasonably required and may, at its option, be represented by counsel of its choice. Amgen shall pay to the Company the reasonable expenses of the Company (excluding attorney's fees) in connection with any such suit or action. Any amount recovered in any such action or suit, whether by judgment or settlement, after payment to the Company of such reasonable costs and expenses (excluding attorney's fees), shall be paid to or retained entirely by Amgen.

ARTICLE VII

ARTICLE VIII

ARTICLE IX

 "Amgen"                                    Amgen Inc.
                                            1900 Oak Terrace Lane
                                            Thousand Oaks, CA 91320
                                            U.S.A.
                                            Telex No. 499-9315 (AMGEN)
                                            Attn: Corporate Secretary

 With a copy to:                            Cooley, Godward, Castro,
                                            Huddleson & Tatum
                                            Five Palo Alto Square, 4th Floor
                                            Palo Alto, CA 94306
                                            U.S.A.
                                            Telex No. 910-372-7370 Cooley SFO
                                            Attn: Alan C. Mendelson, Esq.

                                      -15-

"Company"                                   Kirin-Amgen, Inc
                                            1900 Oak Terrace Lane
                                            Thousand Oaks, CA 91320
                                            U.S.A.
                            _               Telex No. 4994440 (AMGEN)
                                            Attn: Corporate Secretary

With a copy to:                             Pettit & Martin
                                            355 South Grand Avenue
                                            Thirty-Third Floor
                                            Los Angeles, CA 90071
                                            Telex No. 181025 PEMLAW LSA
                                            Attn: Joel S. Marcus, Esq.

Any party by giving notice to the others in the manner provided above may change such party's address for purposes of this Section 10.01.

ARTICLE XI

herein shall not in any way be affected or impaired thereby. In such event, such invalid provision or provisions shall be validly reformed to as nearly approximate the intent of the parties as possible and if unreformable, shall be severed and deleted from this Agreement.

fees may be included in and as part of such judgment. The successful party shall be the party who is entitled to recover its costs of suit, whether or not the suit proceeds to final judgment. A party not entitled to recover its costs shall not recover attorneys' fees.

[SIGNATURE PAGE FOLLOWS]

IN WITNESS WHEREOF, the parties have caused this Agreement to be executed by their duly authorized representatives in the manner legally binding on them as of the date first above written.

KIRIN-AMGEN, INC., a
California corporation

By /s/ Y. Yamamoto
          Its --------
  -------------------------

"Company"

AMGEN INC., a Delaware corporation

By /s/ George B. Rathmann
  --------------------------
  -------- Its
                                "Amgen"

Amino acids [23-30] Lys Ile Gln Gly Asp Gly Ala Ala
mRNA AAG AUC CAG GGC GAU GGC GCA GCG

Probes [24-23 mers TTC TAC GTC CCT CTA CCT GGT CG

B -12 -10

ELU TRP HIS SER ALA LEU TRP THR VAL GLN GLU ALA THR PRO LEU CIG TGG CAC AGI GIA CIC TGG ACR GIG CAG GAA GCC ACC CCC CIG

10

ALY PRO ALA SER SER LEU PRO GLN SER PHE LEU LEU LYS CYS LEU GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC AAG TGC TTA

20 30 phe ALU GLN VAL ARG LYS ILE GLN GLY ASP GLY ALA ALA LEU GLN GLN GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG

gly

LYS LEU CYS ALA THR TYR LYS LEU CYS HIS PRO GLU GLU LEU VAL AAG CTG TGT GCC ACC TAC AAG CTG TGT CAC CCC GAG GAG CTG GTG

50 60 LEU LEU GLY HIS SER LEU GLY ILE PRO TRP ALA PRO LEU SER SER CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC CTG AGC AGC

CYS PRO SER GLN ALA LEU GLN LEU ALA GLY CYS LEU SER GLN LEU TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC CAA CTC

80 90 HIS SER GLY LEU PHE LEU TYR GLN GLY LEU LEU GLN ALA LEU GLN CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG GCC CTG GAA

GLY ILE SER PRO GLU LEU GLY PRO THR LEU ASP THR LEU GLN LEU GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG

110 120 ASP VAL ALA ASP PHE ALA THR THR ILE TRP GLN GLN MET GLU GLU GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA

LEU GLY MET ALA PRO ALA LEU GLN PRO THR GLN GLY ALA MET PRO CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT GCC ATG CCG

140 150 ALA PHE ALA SER ALA PHE GLN ARG ARG ALA GLY GLY VAL LEU VAL GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT

ALA SER HIS LEU GLN SER PHE LEU GLU VAL SER TYR ARG VAL LEU GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA

170 174 ARG HIS LEU ALA GLN PRO OP CGC CAC CTT GCC CAG CCC TGA GCCAAGCCCTCCCCATCCCATGTATTTATCT

tsa (pound) 1, c CTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGG AGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCA GTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCA AGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGC CGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTC CCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGG TCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGG CTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCC CACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACT CCCGAACATCACCGACGTGTCTCCTGTTTTTCTGGGTGGCCTCGGGACACCTGCCCTGC CCCCACGAGGGTCAGGACTGTGACTCTTTTTAGGGCTAGGCAGGTGCCTGGACATTTGC CTTGCTGGACGGGGACTGGGGATGTGGGAGGGAGCAGACAGGAGGAATCATGTCAGGCC TGTGTGTGAAAGGAAGCTCCACTGTCACCCTCCACCTCTTCACCCCCCACTCACCAGTG TCCCCTCCACTGTCACATTGTAACTGAACTTCAGGATAATAAAGTGTTTGCCTCCAA EXHIBIT "A"

THIS AMENDMENT N0. 1 ("Amendment No. 1") TO THAT CERTAIN KIRIN-AMGEN, INC./AMGEN G-CSF UNITED STATES LICENSE AGREEMENT ("License Agreement"), is made and entered into this 20th day of October, 1988, by and between AMGEN INC., a Delaware corporation ("Amgen"), and KIRIN-AMGEN, INC., a California corporation ("Corporation").

R E C I T A L S

A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF.

B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 1.

NOW, THEREFORE, it is agreed as follows:

1. Article I, Section 1.08 at page 3 of the License Agreement is hereby deleted and the following substituted in lieu thereof:

2. Except to the extent as provided herein, the provisions of the License Agreement are hereby ratified and confirmed in all respects.

IN WITNESS WHEREOF, the undersigned have caused this Amendment No. 1 to be executed as of the first day written above.

AMGEN INC.,
a Delaware corporation

By   /s/ George B. Rathmann
   George B. Rathmann, President
                           "Amgen"

KIRIN-AMGEN, INC.,
a California corporation

By   /s/ Yashushi Yamamoto
     Yasushi Yamamoto, Chairman
                           "Corporation"

R E C I T A L S

A. Amgen and Corporation have previously executed that certain License Agreement regarding G-CSF.

B. The parties desire to incorporate certain changes into the License Agreement pursuant to this Amendment No. 2.

NOW, THEREFORE, it is agreed as follows:

1. Article IV, Sections 4.01 and 4.03 at pages 7-8 of the License Agreement are hereby deleted and the following substituted in lieu thereof:

"ARTICLE IV

2. Except to the extent as provided herein, the provisions of the License Agreement, as amended, are hereby ratified and confirmed in all respects.

IN WITNESS WHEREOF, the undersigned has caused this Amendment No. 2 to be executed as of the first day written above.

AMGEN INC., a Delaware corporation

By /s/ Gordon M. Binder
Gordon M. Binder
Chief Executive Officer

"Amgen"

KIRIN-AMGEN, INC., a
Delaware corporation

By /s/ T. Sasahara
Toru Sasahara, Chairman


                      "Corporation"

By: /s/ Koichiro Aramaki
Koichiro Aramaki Ph.D.
Title: President, Pharmaceutical Div.

   November 28, 1996
Date

By: /s/ K. Sharer
       Kevin Sharer
Title:

      December 9, 1996
Date

By: /s/ Daryl Hill
         Daryl Hill
Title:

       December 9, 1996
Date

    /s/ Koichiro Aramaki
By: Koichiro Aramaki Ph.D.
Title: President, Pharmaceutical Div.


June 30, 2000
Date

   /s/ Craig Brooks
By: Craig Brooks
Title: Vice President,
       Asia Pacific/Latin America

June 30, 2000
Date

/s/ Katsuhiko Asano
 Katsuhiko Asano, Ph.D.
Chairman

June 30, 2000
Date

By /s/ George B. Rathmann
   -------------------------------------
   George B. Rathmann, President

By /s/ Y. Yamamoto
   ------------------------------------------
   Yashushi Yamamoto, Chairman

A              Amino acids [23-30]  Lys   Ile   Gln   Gly   Asp  Gly   Ala   Ala

               mRNA                 AAG AUC CAG GGC GAU GGC GCA GCG

               Probes [24-23 mers]  TTC TAC GTC CCT CTA CCT GGT CG

B -12  -10